A method of repositioning intracellular e3 ubiquitin ligases to enable degradation of membrane proteins

Abstract

The application discloses a method for repositioning intracellular E3 ubiquitin ligase to realize degradation of membrane proteins, comprising the following steps: (1) preparing a targeting membrane protein chimera; (2) placing the targeting membrane protein chimera close to a target cell with a low extracellular pH and a membrane protein targeted by an aptamer, so that the aptamer in the targeting membrane protein chimera is combined with the membrane protein targeted thereby, and CRBN distributed in the target cell is repositioned to the inside of the cell membrane of the target cell, so that the intracellular domain of the targeted membrane protein is ubiquitinated and degraded. The application can effectively utilize intracellular E3 ubiquitin ligase to realize degradation of tumor cell membrane proteins without the need of an intracellular delivery process, thereby improving the degradation efficiency and expanding the application range of PROTACs to membrane proteins.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology, and particularly relates to a method for repositioning intracellular E3 ubiquitin ligase to achieve degradation of membrane proteins. BACKGROUND

[0002] Membrane proteins play a key role in many physiological and pathological processes in the human body. Over-activation and mutation of cell membrane proteins are one of the causes of cancer diseases. Targeted protein degradation (TPD) is a promising therapeutic strategy for degrading disease-related pathogenic target proteins. In the TPD strategy, the proteasome-targeting membrane protein chimera (PROTACs) technology has developed most significantly, and its principle is to use a bifunctional molecule or peptide to link the target protein with an E3 ubiquitin ligase to degrade the disease-related target protein through the ubiquitin-proteasome system. At present, the PROTACs technology has been successfully applied to the degradation of transcription factors (TFs), RNA binding proteins (RBPs), BRD4 and other targets. PROTACs show good advantages in targeting "undruggable" proteins and overcoming drug molecule resistance, and have significant potential in the treatment of various diseases. However, most of the PROTACs reported at present are based on VHL or CRBN, which are cytoplasmic E3 ligases, and PROTACs must pass through the cell membrane into the intracellular protein degradation. Compared with traditional small molecule inhibitors, the large molecular weight of PROTACs is usually accompanied by poor water solubility and low cell permeability. In addition, most of the current PROTAC technologies cannot achieve the degradation of cell membrane proteins.

[0003] To effectively degrade cell membrane proteins, researchers have developed lysosome-targeting membrane protein chimeras (LYTACs). As a key supplement to PROTACs, LYTACs induce extracellular and transmembrane proteins to migrate to lysosomes through lysosome transport receptors to achieve protein degradation. LYTACs have successfully degraded targeted cell membrane proteins such as EGFR, PD-L1, and PTK7. Similar to LYTACs, the bispecific aptamer chimeric strategy, the dendritic DNA chimeric (DENTAC) strategy, the integrin facilitated lysosomal degradation (IFLD) strategy, the aptamer-based LYTACs (Apt-LYTACs), the cytokine receptor-targeting membrane protein chimeric (KineTACs), and the covalent nanobody-based PROTAC strategy (GlueTAC) all mediate the degradation of transmembrane proteins through the endosome-lysosome pathway. In addition, there are few reports of bifunctional small molecule degraders that can degrade cell membrane proteins. Although these methods provide the benefit of degrading extracellular and transmembrane proteins, they still face challenges such as large molecular weight, limited permeability, and easy off-targeting compared to PROTACs. Therefore, there is an urgent need to develop a novel, easily synthesized, and more adaptable protein degrader that can specifically ubiquitinate cell membrane proteins to achieve their degradation. SUMMARY

[0004] The present application aims to overcome the defects of the prior art and provide a method for repositioning intracellular E3 ubiquitin ligase to achieve membrane protein degradation, referred to as RIETACs.

[0005] Another object of the present application is to provide a targeting membrane protein chimeric.

[0006] The specific principle of the present application is shown in Figure 1 RIETACs are composed of three modules: an aptamer targeting a cancer cell membrane protein (Aptamer), a low-pH insertion peptide (pHLIP-P) modified with a pomalidomide molecule at the C-terminus, and a middle-attached streptavidin (SA). pHLIP can insert into the cell membrane at a low extracellular pH (pHe, about 6.0-6.8) in the acidic tumor microenvironment (TME), but not at physiological pH (about 7.2-7.4). Pomalidomide is a ligand for ubiquitin ligase (CRBN). The aptamer binds to pHLIP-P through streptavidin to form Apt-pHLIP-P (targeting membrane protein chimeric), and the ratio of aptamer to pHLIP-P can be adjusted according to different degradation efficiencies. When Apt-pHLIP-P encounters a tumor cell, the aptamer can bind to the target membrane protein, and due to the acidity of the tumor microenvironment, pHLIP-P inserts into the cell membrane to recruit CRBN protein, repositioning the intracellular distribution of CRBN to the inside of the cell membrane, allowing the intracellular domain of the target protein to be ubiquitinated for degradation.

