Specific protein degradation system and application

Abstract

The invention provides a specific protein degradation system and application. A specific protein degradation system is introduced in the lentivirus production process, membrane proteins such as CAR on the surfaces of production cells are degraded, carrier surface membrane protein modification is reduced, and therefore the off-target risk is reduced, and the transduction efficiency is improved. The specific protein degradation system comprises a monovalent degradation agent, a disturbance type degradation agent, molecular glue and a difunctional degradation agent; the difunctional degradation agent comprises one or more of a lysosome targeting chimera, a proteolysis targeting chimera and an autophagy targeting chimera.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a specific protein degradation system and its application. Background Art

[0002] Advantages of in vivo CAR-T therapy: Simplifying the manufacturing process and reducing costs: In vivo CAR-T therapy does not require complex in vitro operations, which greatly simplifies the process, reduces the manufacturing cost, shortens the treatment time, and enables many patients to receive treatment (PMID: 29552577). Since in vivo CAR-T therapy does not require cell extraction and in vitro modification, the treatment can be initiated faster than in vitro CAR-T therapy. This is particularly beneficial for patients with rapidly progressing cancer, who may not have time to wait for the manufacturing process associated with in vitro CAR-T therapy (PMID: 28857075). In vivo CAR-T therapy does not need to rely on the patient's own T cells, so it may provide treatment for more patients. For individuals with low T cell counts or impaired immune systems, collecting enough T cells from the body for in vitro processing can be a challenging task. However, in vivo CAR-T therapy uses the patient's own cells and can be used in a wider clinical setting (PMID: 33603158). Since in vivo CAR-T therapy does not require customizing T cells for each patient, it is more suitable for large-scale production and distribution. The same gene editing components can be delivered to multiple patients, making this method more scalable and potentially expanding its application scope. The process of in vitro T cell processing is complex and may pose a risk of contamination because the cells are exposed to various in vitro environments. On the other hand, in vivo CAR-T therapy reduces this risk by directly editing cells in the patient's body, thus reducing exposure to the external environment (PMID: 31900462).

[0003] CAR-T cell therapy has important application prospects in the fields of tumors, autoimmune diseases, viral infections, and aging. However, the existing CAR-T cell preparation process is complex, including steps such as patient cell isolation, in vitro infection with VSV-G-coated lentivirus, amplification culture, and reinfusion, and the cost is high. If CAR-T cells can be generated in vivo, it is expected to significantly reduce the cost of CAR-T cells. Currently, there are still off-target problems in in vivo delivery: when delivered to a specific target in the body, it accidentally acts on non-target tissues or cells, resulting in adverse reactions or side effects. The off-target effect not only reduces the treatment effect but may also cause negative impacts such as toxicity and inflammation.

[0004] The main reasons are as follows: Non-specificity of the delivery system: The delivery vector may lack sufficient targeting ability, resulting in the widespread distribution of drugs or gene editing tools throughout the body rather than accumulation at specific sites. Molecular structure design problems: The designed molecules may interact with non-target genes, proteins, or receptors, leading to incorrect modification or activation. Complex in vivo environment: Factors such as blood flow and the immune system in the body may affect the distribution of drugs or editing tools, increasing the risk of off-target effects. PMID:27087594

[0005] Existing targeted degradation of CAR proteins is mostly used for considerations of in vivo safety to control the expression level of CAR. This degradation occurs on CAR-T cells to reduce the harm caused by cytokine storms and off-target effects of CAR-T cells (PMID: 33408186).

[0006] Existing in vivo CAR-T treatment technologies do not pay attention to the off-target effects caused by the modification of CAR on the vector. Summary of the Invention

[0007] In view of this, the present invention proposes a specific protein degradation system and its application. Based on the specific protein degradation system, this method targets and degrades membrane proteins such as CAR on the surface of producer cells during the production process of lentivirus. By introducing the specific protein degradation system, the CAR protein is degraded after plasmid transfection of the producer cells, reducing the modification of membrane proteins on the vector surface, thereby significantly reducing the off-target risk and improving the transduction efficiency. This method has broad application potential and is applicable to various vectors with cell membranes and membrane proteins that affect the targeting and stability of the vector.

[0008] The technical solutions provided by the present invention are as follows:

[0009] <First aspect>

[0010] A lentivirus prepared by using a specific protein degradation method, which introduces a specific protein degradation system during the production process of the lentivirus to degrade the membrane proteins on the surface of the lentivirus.

[0011] Furthermore, during the production process of the lentivirus, the specific protein degradation system is added to the sequence of the target gene of the delivery vector.

[0012] The principle of the present invention is as follows: The present invention modifies the target gene of the in vivo delivery vector (such as CAR), adds a targeting protein degradation system, degrades the protein expressed by the target gene during the vector production process, and reduces the influence of the target gene on the vector. For example, when the target gene is a membrane protein, the membrane protein will modify on the surface of the vector and affect the vector. When producing a lentiviral vector targeting T cells in vivo: If the CAR molecule is modified on the membrane of the vector during the production process, it will reduce the transduction efficiency and cause off-target effects in vivo.

[0013] The specific protein degradation system includes one of a monovalent degrader, a perturbing degrader, a molecular glue, and a bifunctional degrader; the bifunctional degrader includes one or more of a lysosome-targeting chimera, a proteolysis-targeting chimera, and an autophagy-targeting chimera.

[0014] The molecular glue protein includes a C2H2-type zinc finger active sequence or a modified sequence of the C2H2-type zinc finger active sequence;

[0015] And / or, the autophagy-targeting chimera includes a CPPLSS-targeting chimera.

[0016] The molecular glue protein is linked to the C-terminus of the membrane protein;

[0017] And / or, the C2H2-type zinc finger active sequence includes one or more of IKZF3, ZN827, ZFP91, ZN653, and ZN276;

[0018] And / or, the modified sequence of the C2H2-type zinc finger active sequence includes ZP1.

[0019] The amino acid sequence of IKZF3 is shown in SEQ ID NO.1.

[0020] The nucleotide sequence of IKZF3 satisfies one of the following conditions;

[0021] 1) The sequence shown in SEQ ID NO.2;

[0022] 2) A sequence that still has the same activity as the sequence shown in SEQ ID NO.2 after substitution, deletion, or addition of one or more base sequences to the sequence shown in SEQ ID NO.2.

[0023] The amino acid sequence of ZP1 is shown in SEQ ID NO.4.

[0024] The nucleotide sequence of ZP1 satisfies one of the following conditions;

[0025] 1) The sequence shown in SEQ ID NO.5;

[0026] 2) A sequence that still has the same activity as the sequence shown in SEQ ID NO.5 after substitution, deletion, or addition of one or more base sequences to the sequence shown in SEQ ID NO.5.

[0027] The amino acid sequence of the CPPLSS-targeting chimera is shown in SEQ ID NO.11.

[0028] The nucleotide sequence of CPPLSS satisfies one of the following conditions:

[0029] 1) The sequence shown in SEQ ID NO.12;

[0030] 2) A sequence which, after substitution, deletion, or addition of one or more base sequences to the sequence shown in SEQ ID NO.12, still has the same activity as the sequence shown in SEQ ID NO.12.

