An artificial breeding method for Acipenser dabryanus

Through precise control of the identification of the temperature and kinship relationship of parent fish culture water, combined with artificial insemination and juvenile fish cultivation technology, the problems of low fertilization rate and low hatching rate in artificial reproduction of the Yangtze River sturgeon were solved, and the stable supply of Yangtze River sturgeon varieties and population health were achieved.

CN118985487BActive Publication Date: 2025-08-05CHINESE STURGEON RES INST OF CTG
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411039816.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-30
Publication Date
2025-08-05
Estimated Expiration
2044-07-30

AI Technical Summary

Technical Problem

The existing artificial breeding technology of the Yangtze River sturgeon faces the problems of low fertilization rate, low hatching rate, and low survival rate of young fish cultivation, and inbreeding leads to population degeneration.

Method used

The water temperature of the parent fish culture is used to stimulate the development of gonads. By identifying the parent fish kinship, the parent fish with distant relatives are selected for pairing, and artificial insemination, fertilized egg hatching and juvenile fish cultivation techniques are used, including the selection of parent fish, parent fish pairing, parent fish cultivation, artificial induction, artificial insemination and juvenile fish cultivation.

Benefits of technology

The fertilization rate and hatching rate of the Yangtze River sturgeon have been improved, the population degradation caused by inbreeding has been overcome, and the Yangtze River sturgeon species have been steadily supplied to meet the needs of artificial proliferation and release.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118985487B_ABST
    Figure CN118985487B_ABST
Patent Text Reader

Abstract

The present invention provides a method for artificial propagation of Acipenser dabryanus, which includes selecting broodstock, pairing broodstock, culturing broodstock, artificial induced spawning, artificial insemination, hatching of fertilized eggs and culturing of juvenile fish. The present invention stimulates the gonadal development of broodstock by precisely controlling the water temperature during broodstock cultivation, selects broodstock with relatively distant genetic relationships for pairing through the identification of the genetic relationships of broodstock to overcome the problem of population degradation caused by inbreeding, and uses artificial insemination, hatching of fertilized eggs and juvenile fish cultivation techniques to solve the problem of difficult artificial propagation of existing Acipenser dabryanus, so as to stably and continuously supply high-quality Acipenser dabryanus seeds and meet the perennial effective demand for artificial enhancement and release of Acipenser dabryanus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to biotechnology, and in particular to a method for artificial reproduction of Yangtze sturgeon (Acipenser dabryanus). Background Art

[0002] Yangtze sturgeon (Acipenser dabryanus) is a fish of the genus Acipenser in the family Acipenseridae of the order Acipenseriformes. It belongs to the chondrostei and is a typical migratory fish, mainly distributed in the main stream of the upper reaches of the Yangtze River and some important tributaries. The traditional artificial reproduction technology of Yangtze sturgeon faces the dilemmas of low fertilization rate, low hatching rate, and low survival rate of juvenile fish cultivation, and the phenomenon of inbreeding is serious, which significantly restricts the artificial proliferation and release of Yangtze sturgeon. Therefore, the artificial reproduction technology of Yangtze sturgeon urgently needs to be improved and developed. Summary of the Invention

[0003] The present invention provides a method for artificial reproduction of Yangtze sturgeon, which can solve the problem of difficult artificial reproduction of existing Yangtze sturgeon, and can stably and continuously supply high-quality Yangtze sturgeon seeds to meet the perennial effective demand for artificial proliferation and release of Yangtze sturgeon.

[0004] The present invention provides a method for artificial reproduction of Yangtze sturgeon, comprising the following steps:

[0005] Step 1, selecting broodstock: Selecting Yangtze sturgeon with an age greater than 6 years as the Yangtze sturgeon individuals to be detected; performing PCR amplification on the DNA samples of the Yangtze sturgeon individuals to be detected using Yangtze sturgeon sex marker primers, subjecting the product after PCR amplification to electrophoresis on a 2% agarose gel at a voltage of 120 V for 30 minutes to obtain an electrophoresis band. When the band size is 529 bp, the Yangtze sturgeon individual to be detected is a female Yangtze sturgeon and serves as a female broodstock; when no band appears, the Yangtze sturgeon individual to be detected is a male Yangtze sturgeon and serves as a male broodstock;

[0006] Among them, the Yangtze sturgeon sex marker primers include a first primer and a second primer. The nucleotide sequence of the first primer is 5’-TAAAGGGAGACGGCAGAT-3’, and the nucleotide sequence of the second primer is 5’-CAGGAAAGGCAAGGATGT-3’;

[0007] Step 2, pairing of broodstock: Identifying the genetic relationship of the female broodstock and the male broodstock to obtain the genetic relationship identification result; formulating a pairing and breeding table for Yangtze sturgeon according to the genetic relationship identification result;

[0008] Step 3, cultivation of broodstock: In November, according to the pairing and breeding table of Yangtze sturgeon, putting the female broodstock and the male broodstock into the cultivation pond for cultivation according to the male-female ratio of (1-2):(1-2) and controlling the stocking density ≤ 5 kg / m 3, after 10 - 30 days, the water temperature in the cultivation pond is increased from 6 - 12°C to 12 - 15°C at a heating rate of 0.1 - 0.3°C per day, and the broodstock to be induced to spawn is obtained by cultivation until May of the following year;