[0007] The technical scheme of the present application is as follows:

[0008] A method for repositioning intracellular E3 ubiquitin ligase to achieve degradation of membrane proteins, comprising the following steps:

[0009] (1) Assembling a targeting membrane protein chimera by using an aptamer targeting a membrane protein, a low-pH insertion peptide modified with pomalidomide molecules at the C-terminus, and streptavidin, wherein the low-pH insertion peptide can insert into the cell membrane under the condition of low extracellular pH of pH = 6.0-6.8, but not under the condition of physiological pH of pH = 7.2-7.4;

[0010] (2) Bringing the targeting membrane protein chimera close to a target cell having the above-mentioned low extracellular pH and the membrane protein targeted by the aptamer, so that the aptamer in the targeting membrane protein chimera binds to the membrane protein targeted thereby, and the low-pH insertion peptide is inserted into the cell membrane of the target cell due to the low extracellular pH, thereby triggering recruitment of pomalidomide to CRBN protein, repositioning CRBN distributed in the target cell to the inside of the cell membrane thereof, and degrading the intracellular domain of the targeted membrane protein by ubiquitination.

[0011] In a preferred embodiment of the present application, the amino acid sequence of the low-pH insertion peptide in the targeting membrane protein chimera is shown in SEQ ID NO. 05.

[0012] Further preferably, the nucleotide sequence of the aptamer is shown in SEQ ID NO. 01 or SEQ ID NO. 03.

[0013] In a preferred embodiment of the present application, in the targeting membrane protein chimera, the aptamer is connected to the low-pH insertion peptide through streptavidin.

[0014] Further preferably, the preparation method of the targeting membrane protein chimera comprises:

[0015] A. Synthetically preparing a low-pH insertion peptide modified with pomalidomide molecules at the C-terminus;

[0016] B. After mixing and incubating the aptamer and the streptavidin in a DPBS buffer at room temperature, adding the low-pH insertion peptide modified with pomalidomide molecules at the C-terminus, and continuing to mix and incubate at room temperature, the targeting membrane protein chimera is obtained.

[0017] More preferably, the molar ratio of the aptamer to the streptavidin is 1-3: 1-2.

[0018] Further preferably, the step A comprises: mixing 4-fluorosalidamide, azido-PEG3-amine, anhydrous DMF and DIPEA, and stirring the mixture at 80-90℃ for 3-5h; after the reaction is completed, adding ethyl acetate, and then washing with brine, followed by drying, silica gel column chromatography, gradient elution with petroleum ether and ethyl acetate, to obtain the reaction product; then dissolving the low-pH insertion peptide, the reaction product, CuSO4·5H2O and NaVC in a DMSO / H2O mixed solvent, stirring and placing in vacuum, and then reacting at room temperature for 10-12h, and then sequentially purifying by high performance liquid chromatography (HPLC) and freeze-drying to obtain the product.

[0019] A target membrane protein chimera is assembled from an aptamer targeting a membrane protein, a low-pH insertion peptide modified at the C-terminus with a pomalidomide molecule, and streptavidin, the aptamer being connected to the low-pH insertion peptide through streptavidin, the low-pH insertion peptide being capable of inserting into a cell membrane under the condition of a low extracellular pH of pH = 6.0-6.8, but not under the condition of a physiological pH of pH = 7.2-7.4.

[0020] In a preferred embodiment of the present application, the amino acid sequence of the low-pH insertion peptide in the target membrane protein chimera is as shown in SEQ ID NO. 05.

[0021] Further preferably, the nucleotide sequence of the aptamer is as shown in SEQ ID NO. 01 or SEQ ID NO. 03.

[0022] The present application has the beneficial effect that it can effectively utilize intracellular E3 ubiquitin ligase to achieve degradation of tumor cell membrane proteins without the need for intracellular delivery, thereby improving the degradation efficiency and expanding the application range of PROTACs to membrane proteins. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 A schematic diagram showing the principle of the repositioning of intracellular E3 ubiquitin ligase to achieve degradation of membrane proteins in the present application.

[0024] Figure 2 Apt-pHLIP-P complex in Example 1 of the present application is shown.

[0025] Figure 3 Apt-pHLIP-P complex in Example 1 of the present application is shown.

[0026] Figure 4 RIETACs strategy expansion results in Example 1 of the present application are shown. DETAILED DESCRIPTION

[0027] The technical solutions of the present application are further described and explained with reference to the specific embodiments and the accompanying drawings.