[0031] <Second aspect>

[0032] The present invention provides a method for preparing a lentivirus capable of targeting and degrading membrane proteins, in which a specific protein degradation system is introduced during the production process of the lentivirus to degrade the membrane proteins on the surface of the lentivirus.

[0033] Furthermore, during the production process of the lentivirus, the specific protein degradation system is added to the target gene sequence of the delivery vector to promote the degradation of the protein expressed by the target gene in the virus-producing cells.

[0034] The specific protein degradation system includes a monovalent degrader, a perturbing degrader, a molecular glue, and a bifunctional degrader; the bifunctional degrader includes one or more of a lysosome-targeting chimera, a proteolysis-targeting chimera, and an autophagy-targeting chimera.

[0035] The molecular glue protein includes a C2H2-type zinc finger active sequence, or a modified sequence of the C2H2-type zinc finger active sequence;

[0036] And / or, the autophagy-targeting chimera includes a CPPLSS-targeting chimera.

[0037] The molecular glue protein is linked to the C-terminus of the membrane protein;

[0038] And / or, the C2H2-type zinc finger active sequence includes one or more of IKZF3, ZN827, ZFP91, ZN653, and ZN276;

[0039] And / or, the modified sequence of the C2H2-type zinc finger active sequence includes ZP1.

[0040] The amino acid sequence of IKZF3 is as shown in SEQ ID NO.1 or SEQ ID NO.3.

[0041] The nucleotide sequence of IKZF3 satisfies one of the following conditions;

[0042] 1) The sequence shown in SEQ ID NO.2;

[0043] 2) A sequence which, after substitution, deletion, or addition of one or more base sequences to the sequence shown in SEQ ID NO.2, still has the same activity as the sequence shown in SEQ ID NO.2.

[0044] The amino acid sequence of the said ZP1 is as shown in SEQ ID NO.4.

[0045] The nucleotide sequence of the said ZP1 meets one of the following conditions:

[0046] 1) The sequence as shown in SEQ ID NO.5;

[0047] 2) A sequence which, after substitution, deletion, addition of one or several base sequences to the sequence as shown in SEQ ID NO.5, still has the same activity as the sequence as shown in SEQ ID NO.5.

[0048] The amino acid sequence of the said CPPLSS-targeted chimera is as shown in SEQ ID NO.11.

[0049] The nucleotide sequence of the said CPPLSS meets one of the following conditions:

[0050] 1) The sequence as shown in SEQ ID NO.12;

[0051] 2) A sequence which, after substitution, deletion, addition of one or several base sequences to the sequence as shown in SEQ ID NO.12, still has the same activity as the sequence as shown in SEQ ID NO.12;

[0052] <The third aspect>

[0053] A lentiviral vector fused with a targeted protein degradation fragment, comprising a CD19CAR fragment and a targeted protein degradation fragment ZP1; the amino acid sequence of the said ZP1 is as shown in SEQ ID NO.4; the sequence of the said CD19CAR fragment is as shown in SEQ ID NO.6.

[0054] The nucleotide sequence of the said ZP1 meets one of the following conditions:

[0055] 1) The sequence as shown in SEQ ID NO.5;

[0056] 2) A sequence which, after substitution, deletion, addition of one or several base sequences to the sequence as shown in SEQ ID NO.5, still has the same activity as the sequence as shown in SEQ ID NO.5.

[0057] The said ZP1 is linked to the C-terminus of the protein sequence of CD19CAR.

[0058] <The fourth aspect>

[0059] A method for preparing a lentiviral vector fused with a targeted protein degradation fragment, comprising the following steps:

[0060] S1. Synthesize the CD19 CAR fragment and the target protein degradation fragment ZP1 respectively; the sequence of the CD19 CAR fragment is as shown in SEQ ID NO.6; the amino acid sequence of the ZP1 is as shown in SEQ ID NO.4.

[0061] S2. Use homologous recombination to connect the target protein degradation fragment ZP1 to the C-terminus of the protein sequence of CD19 CAR to obtain a lentiviral vector fragment fused with the target protein degradation fragment, denoted as CD19CAR-ZP1; the sequence of the CD19CAR-ZP1 is as shown in SEQ ID NO.7.

[0062] The nucleotide sequence of the ZP1 satisfies one of the following conditions:

[0063] 1) The sequence as shown in SEQ ID NO.5;

[0064] 2) A sequence that still has the same activity as the sequence shown in SEQ ID NO.5 after substitution, deletion, addition of one or several base sequences to the sequence shown in SEQ ID NO.5.

[0065] <Fifth aspect>

[0066] A recombinant lentiviral shuttle plasmid, which contains the lentiviral vector fused with the target protein degradation fragment.

[0067] The preparation method of the recombinant lentiviral shuttle plasmid includes the following steps: ligate the linearized plasmid fragment with the lentiviral vector fragment fused with the target protein degradation fragment as claimed, and verify the ligation product to obtain the recombinant lentiviral shuttle plasmid.

[0068] The linearized plasmid fragment is obtained by digesting the vector pCCL-PGK-CD19CAR with XhoI and BamHI.

[0069] As an embodiment of the present invention, the preparation method of the recombinant lentiviral shuttle plasmid includes the following steps:

[0070] 1) Digest the vector pCCL-PGK-CD19CAR with XhoI and BamHI to obtain a linearized plasmid fragment; digest the CD19CAR lentiviral vector fused with the target protein degradation fragment with XhoI and BamHI to obtain the digested CD19CAR-ZP1 fragment;

[0071] 2) Ligate the linearized plasmid fragment and the digested CD19CAR-ZP1 fragment, and verify to obtain the recombinant lentiviral shuttle plasmid, denoted as pCCL-PGK-CD19CAR-ZP1.

[0072] <Sixth aspect>

[0073] A preparation method of a specific lentivirus targeting CD3-positive cells, comprising the following steps:

[0074] S1. Co-transfect a donor plasmid containing the scFv sequence targeting CD3, an auxiliary plasmid, and the recombinant lentiviral shuttle plasmid into virus-producing cells;

[0075] S2. After transfection, induce and culture with a culture medium containing an inducer; obtain a specific lentivirus targeting CD3-positive cells. (The inducer includes one or several of lenalidomide, pomalidomide, thalidomide).

[0076] The donor plasmid containing the scFv sequence targeting CD3 is pMD2.G-Nipah-F-G1-CD3 scFv;

[0077] And / or, the auxiliary plasmid includes pRSV.REV and pMDlg / pRRE.

[0078] <Seventh aspect>

[0079] A lentiviral vector fused with an autophagy-targeting chimera, comprising a CD19 Met1-Arg556 fragment and an autophagy-targeting chimera CPPLSS; the amino acid sequence of the CPPLSS is as shown in SEQ ID NO.11; the sequence of the CD19 Met1-Arg556 fragment is SEQ ID NO.10.

[0080] The autophagy-targeting chimera binds to the target protein CD19CAR through the CD19 Met1-Arg556 fragment and is then degraded through the lysosomal pathway.