[0009] Step 4, Artificial Induction of Spawning: The broodstock to be induced to spawn is placed in the spawning induction pond according to the male - female ratio of (1 - 2):(1 - 2) and the breeding density is controlled ≤ 3 kg / m 3 . After 3 - 5 days of cultivation, first, the male broodstock among the broodstock to be induced to spawn is injected with spawning - inducing drugs, and sperm is obtained 10 - 12 hours later. Subsequently, eggs are obtained from the female broodstock among the broodstock to be induced to spawn; the time interval between inducing the male broodstock and the female broodstock does not exceed 2 days;

[0010] Step 5, Artificial Insemination: The sperm and eggs are mixed according to the volume ratio of (1 - 2):50, shaken and mixed evenly with water for 0.3 - 0.5 minutes, the water is discarded, and then sperm with a volume fraction of 1 - 2% is added to the eggs again, shaken and mixed evenly with water for 1 minute, and the water is discarded to obtain fertilized eggs;

[0011] Step 6, Incubation of Fertilized Eggs: The fertilized eggs are poured into an aqueous solution of talcum powder with a volume percentage content of 20 - 30%, the water temperature is controlled at 18 - 20°C, and slowly stirred for 120 minutes, and the talcum powder aqueous solution is changed every 30 minutes; then it is incubated under the conditions of a water temperature of 18 - 20°C, a water flow rate of 0.15 - 0.25 m / s, and a dissolved oxygen ≥ 7 mg / L to obtain hatched fry;

[0012] Step 7, Fry Cultivation: The fry are transferred to the fry cultivation device for the first cultivation for 11 - 13 days, and the concentration of dissolved oxygen is controlled ≥ 7 mg / L; after the first cultivation ends, the second cultivation is carried out for 30 - 45 days. Tubifex worms are fed to the fry four times a day, and the feeding times are 8:00, 14:00, 20:00, and 00:00 respectively, and garlic is mixed into the Tubifex worms once a week; after the second cultivation ends, the third cultivation is carried out. On the 1st - 2nd day of the third cultivation, a mixture of Tubifex worms and commercial feed with a mass ratio of 10:1 is fed to the fry. On the 3rd - 4th day of the third cultivation, a mixture of Tubifex worms and commercial feed with a mass ratio of 8:2 is fed. On the 5th - 6th day of the third cultivation, a mixture of Tubifex worms and commercial feed with a mass ratio of 6:4 is fed. On the 7th - 8th day of the third cultivation, a mixture of Tubifex worms and commercial feed with a mass ratio of 5:5 is fed. On the 8th - 10th day of the third cultivation, a mixture of Tubifex worms and commercial feed with a mass ratio of 4:6 is fed. On the 10th - 12th day of the third cultivation, a mixture of Tubifex worms and commercial feed with a mass ratio of 2:8 is fed; on the 13th - 14th day of the third cultivation, a mixture of Tubifex worms and commercial feed with a mass ratio of 1:10 is fed; on the 15th day of the third cultivation, commercial feed is fed to obtain Chinese sturgeon.

[0013] The method as described above, wherein step 2 further includes the following steps:

[0014] Extract the sample DNA of the female parent fish and male parent fish to be detected;

[0015] Perform PCR amplification on the sample DNA using a microsatellite primer set to obtain a PCR amplification product;

[0016] Perform electrophoresis on the PCR amplification product to obtain the kinship identification result;

[0017] Among them, the microsatellite primer set includes the primers shown in SEQ ID NO: 3 - SEQ ID NO: 22.

[0018] The method as described above, wherein in step 4, sperm extraction from the male parent fish further includes: subjecting the male parent fish to a single induced spawning, the inducing drug being LRHA - 2, and the inducing dose being 4 - 5 μg / kg.

[0019] The method as described above, wherein in step 4, egg extraction from the female parent fish further includes: subjecting the female parent fish to a double induced spawning, the double induced spawning including the first induced spawning and the second induced spawning; the drug for the first induced spawning is LRHA - 2, and the dose is 2 - 3 μg / kg; the drug for the second induced spawning is LRHA - 2, and the dose is 2 μg / kg.

[0020] The method as described above, wherein in step 7, the Tubifex worms are treated by ultraviolet irradiation for 10 - 15 minutes.

[0021] The method as described above, wherein the feeding mass of the Tubifex worms is 0.5 - 1.5% of the weight of the juvenile fish, and the particle size of the Tubifex worms is 50.0 - 66.7% of the mouth gape of the juvenile fish.

[0022] The method as described above, wherein the feeding mass of the garlic is 1 - 2% of the weight of the juvenile fish, and the particle size of the garlic is 50.0 - 66.7% of the mouth gape of the juvenile fish.

[0023] The method as described above, wherein in step 7, at the beginning of juvenile fish cultivation, the cultivation density is 2000 - 3000 tails / m 2 ; after 11 - 20 days of cultivation, the cultivation density is 1500 - 2000 tails / m 2 ; after 20 - 30 days of cultivation, the cultivation density is 1000 - 1500 tails / m 2 ; after 30 - 45 days of cultivation, the cultivation density is 300 - 700 tails / m 2 .

[0024] The method as described above, wherein the water temperature of the breeding pond is 6 - 12 °C, the light intensity is 0.1 - 50 lux, the water flow rate is 0.05 - 0.25 m / s, the transparency is ≥ 30 cm, and the dissolved oxygen content is ≥ 6.5 mg / L.