[0028] The sequences of the polypeptides and DNA involved in the following examples are shown in Table 1 below:

[0029] Table 1

[0030] Name Specific sequence (5'-3' or N-terminal - C-terminal) SYL3C cactacagaggttgcgtctgtcccacgttgtcatggggggttggcctg (SEQ ID NO. 01) B-SYL3C cactacagaggttgcgtctgtcccacgttgtcatggggggttggcctgttttt-Biotin (SEQ ID NO. 02) Mapt atcaggctggatggtagctcggtcggggtgggtgggttggcaagtctgat (SEQ ID NO. 03) B-Mapt atcaggctggatggtagctcggtcggggtgggtgggttggcaagtctgatttttt-Biotin (SEQ ID NO. 04) pHLIP Biotin-AEQNPIYWARYADWLFTTPLLLLDLALLVDADEGT-Pra (SEQ ID NO. 05)

[0031] Pra represents Propargylglycine.

[0032] Example 1

[0033] I. Experimental methods and procedures

[0034] (1) Synthesis of pHLIP-P:

[0035] a, 0.27 g of 4-fluorosalicylidimide (1.0 mmol, 1.0 eq) and 0.5 eq of azido-PEG3-amine were added to a 50 mL reaction round-bottom flask. Then, 10 mL of anhydrous DMF and 2 eq of DIPEA were added, and the mixture was stirred at 85 °C for 4 h. The reaction was monitored by TLC. When the reaction was completed, 50 mL of ethyl acetate was added, and the mixture was washed with brine several times and then dried over Na2S04. The solvent was removed, and the residue was purified by silica gel column chromatography eluted with petroleum ether and ethyl acetate (gradient elution from 10: 1 to 1: 1) to give the corresponding product Pomalidomide-PEG3-azide (abbreviated as P) as a yellow solid. 1H NMR (500 MHz, DMSO-d6) δ 11.12 (s, 1H), 7.63-7.57 (m, 1H), 7.16-7.04 (m, 2H), 6.61 (s, 1H), 5.10-5.04 (m, 1H), 3.62-3.47 (m, 15H), 3.36 (s, 1H), 2.92-2.86 (t, 1H), 2.62-2.45 (m, 2H), 2.06 (br s, 1H). 13C NMR (100 MHz, DMSO-d6) δ 173.29, 170.55, 169.41, 167.77, 146.87, 136.69, 132.56, 117.90, 111.14, 109.70, 70.33, 70.30, 70.25, 70.17, 69.72, 69.34, 50.45, 49.03, 42.17, 31.46, 22.62. Pomalidomide-PEG3-azide ([C 21 H 26N6O7-H] - Theoretical: 473.17902, Observed: 473.17899).

[0036] b. Dissolve pHLIP (as shown in SEQ ID NO. 05, 1.0 mg, 0.231 pmol, 1.0 eq), P (0.328 mg, 0.7 pmol, 3 eq), CuS04-5H20 (0.0346 mg, 0.139 pmol, 0.6 eq) and NaVC (0.183 mg, 0.924 pmol, 4.0 eq) in DMSO / H20 (1.0 ml, 1:3) mixture. After the mixture was stirred and placed in vacuum for 3 min, the reaction was carried out at room temperature overnight. Purify the conjugate (pHLIP-P) by high performance liquid chromatography (HPLC) and quantify by freeze-drying. Identify pHLIP-P by LC-MS (Theoretical: 4804.34, Observed: 4803.25).

[0037] (2) Assembly of chimeras

[0038] All aptamer-pHLIP-P samples were obtained by mixing aptamer (aptamer, biotin-anti-EpCAM, as shown in SEQ ID NO. 02, wherein SYL3C is shown in SEQ ID NO. 01) with streptavidin (SA) at a molar ratio of 1:1, 2:2 and 3:1 in DPBS buffer (5 mM MgCl2, pH = 7.4) at room temperature for 20 min, then adding pHLIP-P at different molar ratios, and incubating for another 20 min. The number of biotin molecules on the aptamer ranges from 3 to 6, so this example modifies the ratio combination of biotin-anti-EpCAM:SA:pHLIP-P = 1:3:9 (abbreviation: anti-EpCAM-pHLIP-P, i.e. membrane protein targeting chimera).

[0039] (3) pH-dependent membrane attachment of pHLIP peptides

[0040] The pH-dependent ability of pHLIP peptides to cross the cell membrane was studied by imaging and flow cytometry analysis. For flow cytometry analysis, SW480 cells cultured in 24-well cell culture plates for 24 h were incubated with 100 nM SA-488, SA-488-pHLIP-P in DPBS (pH 6.5 or 7.4) containing 5 mM Mg 2+ for 20 min at 37°C. The cells were washed and resuspended in DPBS (pH 6.5 or 7.4) containing 5 mM Mg 2+ for flow cytometry analysis. The data in this section were collected by the Beckman Cytoflex LX flow cytometer system and analyzed using FlowJo software.