[0081] The nucleotide sequence of the CPPLSS satisfies one of the following conditions:

[0082] 1) The sequence as shown in SEQ ID NO.12;

[0083] 2) A sequence that still has the same activity as the sequence shown in SEQ ID NO.12 after substitution, deletion, or addition of one or several base sequences to the sequence shown in SEQ ID NO.12.

[0084] The autophagy-targeting chimera CPPLSS is connected to the C-terminus of CD19 Met1-Arg556.

[0085] A preparation method of the lentiviral vector fused with an autophagy-targeting chimera, comprising the following steps:

[0086] S1. Synthesize the CD19 Met1-Arg556 fragment and the autophagy-targeting chimera CPPLSS respectively; wherein the amino acid sequence of the CPPLSS is as shown in SEQ ID NO.11; the sequence of the CD19 Met1-Arg556 fragment is SEQ ID NO.10;

[0087] S2. Use homologous recombination to connect CPPLSS to the C-terminus of the protein sequence of CD19 Met1-Arg556 to obtain the fragment CD19-G4S-CPPLSS; wherein the sequence of CD19-G4S-CPPLSS is as shown in SEQ ID NO.13.

[0088] <Eighth aspect>

[0089] An autophagy-targeting chimera expression plasmid, which comprises the lentiviral vector fused with the autophagy-targeting chimera as described above.

[0090] The preparation method of the autophagy-targeting chimera expression plasmid comprises the following steps: connecting the linearized plasmid fragment with the lentiviral vector fragment fused with the autophagy-targeting chimera, and verifying the connection product to obtain the autophagy-targeting chimera expression plasmid.

[0091] The linearized plasmid fragment is obtained by digesting the vector pMD2.G-Nipah-F-G1-CD3 scFv with XhoI and HinDIII.

[0092] <Ninth aspect>

[0093] A preparation method of a specific lentivirus targeting CD3-positive cells comprises the following steps: co-transfecting a donor plasmid containing the scFv sequence targeting CD3, an auxiliary plasmid, a lentiviral shuttle plasmid and the autophagy-targeting chimera expression plasmid into virus-producing cells; obtaining a specific lentivirus targeting CD3-positive cells.

[0094] The lentiviral shuttle plasmid includes pCCL-PGK-CD19CAR;

[0095] And / or, the donor plasmid containing the scFv sequence targeting CD3 is pMD2.G-Nipah-F-G1-CD3scFv;

[0096] And / or, the auxiliary plasmid includes pRSV.REV and pMDlg / pRRE.

[0097] A specific lentivirus targeting CD3-positive cells prepared by the preparation method of the specific lentivirus targeting CD3-positive cells as described above.

[0098] <Tenth aspect>

[0099] A method for preparing a non-specific lentivirus, comprising the following steps:

[0100] S1. Co-transfecting a donor plasmid, an auxiliary plasmid, and the recombinant lentiviral shuttle plasmid into virus-producing cells; the donor plasmid includes pMD2.G;

[0101] S2. After transfection, inducing and culturing with a culture medium containing an inducer; obtaining a non-specific lentivirus. The inducer includes one or more of lenalidomide, pomalidomide, and thalidomide.

[0102] The auxiliary plasmid includes pRSV.REV and pMDlg / pRRE.

[0103] <The eleventh aspect>

[0104] A method for preparing a non-specific lentivirus, comprising the following steps:

[0105] S1. Co-transfecting a donor plasmid, an auxiliary plasmid, a lentiviral shuttle plasmid, and the autophagy-targeted chimeric expression plasmid into virus-producing cells; obtaining a specific lentivirus targeting CD3-positive cells; the donor plasmid includes pMD2.G.

[0106] The specific lentivirus targeting CD3-positive cells prepared by the method for preparing a non-specific lentivirus as described above also belongs to the protection scope of the present invention.

[0107] The application of the specific lentivirus or non-specific lentivirus targeting CD3-positive cells in improving the transduction efficiency of PBMCs, reducing the off-target effect of chimeric antigen receptor CAR molecules, and improving the targeting of chimeric antigen receptor CAR molecules.

[0108] In the production process of lentiviruses and viroid vectors, if the protein expressed by the plasmid transfected into the production cells is a membrane protein (such as CAR), the membrane protein will be expressed on the surface of the production cells. The vector will also carry the membrane protein on the surface of the production cells during the process of exiting the membrane. When the lentivirus and viroid vector transduce a single cell type, these membrane proteins do not have an impact. However, for antigen-specific targeting vectors, the membrane proteins will affect their targeting and transduction efficiency, and in the in vivo application of CAR-T, they will also cause tumor cell antigen masking and even off-target of specific targeting.

[0109] The present invention describes a new process for producing a specific vector: during the vector production process, after plasmid transfection, the membrane proteins in the production cells are targeted for degradation. The finally obtained specific vector has no membrane protein modification on its surface, reducing the risk of vector off-target.

[0110] The core feature of the present invention is as follows: aiming at the problem of off-target caused by the expression of membrane proteins and the modification of membrane proteins on the surface of in vivo delivery carriers during the production process. The targeted degradation protein site is fused to the C-terminus of the membrane protein sequence to eliminate the modification of the membrane protein on the carrier. Thereby enhancing the in vivo transduction efficiency of the carrier and reducing the risk of off-target.

[0111] During the carrier production process, the viral shuttle plasmid expresses the target CAR protein on the surface of the production cell 293T and modifies it on the lentiviral vector, causing some carriers to target cancer cells instead of T cells, resulting in off-target. The present invention expresses a targeted protein degradation protein during the carrier production process to degrade the CAR protein on the surface of the carrier and reduce the probability of carrier off-target.

[0112] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0113] 1. Reduce the off-target risk: effectively solve the off-target problem caused by the modification of membrane proteins on the surface of the carrier. By targeting the degradation of membrane proteins during the carrier production process, the finally obtained specific carrier surface has no membrane protein modification, greatly reducing the mis-targeting of non-target cells by the carrier in in vivo CAR-T therapy and improving the accuracy and safety of the treatment.

[0114] 2. Enhance the transduction efficiency: avoid the negative impact of membrane proteins on the targeting and transduction efficiency of the carrier, enabling the carrier to more effectively transduce target cells.

[0115] 3. Can more effectively kill tumor cells while reducing the damage to normal tissues and cells, providing a more reliable and efficient treatment strategy for cell therapy of diseases such as cancer.

[0116] 4. Provide a brand-new specific carrier production process, which precisely solves the problems brought by membrane proteins during the carrier production process, is innovative and unique, provides new ideas and methods for the optimization of the carrier production process in the field of cell therapy, and has high application value and promotion potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0117] By reading the detailed description of the non-limiting embodiments with reference to the following drawings, other features, objectives and advantages of the present invention will become more obvious:

[0118] Figure 1 Viruses packaged for targeted degradation of CAR proteins reduce the binding to antigen cells;

[0119] Figure 2 Viruses packaged for targeted degradation of CAR proteins increase the virus transduction efficiency. DETAILED DESCRIPTION OF THE INVENTION

[0120] The present invention will be described in detail below in conjunction with embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but do not limit the present invention in any form. It should be noted that for those of ordinary skill in the art, several adjustments and improvements can be made without departing from the concept of the present invention. These all fall within the protection scope of the present invention.