[0025] The method as described above, wherein the water temperature of the spawning pond is 16 - 18 °C, the water flow rate is 0.05 - 0.25 m / s, the transparency is ≥ 30 cm, and the dissolved oxygen content is ≥ 6.5 mg / L.

[0026] The present invention provides a method for artificial reproduction of Yangtze sturgeon, which includes selecting broodstock, pairing broodstock, culturing broodstock, artificial induced spawning, artificial insemination, incubating fertilized eggs, and culturing juvenile fish. By precisely controlling the water temperature of broodstock culture to stimulate the gonadal development of broodstock, and by identifying the genetic relationship of broodstock and selecting broodstock with a relatively distant genetic relationship for pairing to overcome the problem of population degradation caused by inbreeding, and using artificial insemination, incubating fertilized eggs, and culturing juvenile fish technologies to solve the problem of difficult artificial reproduction of Yangtze sturgeon, so as to stably and continuously supply high-quality Yangtze sturgeon seeds to meet the annual effective demand for artificial enhancement and release of Yangtze sturgeon. Description of the Drawings

[0027] Figure 1 Electrophoresis pattern for identifying the genetic sex of the individual Yangtze sturgeon to be detected in Example 1;

[0028] Figure 2 B-ultrasound image of the ovary of the female Yangtze sturgeon in Example 1;

[0029] Figure 3 B-ultrasound image of the testis of the male Yangtze sturgeon in Example 1;

[0030] Figure 4 Genetic relationship diagram between the female and male broodstock in Example 1. Detailed Embodiments

[0031] To enable those skilled in the art to better understand the solution of the present invention, the present invention will be further described in detail below. The specific embodiments listed below only describe the principles and features of the present invention, and the examples given are only used to explain the present invention and do not limit the scope of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of the present invention.

[0032] The present invention provides a method for artificial reproduction of Yangtze sturgeon, which includes the following steps:

[0033] Step 1. Select broodstock: Select Yangtze sturgeon over 6 years old as the individuals to be tested; perform PCR amplification on the DNA samples of the Yangtze sturgeon individuals to be tested using Yangtze sturgeon sex marker primers, electrophorese the PCR amplification products on a 2% agarose gel at a voltage of 120V for 30 minutes to obtain electrophoretic bands. When the band size is 529bp, the Yangtze sturgeon individual to be tested is a female Yangtze sturgeon, which is used as the female broodstock; when no band appears, the Yangtze sturgeon individual to be tested is a male Yangtze sturgeon, which is used as the male broodstock;

[0034] Among them, the Yangtze sturgeon sex marker primers include a first primer and a second primer. The nucleotide sequence of the first primer is 5’-TAAAGGGAGACGGCAGAT-3’, and the nucleotide sequence of the second primer is 5’-CAGGAAAGGCAAGGATGT-3’;

[0035] Step 2. Broodstock pairing: Identify the genetic relationship of the female and male broodstocks of Yangtze sturgeon to obtain the genetic relationship identification result; formulate a Yangtze sturgeon pairing and breeding table according to the genetic relationship identification result;

[0036] Step 3. Broodstock cultivation: In November, put the female and male broodstocks into the cultivation pond according to the female-male ratio of (1-2):(1-2) according to the Yangtze sturgeon pairing and breeding table and control the stocking density ≤ 5kg / m 3 , and after 10 - 30 days, raise the water temperature in the cultivation pond from 6 - 12°C to 12 - 15°C at a heating rate of 0.1 - 0.3°C per day, and cultivate until May of the following year to obtain the broodstocks to be induced to spawn;

[0037] Step 4. Artificial spawning induction: Put the broodstocks to be induced to spawn into the spawning induction pond according to the female-male ratio of (1-2):(1-2) and control the stocking density ≤ 3kg / m 3 , after cultivating for 3 - 5 days, first inject the male broodstock among the broodstocks to be induced to spawn with the spawning induction drug, obtain sperm after 10 - 12 hours, and then obtain eggs by taking eggs from the female broodstock among the broodstocks to be induced to spawn; the interval time between inducing the male broodstock and the female broodstock to spawn does not exceed 2 days;

[0038] Step 5. Artificial insemination: Mix the sperm and eggs according to the volume ratio of (1-2):50, add water and shake well for 0.3 - 0.5 minutes, discard the water, then add sperm with a volume fraction of 1 - 2% to the eggs again, add water and shake well for 1 minute, and discard the water to obtain fertilized eggs;

[0039] Step 6, fertilized egg incubation: Pour the fertilized eggs into an aqueous solution of talcum powder with a volume percentage of 20-30%, control the water temperature at 18-20°C, stir slowly for 120 minutes, and change the talcum powder aqueous solution every 30 minutes; then incubate it under the conditions of a water temperature of 18-20°C, a water flow rate of 0.15-0.25 m / s, and a dissolved oxygen ≥ 7 mg / L to obtain hatched juvenile fish;