[0121] Lentiviral vectors are viral vectors derived from HIV-1 that have lost their self-replicating ability. They can efficiently infect cells and are commonly used vectors in biological research and gene therapy.

[0122] Virus-like vectors are derived from lentiviral vectors, have no reverse transcription step, and have the ability to deliver mRNA.

[0123] In vivo CAR-T (chimeric antigen receptor T cell) therapy, also known as in situ CAR-T therapy. It directly engineers and injects CAR-T cells in the patient's body. This method has the potential to simplify the CAR-T manufacturing process and overcome the challenges faced by allogeneic therapies.

[0124] Cell targeting: It can be achieved by engineering the surface membrane proteins of lentiviral or virus-like vectors, enabling the vectors to deliver nucleic acids to specific cell types in a targeted manner.

[0125] Targeted protein degradation (TPD) refers to the use of small molecules to induce the selective degradation of proteins.

[0126] Proteolysis targeting chimera (PROTAC) is a targeted protein degradation technology that uses small molecule compounds to regulate protein levels. The core concept is to use artificial small molecule compounds to recruit a specific ubiquitin ligase and degrade the protein by achieving ubiquitination of the target protein.

[0127] Autophagy-targeting chimera is a non-small molecule type targeted protein degradation technology, composed of an antibody or ligand that recognizes a protein and an autophagy pathway guiding module, and can be used to degrade ligand-free proteins, aggregated proteins, and organelles.

[0128] Example 1 Preparation of pCCL-PGK-CD19CAR-ZP1 and pCMV-CD19-CPPLSS

[0129] 1. Materials

[0130] 1.1 Cell line: HEK293T cells, purchased from [ATCC];

[0131] 1.2, Primary cells: human PBMC (human peripheral blood mononuclear cells), purchased from [Miaoshun Biotechnology Co., Ltd.]

[0132] 1.2, Plasmids:

[0133] pMD2.G plasmid, purchased from [addgene]

[0134] pRSV.REV plasmid, purchased from [addgene]

[0135] pMDlg / pRRE plasmid, purchased from [addgene]

[0136] pMD2.G - Nipah - F - G1 - CD3 scFv plasmid SEQ ID NO.8,

[0137] pCCL - PGK - CD19CAR plasmid SEQ ID NO.9.

[0138] 1.3, Enzymes and reagents:

[0139] XhoI, BamHI restriction endonucleases (purchased from [New England Biolabs]);

[0140] T4 DNA ligase, lenalidomide (purchased from [Selleck]);

[0141] DMEM complete medium (containing 10% FBS, 1% glutamine, 1% non - essential amino acids, 1% sodium pyruvate, 1% penicillin - streptomycin);

[0142] RPMI1640 complete medium (containing 10% FBS, 1% glutamine, 1% non - essential amino acids, 1% sodium pyruvate, 1% penicillin - streptomycin);

[0143] TransAct (purchased from [Miltenyi Biotec]);

[0144] Fluorescently labeled anti - CD19 antibody, anti - CD3 antibody, anti - CAR antibody (purchased from [BioLegend]);

[0145] P24 protein detection ELISA kit (purchased from [GenScript Biotech Corporation]).

[0146] 2. Construction of pCCL - PGK - CD19CAR - ZP1 fragment

[0147] 2.1. Synthesize the CD19 CAR fragment and the target protein degradation fragment ZP1 separately; the sequence of the CD19 CAR fragment is (SEQ ID NO.6); the target protein degradation fragment ZP1 (amino acid sequence as SEQ ID NO.4; nucleotide sequence as SEQ ID NO.5).

[0148] 2.2. Use homologous recombination PCR to ligate ZP1 to the C-terminus of the protein sequence of CD19 CAR to obtain the fragment CD19CAR-ZP1 (SEQ ID NO.7); specifically including the following steps:

[0149] Design primers containing homologous sequences to the C-terminus of CD19 CAR and the N-terminus of ZP1, and perform PCR amplification using CD19 CAR and ZP1 as templates; the primer sequences are as follows:

[0150] CD19CAR-F: Ctctagcgggatccaccggtcgccaccatggccctccctgtc (SEQ ID NO.14)

[0151] CD19CAR-R: GTTGAAccgaggcggcagggcct (SEQ ID NO.15)

[0152] ZP1-F: CTgccgcctcggTTCAACGTGTTGATG (SEQ ID NO.16)

[0153] ZP1-R: ggaattccctcgaggccgctttaAAGTGCATCTCTGCGC (SEQ ID NO.17)

[0154] The reaction conditions are:

[0155] PCR reaction 1: CD19CAR-F, CD19CAR-R (primers), CD19 CAR fragment (template)

[0156] Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 62°C for 30 s, extension at 72°C for 20 s, for a total of 35 cycles; finally, extension at 72°C for 10 min.

[0157] PCR reaction 2: ZP1-F, ZP1-R (primers), target protein degradation fragment ZP1 (template)

[0158] Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 10 s, for a total of 35 cycles; finally, extension at 72°C for 10 min.

[0159] PCR Reaction 3: Using the products of PCR Reaction 1 and PCR Reaction 2 as templates

[0160] Step 1: Pre-denature at 95°C for 5 min; denature at 95°C for 30 s, anneal at 60°C for 30 s, extend at 72°C for 10 s, for a total of 10 cycles.

[0161] Add primers CD19CAR-F and ZP1-R to the Step 1 system

[0162] Step 2: Denature at 95°C for 30 s, anneal at 60°C for 30 s, extend at 72°C for 30 s, for a total of 25 cycles; finally, extend at 72°C for 10 min.

[0163] After separating the PCR products by agarose gel electrophoresis, recover the linearized plasmid fragments.

[0164] 2.3. Digest the vector pCCL-PGK-CD19CAR and the CD19CAR-ZP1 fragment obtained in 2.1.2 with XhoI and BamHI, and ligate them using T4 ligase to obtain plasmid pCCL-PGK-CD19CAR-ZP1.

[0165] First, digest the pCCL-PGK-CD19CAR plasmid with XhoI and BamHI to obtain a linearized plasmid fragment;

[0166] The DNA sequence recognized by XhoI is 5'-CTCGAG-3'

[0167] The DNA sequence recognized by BamHI is 5'-GGATCC-3';

[0168] The digestion system is: 4 μg of plasmid, 100 U of XhoI and BamHI enzymes, 4 μl of 10× Buffer, add ddH2O to a total volume of 40 μl, and incubate at 37°C for 30 min.

[0169] After separating the digestion products by agarose gel electrophoresis, recover the linearized plasmid fragment, and then ligate it with the CD19CAR-ZP1 fragment that has been digested with the same XhoI and BamHI enzymes under the action of T4 DNA ligase.

[0170] The ligation system is: 90 ng of linearized plasmid fragment, 20 ng of CD19CAR-ZP1 fragment, 100 U of T4 DNA ligase, 2 μl of 10× T4 DNA ligase Buffer, add ddH2O to a total volume of 20 μl, and ligate overnight at 16°C. Transform the ligation product into competent Escherichia coli DH5α, pick a single colony for amplification culture, extract the plasmid for identification, and obtain the verified shuttle plasmid pCCL-PGK-CD19CAR-ZP1.