[0040] Step 7, juvenile fish cultivation: Transfer the juvenile fish to a juvenile fish cultivation device for the first cultivation for 11-13 days, and control the concentration of dissolved oxygen ≥ 7 mg / L; after the end of the first cultivation, conduct the second cultivation for 30-45 days, and feed the juvenile fish four times a day with tubificid worms, and the feeding times are 8:00, 14:00, 20:00, and 00:00 respectively, and mix garlic with the tubificid worms once a week; after the end of the second cultivation, conduct the third cultivation. On the 1st-2nd day of the third cultivation, feed the juvenile fish a mixture of tubificid worms and commercial feed with a mass ratio of 10:1. On the 3rd-4th day of the third cultivation, feed a mixture of tubificid worms and commercial feed with a mass ratio of 8:2. On the 5th-6th day of the third cultivation, feed a mixture of tubificid worms and commercial feed with a mass ratio of 6:4. On the 7th- eighth day of the third cultivation, feed a mixture of tubificid worms and commercial feed with a mass ratio of 5:5. On the 8th-10th day of the third cultivation, feed a mixture of tubificid worms and commercial feed with a mass ratio of 4:6. On the 10th-12th day of the third cultivation, feed a mixture of tubificid worms and commercial feed with a mass ratio of 2:8; on the 13th-14th day of the third cultivation, feed a mixture of tubificid worms and commercial feed with a mass ratio of 1:10; on the 15th day of the third cultivation, feed commercial feed to obtain Yangtze sturgeon.

[0041] In the present invention, a passive integrated transponder (PIT) tag can also be used to tag the Yangtze sturgeon and record the gender of the Yangtze sturgeon corresponding to the tag.

[0042] The PIT tag is a tag based on radio frequency identification, which can identify target organisms by tagging, and is mainly applied to research such as the behavior, survival and growth, distribution, monitoring and protection of aquatic animals, and the evaluation of the effect of fishery enhancement and release. Compared with other tagging technologies, the PIT tag has the advantages of large information storage capacity, small volume, strong persistence, high recognition degree, uniqueness, stable performance, easy to identify when the frequency is low enough, and no significant impact on the survival, growth and swimming ability of organisms.

[0043] The present invention uses PIT tags to effectively identify and distinguish the cultured Yangtze sturgeon, avoiding the phenomenon of individual confusion.

[0044] In the solution of the present invention, on the basis of identifying the sex of the Yangtze sturgeon, since the gonad, that is, the testis of the male or the ovary of the female, can promote the development of the gonad and its accessory structures, and the size of the gonad is related to the degree of gonad development and maturity, the degree of gonad development and maturity of the Yangtze sturgeon is also detected by detecting the size of the gonad.

[0045] In the present invention, the specific types and components of the commercial feed are not limited. For example, the commercial feed can be the formulated feed for sturgeon circulating in the market, as long as it can meet the normal growth of the juvenile Yangtze sturgeon, and those skilled in the art can select it according to their needs.

[0046] In the present invention, in step 4, the broodstock to be induced to spawn is placed in the spawning induction pond for cultivation according to the male-female ratio of (1-2):(1-2). It can be understood that when the number of female broodstock is equal to the number of male broodstock, the male-female ratio can be 1:1; when the number of female broodstock is more than the number of male broodstock, the male-female ratio can be 2:1; when the number of female broodstock is less than the number of male broodstock, the male-female ratio can be 1:2, and those skilled in the art can select according to their needs.

[0047] In a specific embodiment, the feeding mass of tubificids is 0.5-1.5% of the body weight of the juvenile fish, and the particle size of the tubificids is 50.0-66.7% of the mouth gape of the juvenile fish. It can be understood that the feeding mass of tubificids can be appropriately increased or decreased according to the remaining mass of tubificids from the previous day, as long as the feeding mass of tubificids is 0.5-1.5% of the body weight of the juvenile fish.

[0048] Hereinafter, the technical solutions of the present application will be further explained and illustrated with specific examples.

[0049] For the experimental methods without specific conditions indicated in the following examples, they are usually carried out under conventional conditions or according to the conditions recommended by the manufacturer. The reagents used, unless otherwise specified, are commercially available or can be obtained through public channels.

[0050] The primer sequences involved in the following examples are shown in Table 1:

[0051] Table 1

[0052]

[0053] Example 1:

[0054] (1) Select broodstock

[0055] Select 24 Yangtze sturgeons that are at least 6 years old as the individuals to be tested. Use the sex - specific primers of Yangtze sturgeon to conduct genetic sex identification on the tested Yangtze sturgeon individuals. Extract the DNA of the tested Yangtze sturgeon individuals to prepare DNA samples. Then, according to the sex - linked markers of Yangtze sturgeon, obtain the upstream primer F (5'-TAAAGGGAGACGGCAGAT-3') and the downstream primer R (5'-CAGGAAAGGCAAGGATGT-3'). Subsequently, use the above - mentioned DNA samples as templates, and use the upstream primer and downstream primer to amplify through PCR technology to obtain PCR products. Add the PCR products to 2% agarose gel, set the voltage to 120V and the time to 30 minutes, conduct electrophoresis and analyze the agarose gel after electrophoresis using a gel imaging system. When a single band appears on the gel image with a size of 529 bp, the tested Yangtze sturgeon individual is a female Yangtze sturgeon; when no band appears on the gel image, the tested Yangtze sturgeon individual is a male Yangtze sturgeon.

[0056] As Figure 1 shown, the male - female ratio of the above 24 tested Yangtze sturgeon individuals is 1:1, that is, there are 12 female Yangtze sturgeons and 12 male Yangtze sturgeons. Use a B - ultrasonic instrument to measure the gonad diameter of female and male Yangtze sturgeons. As Figure 2 and Figure 3 shown, determine the gonad development degree of Yangtze sturgeon according to the size of the gonad width. Generally, the wider the gonad width, the better the gonad development. The gonad diameters of the above 12 female Yangtze sturgeons or 12 male Yangtze sturgeons all meet the standards and can be used as female parent fish or male parent fish. Use passive integrated transponder (PIT) tags to mark and number the above - mentioned female and male parent fish. Among them, numbers 1 - 12 are female parent fish, and numbers 13 - 24 are male parent fish.