[0171] 3. Construction of pCMV-CD19-CPPLSS Fragment

[0172] 3.1. Synthesize the CD19 (Met1-Arg556) fragment and the autophagy-targeting chimera CPPLSS separately; the sequence of the CD19 (Met1-Arg556) fragment is (SEQ ID NO.10); CPPLSS (amino acid sequence as SEQ ID NO.11; nucleotide sequence as SEQ ID NO.12).

[0173] 3.2. Connect CPPLSS to the C-terminus of the protein sequence of CD19 (Met1-Arg556) by homologous recombination to obtain the fragment CD19-G4S-CPPLSS (SEQ ID NO.13);

[0174] Specifically, it includes the following steps:

[0175] Design primers containing homologous sequences to the C-terminus of CD19 (Met1-Arg556) and the N-terminus of CPPLSS, and perform PCR amplification using CD19 (Met1-Arg556) and CPPLSS as templates; the primer sequences are as follows:

[0176] CD19-F: agcgaagcttaccggtcgccaccatgccacctcctcgc (SEQ ID NO.18)

[0177] CD19-R: CCGCCAGAACCACCGCCGCCcctggtgctccaggtgccca (SEQ ID NO.19)

[0178] CPPLSS-F: GTTCTGGCGGCGGCAGACGC (SEQ ID NO.20)

[0179] CPPLSS-R: aattccctcgaggccgctttaGTAGCCTGGATTCCG (SEQ ID NO.21)

[0180] The reaction conditions are:

[0181] PCR Reaction 1: CD19-F, CD19-R (primers), CD19 (Met1-Arg556) fragment (template)

[0182] Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 62°C for 30 s, extension at 72°C for 20 s, for a total of 35 cycles; finally, extension at 72°C for 10 min.

[0183] PCR Reaction 2: CPPLSS-F, CPPLSS-R (primers), target protein degradation fragment CPPLSS (template)

[0184] Pre-denature at 95°C for 5 min; denature at 95°C for 30 s, anneal at 60°C for 30 s, extend at 72°C for 10 s, for a total of 35 cycles; finally extend at 72°C for 10 min.

[0185] PCR Reaction 3: Using the products of PCR Reaction 1 and the products of PCR Reaction 2 as templates

[0186] Step 1: Pre-denature at 95°C for 5 min; denature at 95°C for 30 s, anneal at 60°C for 30 s, extend at 72°C for 20 s, for a total of 10 cycles.

[0187] Add primers CD19-F and CPPLSS-R to the system of Step 1

[0188] Step 2: Denature at 95°C for 30 s, anneal at 60°C for 30 s, extend at 72°C for 30 s, for a total of 25 cycles; finally extend at 72°C for 10 min.

[0189] After the PCR products are separated by agarose gel electrophoresis, the linearized plasmid fragments are recovered.

[0190] 3.3. Digest the vector pMD2.G-Nipah-F-G1-CD3 scFv and the CD19-G4S-CPPLSS fragment with XhoI and HinDIII, and ligate them with T4 to obtain the plasmid pCMV-CD19-CPPLSS.

[0191] First, digest the plasmid pCMV-CD19-CPPLSS with XhoI and HinDIII to obtain linearized plasmid fragments;

[0192] The DNA sequence recognized by XhoI is 5'-CTCGAG-3'

[0193] The DNA sequence recognized by HinDIII is 5'-AAGCTT-3'

[0194] The digestion system is: 4 μg of plasmid, 100 U of XhoI and HinDIII enzymes, 4 μl of 10× Buffer, add ddH2O to a total volume of 40 μl, and incubate at 37°C for 30 min.

[0195] After the digestion products are separated by agarose gel electrophoresis, the linearized plasmid fragments are recovered, and then ligated with the CD19-CPPLSS fragment treated with the same XhoI and HinDIII digestion under the action of T4 DNA ligase.

[0196] The ligation system is as follows: 900 ng of linearized plasmid fragment, 20 ng of CD19-CPPLSS fragment, 100 U of T4 DNA ligase, 2 μl of 10×T4 DNA ligase Buffer, add ddH2O to a total volume of 20 μl, and ligate overnight at 16°C. The ligation product was transformed into competent Escherichia coli DH5α, single colonies were picked for amplification culture, and plasmids were extracted for identification to obtain the plasmid pCMV-CD19-CPPLSS with correct verification.

[0197] Example 2 Preparation of non-specific lentivirus VSVG-CD19CAR-ZP1

[0198] 1. Co-transfect HEK293T cells with the donor plasmid (pMD2.G), the helper plasmids (pRSV.REV, pMDlg / pRRE), and pCCL-PGK-CD19CAR-ZP1 (the shuttle plasmid prepared in Example 1). One day before transfection, seed HEK293T cells in a 15-cm culture dish to a cell density of 70 - 80%. At the time of transfection, mix each plasmid in a certain ratio (pMD2.G:pRSV.REV:pMDlg / pRRE:pCCL-PGK-CD19CAR-ZP1 = [4 μg: 3.15 μg: 14.16 μg: 14.16 μg]), and add it to 1.5 ml of serum-free DMEM medium; add 35 μl of Lipofectamine 2000 to 1.5 ml of serum-free DMEM medium (Lipofectamine 2000, operate according to the instructions). Incubate at room temperature for 20 min, then add dropwise to the cell culture dish and gently shake to mix.

[0199] 2. 12 hours after transfection, change the medium to DMEM complete medium containing 1 μM lenalidomide and continue to induce culture for 48 hours. Collect the supernatant of the induced culture medium; obtain the concentrated virus solution by ultracentrifugation. The ultracentrifugation conditions are: 4°C, 25000 rpm, centrifuge for 120 min. The concentrated virus solution (VSVG-CD19CAR-ZP1 virus solution) is aliquoted and stored at -80°C.

[0200] Example 3 Preparation of non-specific lentivirus VSVG-CD19CAR-CPPLSS

[0201] 1. Co-transfect HEK293T cells with the donor plasmid (pMD2.G), the helper plasmids (pRSV.REV, pMDlg / pRRE), pCCL-PGK-CD19CAR, and pCMV-CD19-CPPLSS (prepared in Example 1). One day before transfection, seed HEK293T cells in a 15-cm culture dish to reach a cell density of 70 - 80%. At the time of transfection, mix each plasmid in a certain ratio (pMD2.G:pRSV.REV:pMDlg / pRRE:pCCL-PGK-CD19CAR:pCMV-CD19-CPPLSS = [4:3.15:14.16:14.16:10.16 μg]), and add it to 1.5 ml of serum-free DMEM medium; add 35 μl of Lipofectamine 2000 to 1.5 ml of serum-free DMEM medium (operate according to the instruction manual of Lipofectamine 2000). Incubate at room temperature for 20 min, then add dropwise to the cell culture dish and gently shake to mix evenly.

[0202] 2. Twelve hours after transfection, change the medium to complete DMEM medium and continue culturing for 48 hours.

[0203] 3. After transfection, collect the supernatant of the cell culture medium; obtain the concentrated virus solution by ultracentrifugation. The ultracentrifugation conditions are: 4°C, 25000 rpm, centrifuge for 120 min. Aliquot and store the concentrated virus solution at -80°C.

[0204] Example 4 Preparation of non-specific lentivirus VSVG-CD19CAR

[0205] 1. Co-transfect HEK293T cells with the donor plasmid (pMD2.G), the helper plasmids (pRSV.REV, pMDlg / pRRE), and pCCL-PGK-CD19CAR (control plasmid). One day before transfection, seed HEK293T cells in a 15-cm culture dish to reach a cell density of 70 - 80%. At the time of transfection, mix each plasmid in a certain ratio (pMD2.G:pRSV.REV:pMDlg / pRRE:pCCL-PGK-CD19CAR = [4 μg:3.15 μg:14.16 μg:14.16 μg]), and add it to 1.5 ml of serum-free DMEM medium; add 35 μl of Lipofectamine 2000 to 1.5 ml of serum-free DMEM medium (operate according to the instruction manual of Lipofectamine 2000). Incubate at room temperature for 20 min, then add dropwise to the cell culture dish and gently shake to mix evenly.

[0206] 2.4.2. After 12 hours of transfection, change the medium to complete DMEM medium and continue culturing for 48 hours.

[0207] 2.4.3. After transfection, collect the supernatant of the cell culture medium; obtain the concentrated virus solution by ultracentrifugation. The ultracentrifugation conditions are: 4°C, 25000 rpm, centrifuge for 120 min. The concentrated virus solution (VSVG-CD19CAR virus solution) is aliquoted and stored at -80°C.

[0208] Example 5 Preparation of Specific Lentivirus G13-CD19CAR-ZP1 Targeting CD3-Positive Cells

[0209] 1. Co-transfect HEK293T cells with the donor plasmid (pMD2.G-Nipah-F-G1-CD3 scFv), the helper plasmids (pRSV.REV, pMDlg / pRRE), and pCCL-PGK-CD19CAR-ZP1 (the shuttle plasmid prepared in Example 1). The transfection method is the same as Step 1 of Example 2.

[0210] pMD2.G-Nipah-F-G1-CD3 scFv:pRSV.REV:pMDlg / pRRE:pCCL-PGK-CD19CAR-ZP1 = [4 μg: 3.15 μg: 14.16 μg: 14.16 μg])

[0211] 2. After 12 hours of transfection, change the medium to complete DMEM medium containing 1 μM lenalidomide and continue culturing for 48 hours.

[0212] 3. After transfection, collect the supernatant of the cell culture medium; obtain the concentrated virus solution by ultracentrifugation. The ultracentrifugation conditions are: 4°C, 25000 rpm, centrifuge for 120 min. The obtained specific lentivirus G13-CD19CAR-ZP1 virus solution targeting CD3-positive cells is stored at -80°C.

[0213] Example 6 Preparation of Specific Lentivirus G13-CD19CAR-CPPLSS Targeting CD3-Positive Cells

[0214] 1. Co-transfect HEK293T cells with the donor plasmid (pMD2.G-Nipah-F-G1-CD3 scFv), the helper plasmids (pRSV.REV, pMDlg / pRRE), pCCL-PGK-CD19CAR, and pCMV-CD19-CPPLSS (prepared in Example 1). The transfection method is the same as that in Example 2.

[0215] pMD2.G-Nipah-F-G1-CD3 scFv:pRSV.REV:pMDlg / pRRE:pCCL-PGK-CD19CAR:pCMV-CD19-CPPLSS = [4:3.15:14.16:14.16:10.16 μg])

[0216] 2. After 12 hours of transfection, change the medium with complete DMEM medium and continue culturing for 48 hours.

[0217] 3. After transfection, collect the supernatant of the cell culture medium; obtain the concentrated virus solution by ultracentrifugation. The ultracentrifugation conditions are: 4 °C, 25,000 rpm, centrifuge for 120 min. The specific lentivirus G13-CD19CAR-CPPLSS virus solution targeting CD3-positive cells is obtained after concentration and stored at -80 °C.

[0218] Example 7 Preparation of Specific Lentivirus G13-CD19CAR Targeting CD3-Positive Cells

[0219] 1. Co-transfect HEK293T cells with the donor plasmid (pMD2.G-Nipah-F-G1-CD3 scFv), the helper plasmids (pRSV.REV, pMDlg / pRRE), and pCCL-PGK-CD19CAR (control plasmid) using the same transfection method as in Example 2.

[0220] pMD2.G-Nipah-F-G1-CD3 scFv:pRSV.REV:pMDlg / pRRE:pCCL-PGK-CD19CAR = [4:3.15:14.16:14.16 μg])

[0221] 2. After 12 hours of transfection, change the medium with complete DMEM medium and continue culturing for 48 hours.

[0222] 3. After transfection, collect the supernatant of the cell culture medium; obtain the concentrated virus solution by ultracentrifugation. The ultracentrifugation conditions are: 4 °C, 25,000 rpm, centrifuge for 120 min. The specific lentivirus G13-CD19CAR virus solution targeting CD3-positive cells is obtained after concentration and stored at -80 °C.

[0223] Application Effect Test Example

[0224] Test the transduction efficiency of the lentivirus solutions prepared in Examples 2-7 in human peripheral blood mononuclear cells (PBMC) and the expression of related cell surface markers.

[0225] 1. Virus Titer Determination

[0226] The virus titer was calculated by detecting the P24 protein content using the ELISA method.

[0227] Lentivirus P24 (ng / μl) VSVG-CD19CAR-ZP1 38.713693 G13-CD19CAR-ZP1 46.546166 VSVG-CD19CAR-CPPLSS 43.715893 G13-CD19CAR-CPPLSS 36.765831 VSVG-CD19CAR 42.324611 G13-CD19CAR 45.247626

[0228] 2. PBMC Culture and Virus Transduction

[0229] Resuscitate 1×10 6 Human PBMC and culture them overnight with the complete medium RPMI1640; Take out the suspended cells for counting, and activate every 1×10 6 PBMC with 10 μl TransAct + 990 μl of the complete medium RPMI1640. The activated cells were cultured in an incubator at 37°C and 5% CO2.

[0230] On the next day, add 200 ng of lentiviral particles VSVG-CD19CAR-ZP1, or G13-CD19CAR-ZP1, or VSVG-CD19CAR-CPPLSS, or G13-CD19CAR-CPPLSS, or VSVG-CD19CAR, or G13-CD19CAR to every 2×10 5 PBMC; Make up the total volume of the liquid to 100 μl with the complete medium RPMI1640.

[0231] At 12 hours after adding the virus, label the cell surface CD19 with the fluorescent antibody CD19 for FACS detection.

[0232] On the third day after adding the virus, label the cell surface CD3 and CAR with fluorescent antibodies (CD3 antibody and CAR antibody) and then perform FACS detection (flow cytometer).

[0233] 2.1 FACS Detection Results of the Mean Fluorescent Intensity of Transduced Cells:

[0234] The results are as Figure 1 .