[0057] (2)Parent fish pairing

[0058] The present invention provides a set of microsatellite primers. Among them, the set of microsatellite primers includes 1 - 5 groups. Group 1 includes primers 1F, 1R and 2F, 2R; Group 2 includes primers 3F, 3R and 4F, 4R; Group 3 includes primers 5F, 5R and 6F, 6R; Group 4 includes primers 7F, 7R and 8F, 8R; Group 5 includes primers 9F, 9R and 10F, 10R.

[0059] Cut 0.5 - 1 g of the fin rays of the female and male parent fish in step (1), extract the fin ray DNA to prepare a DNA sample as a DNA template, and use the four primers in each group of the above microsatellite primer sets as primers to perform PCR amplification to obtain a PCR product. Among them, the total volume of the PCR amplification system is 25 μL, including 2 μL of the DNA template, 1 μL of each of the four primers in each group of the microsatellite primer sets, 12.5 μL of 2×Taq Master Mix, and 6.5 μL of ddH2O; the PCR amplification program includes pre-denaturation at 94°C for 3 min; denaturation at 94°C for 10 s, annealing at 56°C for 10 s, extension at 72°C for 29 s, for a total of 35 cycles; finally, extension at 72°C for 5 min. Add the PCR product to a 10% polyacrylamide gel, set the voltage to 100 V and the time to 2 hours, perform electrophoresis, and analyze the polyacrylamide gel after electrophoresis using a gel imaging system. Input the electrophoresis results into the phylogenetic tree construction software to analyze the genetic relationship between the above female and male parent fish and obtain a genetic relationship diagram ( Figure 4 ) as Figure 4 shown. Among the fish with a relatively large distance in Figure 4 , their genetic relationship is also relatively far. For example, the distance between female parent fish 10 and male parent fish 14 or male parent fish 23 is relatively close, and their genetic relationship is also relatively close, while the distance between female parent fish 10 and male parent fish 24 or male parent fish 20 is relatively far, and their genetic relationship is also relatively far. Therefore, according to Figure 4 , a pairing breeding table (Table 2) can be drawn.

[0060] Table 2

[0061]

[0062] (3) Rearing of parent fish

[0063] In November, pair the above female and male parent fish according to the pairing breeding table in Table 2 according to the male-female ratio of (1 - 2):(1 - 2). Put the paired female and male parent fish into a rearing pond with a water temperature of 6 - 12°C, a light intensity of 0.1 - 50 lux, a water flow rate of 0.05 - 0.25 m / s, a transparency ≥ 30 cm, and a dissolved oxygen content ≥ 6.5 mg / L for rearing and control the stocking density ≤ 5 kg / m 3 . After 10 - 30 days, raise the water temperature in the rearing pond from 6 - 12°C to 12 - 15°C at a heating rate of 0.1 - 0.3°C per day, and rear until May of the following year to obtain the parent fish to be induced to spawn.

[0064] (4) Artificial induction of spawning

[0065] Put the broodstock to be induced into the spawning pond with a water temperature of 16 - 18°C, a water flow rate of 0.05 - 0.25 m / s, a transparency ≥ 30 cm, and a dissolved oxygen content ≥ 6.5 mg / L according to the male - female ratio of (1 - 2):(1 - 2), and control the stocking density ≤ 3 kg / m 3 After culturing for 3 - 5 days, first induce the male fish once. The inducing drug is LRHA - 2 produced by Ningbo No. 3 Pharmaceutical Factory, with a dosage of 4 - 5 μg / kg. After the 10 - 12 - hour effect time ends, collect sperm by abdominal extrusion method, once every 2 hours, for a total of 4 - 5 times, and store it in a fresh - keeping bag filled with oxygen in a 2 - 4°C refrigerator. Then induce the female fish twice. The inducing drug is LRHA - 2 produced by Ningbo No. 3 Pharmaceutical Factory. The dosage of the first injection is 2 - 3 μg / kg, and the dosage of the second injection is 2 μg / kg. The interval between the two injections is 10 - 12 hours. After the 10 - hour effect time ends, collect eggs by abdominal extrusion method, once every 0.5 hour, for a total of 4 - 5 times. Immediately perform fertilization treatment after the eggs are collected. Among them, the time interval between inducing male and female fish does not exceed 2 days.

[0066] (5)Artificial insemination

[0067] Mix sperm and eggs according to the volume ratio of (1 - 2):50, add water and shake well for 0.3 - 0.5 minutes, discard the liquid, then add sperm with a volume fraction of 1 - 2% to the eggs again, add water and shake well for 1 minute, and discard the liquid to obtain fertilized eggs.

[0068] (6)Hatching of fertilized eggs

[0069] Pour the fertilized eggs into an aqueous solution of talcum powder with a volume percentage content of 20 - 30%, control the water temperature at 18 - 20°C, stir slowly for 120 minutes to ensure that the fertilized eggs can turn normally and the fish eggs are not damaged, and change the talcum powder aqueous solution every 30 minutes. Pour the fertilized eggs into the incubator for hatching, control the water temperature of the incubator at 18 - 20°C, the water flow rate at 0.15 - 0.25 m / s, ensure that the fish eggs can turn normally, and the dissolved oxygen ≥ 7 mg / L. During the hatching process of the fertilized eggs, select and discard the unfertilized eggs and the fertilized eggs with stopped development. After culturing for 11 - 13 days, obtain hatched fry.