[0235] At 12 hours after adding the virus, the mean fluorescent intensity (MFI) of CD19-positive cells in PBMC transduced with VSVG-CD19CAR-ZP1 was 5199, and the mean fluorescent intensity of CD19-positive cells in PBMC transduced with G13-CD19CAR-ZP1 was 5525.

[0236] The mean fluorescent intensity of CD19-positive cells in PBMC transduced with VSVG-CD19CAR-CPPLSS was 3635, and the mean fluorescent intensity of CD19-positive cells in PBMC transduced with G13-CD19CAR-CPPLSS was 3640.

[0237] The mean fluorescence intensity of CD19-positive cells in PBMC transduced with VSVG-CD19CAR was 594, and that in PBMC transduced with G13-CD19CAR was 1020.

[0238] 2.2 Results of FACS detection of the positive rate of transduced cells:

[0239] The results are as Figure 2 .

[0240] On the third day after adding the virus, the proportion of CD3 and CAR double-positive cells in PBMC transduced with VSVG-CD19CAR-ZP1 was 65.20%, and the proportion of CD3-negative and CAR-positive cells was 10.23%; the proportion of CD3 and CAR double-positive cells in PBMC transduced with G13-CD19CAR-ZP1 was 57.71%, and the proportion of CD3-negative and CAR-positive cells was 1.01%.

[0241] The proportion of CD3 and CAR double-positive cells in PBMC transduced with VSVG-CD19CAR-CPPLSS was 58.13%, and the proportion of CD3-negative and CAR-positive cells was 11.23%; the proportion of CD3 and CAR double-positive cells in PBMC transduced with G13-CD19CAR-CPPLSS was 48.32%, and the proportion of CD3-negative and CAR-positive cells was 1.89%.

[0242] The proportion of CD3 and CAR double-positive cells in PBMC transduced with VSVG-CD19CAR was 52.36%, and the proportion of CD3-negative and CAR-positive cells was 15.39%; the proportion of CD3 and CAR double-positive cells in PBMC transduced with G13-CD19CAR was 40.99%, and the proportion of CD3-negative and CAR-positive cells was 4.42%.

[0243] 2.3 Conclusion:

[0244] From the virus titer results, there was no significant difference between the four lentiviruses produced using two protein degradation technologies and the lentiviruses produced conventionally.

[0245] In the PBMC transduction experiment, by detecting the expression of cell surface markers at different time points through FACS, it was found that in the viruses with targeted protein degradation of CAR molecules (VSVG-CD19CAR-CPPLSS, G13-CD19CAR-CPPLSS, VSVG-CD19CAR-ZP1, and G13-CD19CAR-ZP1) during the production process, they bound less to CD19 on the surface of B cells compared to the viruses without targeted protein degradation.

[0246] During the production process, viruses for targeted protein degradation of CAR molecules (VSVG-CD19CAR-CPPLSS, G13-CD19CAR-CPPLSS, VSVG-CD19CAR-ZP1, and G13-CD19CAR-ZP1) have higher transduction efficiency compared to viruses without targeted protein degradation and can reduce off-targeting of CAR molecule-targeted cells.

[0247] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art can make various deformations or modifications within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A lentivirus prepared by a specific protein degradation method, characterized in that, Introduce a specific protein degradation system during the production process of lentivirus to degrade the membrane proteins on the surface of lentivirus.

2. The lentivirus prepared by the specific protein degradation method according to claim 1, characterized in that, During the production process of lentivirus, add the specific protein degradation system to the sequence of the target gene of the delivery vector.

3. The lentivirus prepared by the specific protein degradation method according to claim 1, characterized in that, The specific protein degradation system includes one of a monovalent degrader, a perturbing degrader, a molecular glue, and a bifunctional degrader; the bifunctional degrader includes one or several of a lysosome-targeting chimera, a proteolysis-targeting chimera, and an autophagy-targeting chimera.

4. The lentivirus prepared by the specific protein degradation method according to claim 3, characterized in that, The molecular glue protein includes a C2H2-type zinc finger active sequence or a modified sequence of the C2H2-type zinc finger active sequence; And / or, the autophagy-targeting chimera includes a CPPLSS-targeting chimera.

5. The lentivirus prepared by the specific protein degradation method according to claim 4, wherein The molecular glue protein is linked to the C-terminus of the membrane protein; And / or, the C2H2-type zinc finger active sequence includes one or several of IKZF3, ZN827, ZFP91, ZN653, and ZN276; And / or, the modified sequence of the C2H2-type zinc finger active sequence includes ZP1.

6. The lentivirus prepared by the method of specific protein degradation according to claim 5, characterized in that, The amino acid sequence of IKZF3 is as shown in SEQ ID NO.

1.

7. The lentivirus prepared by the method of specific protein degradation according to claim 6, characterized in that, The nucleotide sequence of IKZF3 satisfies one of the following conditions; 1) The sequence as shown in SEQ ID NO.2; 2) A sequence that still has the same activity as the sequence shown in SEQ ID NO.2 after substitution, deletion, or addition of one or several base sequences to the sequence shown in SEQ ID NO.

2.

8. The lentivirus prepared by the method of specific protein degradation according to claim 5, characterized in that, The amino acid sequence of ZP1 is as shown in SEQ ID NO.

4.

9. The lentivirus prepared by the method of specific protein degradation according to claim 8, characterized in that, The nucleotide sequence of ZP1 satisfies one of the following conditions; 1) The sequence as shown in SEQ ID NO.5; 2) A sequence that still has the same activity as the sequence shown in SEQ ID NO.5 after substitution, deletion, or addition of one or several base sequences to the sequence shown in SEQ ID NO.

5.

10. The lentivirus prepared by the specific protein degradation method according to claim 4, characterized in that, The amino acid sequence of the CPPLSS-targeting chimera is as shown in SEQ ID NO.

11.

11. The lentivirus prepared by the specific protein degradation method according to claim 10, characterized in that, The nucleotide sequence of CPPLSS satisfies one of the following conditions: 1) The sequence as shown in SEQ ID NO.12; 2) A sequence that still has the same activity as the sequence shown in SEQ ID NO.12 after substitution, deletion, or addition of one or several base sequences to the sequence shown in SEQ ID NO.

12.

12. A method for preparing a lentivirus capable of targeting and degrading membrane proteins, characterized in that, Introduce a specific protein degradation system during the production process of lentivirus to degrade the membrane proteins on the surface of lentivirus.

13. The preparation method according to claim 12, characterized in that, During the production process of lentivirus, add the specific protein degradation system to the target gene sequence of the delivery vector to cause the degradation of the protein expressed by the target gene in virus-producing cells.

14. A lentiviral vector incorporating a target protein degradation fragment, characterized in that, It contains a CD19CAR fragment and a targeting protein degradation fragment ZP1; the amino acid sequence of ZP1 is as shown in SEQ ID NO.4; the sequence of the CD19CAR fragment is as shown in SEQ ID NO.

6.