[0070] (7)Fry cultivation

[0071] After the fertilized eggs hatch, that is, after the fry hatch, transfer the fry swimming against the water flow to the fry cultivation device for the first cultivation, and the concentration of dissolved oxygen ≥ 7 mg / L. At the beginning of cultivation, the stocking density is 2000 - 3000 tails / m 2 ; after culturing for 11 - 20 days, control the stocking density at 1500 - 2000 tails / m 2; After 20 - 30 days of cultivation, control the cultivation density to be 1000 - 1500 tails / m 2 ; After 30 - 45 days of cultivation, control the cultivation density to be 300 - 700 tails / m 2 . In addition, after the yolk sac of the juvenile fish is completely absorbed, that is, after 11 - 13 days of cultivation, feed the juvenile fish with Tubifex worms four times a day for the second cultivation. The feeding times are 8:00, 14:00, 20:00, and 00:00 respectively. The feeding quality is 0.5 - 1.5% of the body weight of the juvenile fish, and the feeding amount is increased or decreased according to the remaining amount of Tubifex worms fed the previous day. Among them, the Tubifex worms are irradiated with ultraviolet light for 10 minutes and crushed before feeding. The particle size of the crushed Tubifex worms increases with the growth of the juvenile fish, and the specific size is 1 / 2 - 2 / 3 of the mouth gape length of the juvenile fish. While feeding the Tubifex worms, mix and feed garlic in the Tubifex worms once a week. The garlic is also crushed, and the particle size is 1 / 2 - 2 / 3 of the mouth gape length of the juvenile fish. The mixing amount of garlic is 1 - 2% of the body weight of the juvenile fish. 30 - 45 days after feeding the Tubifex worms, start to feed the juvenile fish with a mixture of Tubifex worms and commercial feed for the third cultivation. On the 1st - 2nd day of the third cultivation, feed the juvenile fish with a mixture of Tubifex worms and commercial feed with a mass ratio of 10:1. On the 3rd - 4th day of the third cultivation, feed a mixture with a mass ratio of 8:2. On the 5th - 6th day of the third cultivation, feed a mixture with a mass ratio of 6:4. On the 7th - 8th day of the third cultivation, feed a mixture with a mass ratio of 5:5. On the 8th - 10th day of the third cultivation, feed a mixture with a mass ratio of 4:6. On the 10th - 12th day of the third cultivation, feed a mixture with a mass ratio of 2:8. On the 13th - 14th day of the third cultivation, feed a mixture with a mass ratio of 1:10. On the 15th day of the third cultivation, feed commercial feed to obtain the Yangtze sturgeon, and conduct artificial release of the Yangtze sturgeon.

[0072] In this example, a total of 12 female parent fish and 12 male parent fish participated in the reproduction. Among them, all female parent fish and male parent fish were successfully induced to spawn, the fertilization rate was 95%, the hatching rate was 82%, more than 500,000 juvenile Yangtze sturgeons were hatched, about 350,000 2 - month - old Yangtze sturgeons were obtained, and artificial release was successfully carried out. Among them, the mortality rate of all female parent fish and male parent fish after being induced to spawn was 0.

[0073] Comparative Example 1:

[0074] The experimental steps of this comparative example can refer to Example 1, with the only difference being that in Comparative Example 1, 16 Yangtze sturgeons not less than 6 years old were selected as the Yangtze sturgeon individuals to be detected, and in step (2), instead of selecting parent fish for pairing, they were randomly paired.

[0075] A total of 7 female parent fish and 9 male parent fish participated in the reproduction in this comparative example. All female and male parent fish were successfully induced to spawn. The fertilization rate was 90%, and the hatching rate was 75%. A total of 220,000 juvenile Yangtze sturgeon were hatched, and 100,000 2-month-old Yangtze sturgeon were obtained and released into the wild artificially. Among them, the mortality rate of all female and male parent fish after induced spawning was 0.

[0076] Comparative Example 2:

[0077] The experimental steps of this comparative example can refer to Example 1, with the only difference being that in Comparative Example 2, 10 Yangtze sturgeon with an age of not less than 6 years were selected as the Yangtze sturgeon individuals to be tested, and in step (7), instead of feeding tubifex worms and garlic, after the yolk sac of the juvenile fish was completely absorbed, that is, 11 - 13 days after cultivation, commercial feed was directly fed.

[0078] A total of 3 female parent fish and 7 male parent fish participated in the reproduction in this comparative example. All female and male parent fish were successfully induced to spawn. The fertilization rate was 95%, and the hatching rate was 82%. A total of 120,000 juvenile Yangtze sturgeon were hatched, and 20,000 2-month-old Yangtze sturgeon were obtained and released into the wild artificially. Among them, the mortality rate of all female and male parent fish after induced spawning was 0. In addition, it was detected that the swimming speed of the juvenile fish obtained using Example 1 was 5 - 10% faster than that of the juvenile fish obtained in Comparative Example 2.