15. The lentiviral vector according to claim 14, characterized in that, The nucleotide sequence of ZP1 satisfies one of the following conditions: 1) The sequence as shown in SEQ ID NO.5; 2) A sequence which, after substitution, deletion, or addition of one or more base sequences to the sequence shown in SEQ ID NO.5, still has the same activity as the sequence shown in SEQ ID NO.

5.

16. The lentiviral vector according to claim 11, wherein The ZP1 is linked to the C-terminus of the protein sequence of CD19CAR.

17. A method for preparing a lentiviral vector incorporating a target protein degradation fragment as described in any one of claims 14-16, characterized in that, Comprising the following steps: S1. Synthesize the CD19CAR fragment and the target protein degradation fragment ZP1 respectively; wherein the sequence of the CD19CAR fragment is as shown in SEQ ID NO.6; the amino acid sequence of the ZP1 is as shown in SEQ ID NO.4; S2. Use homologous recombination to link the target protein degradation fragment ZP1 to the C-terminus of the protein sequence of CD19CAR to obtain a lentiviral vector fragment fused with the target protein degradation fragment, denoted as CD19CAR-ZP1; the sequence of the CD19CAR-ZP1 is as shown in SEQ ID NO.

7.

18. The preparation method of the lentiviral vector incorporating the targeted protein degradation fragment according to claim 17, wherein The nucleotide sequence of the ZP1 satisfies one of the following conditions: 1) The sequence as shown in SEQ ID NO.5; 2) A sequence which, after substitution, deletion, or addition of one or more base sequences to the sequence shown in SEQ ID NO.5, still has the same activity as the sequence shown in SEQ ID NO.

5.

19. A recombinant lentiviral shuttle plasmid, characterized in that, It comprises the lentiviral vector fused with the target protein degradation fragment according to any one of claims 14-16.

20. A method for preparing the recombinant lentiviral shuttle plasmid as described in claim 19, characterized in that, Comprising the following steps: Link the linearized plasmid fragment with the lentiviral vector fragment fused with the target protein degradation fragment according to any one of claims 14-16, verify the ligation product, and obtain the recombinant lentiviral shuttle plasmid.

21. According to the preparation method of claim 20, the linearized plasmid fragment is obtained by digesting the vector pCCL-PGK-CD19CAR with XhoI and BamHI.

22. A method for preparing a specific lentivirus targeting CD3-positive cells, characterized in that, Comprising the following steps: S1. Co-transfect the donor plasmid containing the scFv sequence targeting CD3, the helper plasmid, and the recombinant lentiviral shuttle plasmid according to claim 19 into virus-producing cells; S2. After transfection, induce and culture with a culture medium containing an inducer; obtain a specific lentivirus targeting CD3-positive cells; the inducer includes one or more of lenalidomide, pomalidomide, and thalidomide.

23. The preparation method according to claim 22, characterized in that, The donor plasmid containing the scFv sequence targeting CD3 is pMD2.G-Nipah-F-G1-CD3 scFv; And / or, the helper plasmid includes pRSV.REV and pMDlg / pRRE.

24. A lentiviral vector incorporating an autophagy-targeting chimera, characterized in that, Comprising the CD19 Met1-Arg556 fragment and the autophagy-targeting chimera CPPLSS; the amino acid sequence of the CPPLSS is as shown in SEQ ID NO.11; the sequence of the CD19 Met1-Arg556 fragment is SEQ ID NO.

10.

25. The lentiviral vector according to claim 24, wherein The nucleotide sequence of the CPPLSS satisfies one of the following conditions: 1) The sequence as shown in SEQ ID NO.12; 2) is a sequence that still has the same activity as the sequence shown in SEQ ID NO.12 after substituting, deleting, or adding one or several base sequences to the sequence shown in SEQ ID NO.

12.

26. The lentiviral vector according to claim 25, wherein The autophagy-targeting chimera CPPLSS is linked to the C-terminus of CD19 Met1-Arg556.

27. A method for preparing a lentiviral vector incorporating an autophagy-targeting chimera as described in any one of claims 24-26, characterized in that, It includes the following steps: S1. Synthesize the CD19 Met1-Arg556 fragment and the autophagy-targeting chimera CPPLSS respectively; wherein the amino acid sequence of the CPPLSS is as shown in SEQ ID NO.11; the sequence of the CD19 Met1-Arg556 fragment is SEQ ID NO.10; S2. Use homologous recombination to link CPPLSS to the C-terminus of the protein sequence of CD19 Met1-Arg556 to obtain the fragment CD19-G4S-CPPLSS; wherein the sequence of CD19-G4S-CPPLSS is as shown in SEQ ID NO.

13.

28. An autophagy-targeting chimera expression plasmid, characterized in that, It contains the lentiviral vector fused with the autophagy-targeting chimera described in any one of claims 24-26.

29. A method for preparing an autophagy-targeting chimera expression plasmid as described in claim 28, characterized in that, It includes the following steps: Link the linearized plasmid fragment with the lentiviral vector fragment fused with the autophagy-targeting chimera described in any one of claims 24-26, and verify the ligation product to obtain the autophagy-targeting chimera expression plasmid.

30. The preparation method according to claim 29, wherein, The linearized plasmid fragment is obtained by digesting the vector pMD2.G-Nipah-F-G1-CD3 scFv with XhoI and HinDIII.

31. A method for preparing a specific lentivirus targeting CD3-positive cells, characterized in that, It includes the following steps: Co-transfect the donor plasmid containing the scFv sequence targeting CD3, the helper plasmid, the lentiviral shuttle plasmid, and the autophagy-targeting chimera expression plasmid described in claim 28 into virus-producing cells; obtain the specific lentivirus targeting CD3-positive cells.

32. The preparation method according to claim 31, characterized in that, The lentiviral shuttle plasmid includes pCCL-PGK-CD19CAR; and / or, the donor plasmid containing the scFv sequence targeting CD3 is pMD2.G-Nipah-F-G1-CD3scFv; and / or, the helper plasmid includes pRSV.REV and pMDlg / pRRE.

33. A method for preparing a non-specific lentivirus, characterized in that, It includes the following steps: S1. Co-transfect the donor plasmid, the helper plasmid, and the recombinant lentiviral shuttle plasmid described in claim 19 into virus-producing cells; the donor plasmid includes pMD2.G; S2. After transfection, induce and culture with the culture medium containing the inducer; obtain the non-specific lentivirus.

34. A method for preparing a non-specific lentivirus, characterized in that, It includes the following steps: Co-transfect the donor plasmid, the helper plasmid, the lentiviral shuttle plasmid, and the autophagy-targeting chimera expression plasmid described in claim 28 into virus-producing cells; obtain the non-specific lentivirus; the donor plasmid includes pMD2.G.

35. A specific lentivirus targeting CD3-positive cells prepared by the preparation method described in any one of claims 20, 21, 29, 30.

36. A non-specific lentivirus prepared by the preparation method described in claim 33 or 34.

37. Use of a specific lentivirus targeting CD3-positive cells as described in claim 35 or a non-specific lentivirus as described in claim 36 in enhancing the transduction efficiency of PBMCs, reducing the off-target effect of the chimeric antigen receptor (CAR) molecule, and enhancing the targeting specificity of the chimeric antigen receptor (CAR) molecule.

Images