[0079] Comparative Example 3:

[0080] The experimental steps of this comparative example can refer to Example 1, with the only difference being that in Comparative Example 3, 8 Yangtze sturgeon with an age of not less than 6 years were selected as the Yangtze sturgeon individuals to be tested, and in step (5), the traditional dry artificial insemination method was used. The specific method was to squeeze the eggs into a clean water basin or large bowl first, then immediately squeeze in several drops of semen and stir evenly. Immediately add clean water to the basin or large bowl and stir for 2 - 3 minutes to fertilize the eggs. Finally, rinse several times or directly pour them into the incubator for incubation.

[0081] A total of 4 female parent fish and 4 male parent fish participated in the reproduction in this comparative example. All female and male parent fish were successfully induced to spawn. The fertilization rate was 80%, and the hatching rate was 70%. A total of 100,000 juvenile Yangtze sturgeon were hatched, and 50,000 2-month-old Yangtze sturgeon were obtained and released into the wild artificially. Among them, the mortality rate of all female and male parent fish after induced spawning was 0.

[0082] In summary, the present invention provides a method for artificial breeding of Yangtze sturgeon, which includes seven steps: selecting broodstock, pairing broodstock, cultivating broodstock, artificial induced spawning, artificial insemination, hatching of fertilized eggs and cultivating juvenile fish. The present invention stimulates the gonadal development of broodstock by precisely controlling the water temperature during the cultivation of broodstock, overcomes the problem of population degradation caused by inbreeding by selecting distantly related broodstock for pairing through identifying the genetic relationship of broodstock, and solves the problem of difficulty in artificial breeding of existing Yangtze sturgeon by using artificial insemination, hatching of fertilized eggs and cultivating juvenile fish technology, so as to stably and continuously supply high-quality Yangtze sturgeon seeds to meet the perennial effective demand for artificial enhancement and release of Yangtze sturgeon.

[0083] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for artificial propagation of Yangtze sturgeon, characterized in that: The steps include: Step 1. Select broodstock: Select Yangtze sturgeons older than 6 years old as the Yangtze sturgeons to be tested; use Yangtze sturgeon sex marker primers to perform PCR amplification on the DNA sample of the Yangtze sturgeons to be tested, and electrophoresing the PCR amplification product on a 2% agarose gel at a voltage of 120V for 30 minutes to obtain electrophoresis bands. When the band size is 529bp, the Yangtze sturgeon to be tested is a female Yangtze sturgeon, which is used as the female broodstock; when no band is present, the Yangtze sturgeon to be tested is a male Yangtze sturgeon, which is used as the male broodstock; The Yangtze sturgeon sex marker primers include a first primer and a second primer, the nucleotide sequence of the first primer is 5'-TAAAGGGAGACGGCAGAT-3', and the nucleotide sequence of the second primer is 5'-CAGGAAAGGCAAGGATGT-3'; Step 2, broodstock pairing: performing kinship identification on the female broodstock and the male broodstock to obtain kinship identification results; formulating a pairing and breeding table for the Yangtze sturgeon based on the kinship identification results; Step 2 also includes: extracting DNA samples from the female broodstock and the male broodstock to be tested; Performing PCR amplification on the sample DNA using a microsatellite primer set to obtain a PCR amplification product; Performing electrophoresis on the PCR amplification product to obtain the kinship identification result; Wherein, the microsatellite primer set includes primers shown in SEQ ID NO: 3 to SEQ ID NO: 22; The nucleotide sequence of SEQ ID NO: 3 is TTGGCGATCCGATCACCAAA; The nucleotide sequence of SEQ ID NO:4 is TGCCATTTGACTCAACTGTGC; The nucleotide sequence of SEQ ID NO:5 is CTTGATAAAGCGTGCC; The nucleotide sequence of SEQ ID NO:6 is CCTGAACTTCGGAACA; The nucleotide sequence of SEQ ID NO:7 is AGTTGGCAGGTGGAGGAC; The nucleotide sequence of SEQ ID NO:8 is ATGGCAATAATGTTACATGAGC; The nucleotide sequence of SEQ ID NO:9 is CTCGTTTTCTTAGCCGCGTG; The nucleotide sequence of SEQ ID NO: 10 is AACGGACACAGAGGGATTGC; The nucleotide sequence of SEQ ID NO: 11 is TTTTGGTGTAGTCCAATT; The nucleotide sequence of SEQ ID NO: 12 is ACTGAAGCCCTGTATGA; The nucleotide sequence of SEQ ID NO: 13 is ACGAGCAAGCAAACAAGCAA; The nucleotide sequence of SEQ ID NO: 14 is TCACTGCATTTTCCAAGTTCCC; The nucleotide sequence of SEQ ID NO: 15 is GACGCGCTCTCTGCAATTTC; The nucleotide sequence of SEQ ID NO: 16 is TCTCACCTCAATTCTCGTGAGT; The nucleotide sequence of SEQ ID NO: 17 is TCACACCTTGGTGTTGGCAT; The nucleotide sequence of SEQ ID NO: 18 is AGTGTGCTTTAACCCAGTGCT; The nucleotide sequence of SEQ ID NO: 19 is TACAGCATAAACTAAACCTTC; The nucleotide sequence of SEQ ID NO:20 is ACCTTATCACGGGAGC; The nucleotide sequence of SEQ ID NO:21 is TGTCTGCTATCCAGGCTCAC; The nucleotide sequence of SEQ ID NO:22 is TGCTATGTACTGTATGGTTCTTTGTG; Step 3: Broodstock cultivation: In November, according to the Yangtze River sturgeon pairing and breeding table, female broodstock and male broodstock are placed in the breeding pond at a male-female ratio of 1-2:1-2 and the breeding density is controlled to be ≤5kg / m 3 After 10-30 days, the water temperature in the culture pond is raised from 6-12°C to 12-15°C at a rate of 0.1-0.3°C / day, and the fish are cultured until May of the following year to obtain broodstock ready for induced spawning; Step 4: Artificial induced spawning: Place the broodstock to be induced spawning into the induced spawning pond in a male-female ratio of 1-2:1-2 and cultivate them at a density of ≤3kg / m 3 After 3-5 days of incubation, the male broodstock to be induced to lay are injected with an induced induced drug and then sperm is collected 10-12 hours later to obtain sperm, and then the female broodstock to be induced to lay are collected to obtain eggs; the interval between the induced induced male broodstock and the induced induced female broodstock shall not exceed 2 days; Step 5, artificial insemination: the sperm and egg are mixed in a volume ratio of 1-2:50, water is added and shaken for 0.3-0.5 minutes, the water is discarded, and 1-2% of the volume fraction of sperm is added to the egg again, water is added and shaken for 1 minute, and the water is discarded to obtain a fertilized egg; Step 6, hatching the fertilized eggs: pouring the fertilized eggs into a 20-30% by volume talc aqueous solution, controlling the water temperature to 18-20° C., slowly stirring for 120 minutes, wherein the talc aqueous solution is changed every 30 minutes; then incubating the eggs under the conditions of a water temperature of 18-20° C., a water flow velocity of 0.15-0.25 m / s, and dissolved oxygen ≥7 mg / L to obtain hatched fry; Step 7, juvenile fish breeding: the juvenile fish are transferred to a juvenile fish breeding device for a first breeding for 11-13 days, and the dissolved oxygen concentration is controlled to be ≥7 mg / L; after the first breeding, a second breeding is carried out for 30-45 days, and the juvenile fish are fed with water earthworms four times a day, and the feeding times are 8:00, 14:00, 20:00, and 00:00, respectively, and garlic is mixed with the water earthworms once a week; after the second breeding, a third breeding is carried out, and on the 1st and 2nd days of the third breeding, the juvenile fish are fed with a mixture of water earthworms and commercial feed with a mass ratio of 10:1, and on the 3rd and 4th days of the third breeding, the juvenile fish are fed with a mass ratio of 8:2 The Yangtze sturgeon was fed a mixture of water earthworms and commercial feed in a mass ratio of 6:4 on the 5th to 6th day of the third breeding, a mixture of water earthworms and commercial feed in a mass ratio of 5:5 on the 7th to 8th day of the third breeding, a mixture of water earthworms and commercial feed in a mass ratio of 4:6 on the 8th to 10th day of the third breeding, a mixture of water earthworms and commercial feed in a mass ratio of 2:8 on the 10th to 12th day of the third breeding; a mixture of water earthworms and commercial feed in a mass ratio of 1:10 on the 13th to 14th day of the third breeding; and commercial feed was fed on the 15th day of the third breeding to obtain the Yangtze sturgeon.

2. The method according to claim 1, characterized in that In step 4, extracting sperm from the male broodstock further comprises: inducing spawning once on the male broodstock, using LRHA-2 as the inducing drug at a dose of 4-5 μg / kg.

3. The method according to claim 1 or 2, characterized in that In step 4, the egg collection of the female broodstock further includes: applying secondary induced labor to the female broodstock, the secondary induced labor including a first induced labor and a second induced labor; the first induced labor drug is LRHA-2, with a dosage of 2-3 μg / kg; the second induced labor drug is LRHA-2, with a dosage of 2 μg / kg.

4. The method according to claim 1 or 2, characterized in that In step 7, the water earthworms are treated with ultraviolet irradiation for 10-15 minutes.

5. The method according to claim 4, characterized in that The feeding mass of the water earthworms is 0.5-1.5% of the body weight of the juvenile fish, and the particle size of the water earthworms is 50.0-66.7% of the mouth size of the juvenile fish.

6. The method according to claim 1 or 2, characterized in that The feeding mass of the garlic is 1-2% of the body weight of the juvenile fish, and the particle size of the garlic is 50.0-66.7% of the mouth opening of the juvenile fish.

7. The method according to claim 1 or 2, characterized in that In step 7, when the juvenile fish farming begins, the farming density is 2000-3000 fish / m 2 After 11-20 days of breeding, the breeding density is 1500-2000 fish / m 2 After 20-30 days of breeding, the breeding density is 1000-1500 fish / m 2 After 30-45 days of breeding, the breeding density is 300-700 fish / m 2 .

8. The method according to claim 1 or 2, characterized in that The water temperature of the cultivation pond is 6-12° C., the light intensity is 0.1-50 lux, the water flow velocity is 0.05-0.25 m / s, the transparency is ≥30 cm, and the dissolved oxygen content is ≥6.5 mg / L.

9. The method according to claim 1 or 2, characterized in that The water temperature of the induced labor pool is 16-18°C, the water flow rate is 0.05-0.25m / s, the transparency is ≥30cm, and the dissolved oxygen content is ≥6.5mg / L.

Citation Information

Patent Citations

  • Artificial propagation method for sturgeon

    CN102165929A

  • Genomic sequence fragment ZHXF-1 for rapidly identifying genetic sex of Chinese sturgeon and application of genome sequence fragment ZHXF-1

    CN113136437A