[0041] The above SA-488 was purchased from Thermofisher (S32354).

[0042] The preparation of the above SA-488-pHLIP-P was performed according to the above step (2).

[0043] For CLSM imaging, SW480 cells were seeded into 35 mm glass-bottomed dishes for 24 h. Cells were incubated at 37 °C in cell culture medium with 5 mM Mg 2 + , pH 6.5 or 7.4, with 100 nM SA-488-pHLIP-P (1 : 1) for different time (0 h, 6 h, 12 h, 24 h). Cells were washed with DPBS (pH 6.5 or 7.4) containing 5 mM Mg 2+ . Cells were then fixed with 4% paraformaldehyde in DPBS. For observation of the localization of SA-488-pHLIP-P, cells were stained with DiD and DAPI and observed using a Zeiss LSM980 confocal microscope.

[0044] (4) Agarose gel electrophoresis

[0045] For agarose gel electrophoresis (AGE) of B-SYL3C, SYL3C2-(pHLIP-P)2 (molar ratio of SYL3C to pHLIP-P is 2:2), SYL3C1-(pHLIP-P)3 (molar ratio of SYL3C to pHLIP-P is 1:3), SYL3C3-(pHLIP-P)1 (molar ratio of SYL3C to pHLIP-P is 3:1), each sample (10 mM, 10 pL) was mixed with 6x loading buffer (2 pL) and loaded into a 3% GelRed-stained agarose gel. Electrophoresis was performed in 2x TAE buffer (80 mM Tris-acetate and 2 mM EDTA, pH 8.0-8.6) at 120 V for 45 min. The gel was then imaged using a CLINX GenoSens 2200 system.

[0046] For agarose gel electrophoresis (AGE) of SA-488, SA-488-pHLIP-P, anti-EpCAM-pHLIP-P, each sample (3 mM, 4 pL) was mixed with 5x sample loading buffer (1 pL) and loaded into a 3% polyacrylamide gel. Electrophoresis was performed in 1x Tris-glycine buffer (25 mM Tris base; 192 mM glycine, pH 8.3) at 120 V for 50 min. The gel was then imaged using a CLINX GenoSens 2200 system at 488 nm excitation.

[0047] (5) Flow cytometry analysis of the binding ability of aptamer or aptamer chimera to target cells

[0048] To determine the binding ability of aptamer or aptamer chimera to target cells, SW480 (or HeLa) cells cultured in 24-well cell culture plates for 24 h were incubated with different aptamers or aptamer chimeras, SYL3C and Mapt aptamer, respectively, in DPBS (2 mg / ml BSA, 0.2 μg / ml tRNA, 5 mM Mg 2+ , pH 7.4) at room temperature for 30 min. Cells were washed three times with DPBS containing 5 mM Mg 2 + , pH 7.4. Then the cells were resuspended in 200 μL binding buffer. Labeled cells were analyzed on a Beckman Cytoflex LX flow cytometer system, counting 10000 events. Data analysis was performed using FlowJo software.

[0049] (6) Western Blot analysis

[0050] All cells were seeded in 6-well cell culture plates 24 h before the experiment. To detect the effect of SYL3C-pHLIP-P on EpCAM protein level, SW480 cells were treated with 400 nM B-SYL3C aptamer, pHLIP-P, SYL3C1-(pHLIP)3 for 48 h, or with different concentrations of B-SYL3C aptamer, SYL3C1-(pHLIP-P)3 for 48 h, or with 400 nM B-SYL3C aptamer, SYL3C1-(pHLIP-P)3, SYL3C1-(pHLIP-P)1 (molar ratio of SYL3C to pHLIP-P is 1:1), SYL3C2-(pHLIP-P)2, SYL3C3-(pHLIP-P)1, 6 nM anti-EpCAM-pHLIP-P at pH 6.5 for different time, respectively. To evaluate the level of Met protein, Hela cells were treated with 400 nM B-Mapt aptamer (as shown in SEQ ID NO. 04, wherein Mapt is as shown in SEQ ID NO. 03) and Mapt1-(pHLIP-P)3 for different time, respectively. Then the cells were washed with DPBS for three times and lysed with RIPA buffer containing protease inhibitor cocktail and phosphatase inhibitor cocktail on ice for 30 min. The samples were centrifuged at 14,000 rpm for 15 min. The protein concentration was determined by BCA method. Equal amount of lysates were loaded on 8% SDS-polyacrylamide gel electrophoresis and transferred to PVDF membrane. The levels of EpCAM and Met were analyzed by immunoblotting using aptamers against EpCAM, Met, β-tubulin and GAPDH. The Western Blot bands were detected by electrochemiluminescence (ECL) Western Blot substrate. The gray value of the image was analyzed by Image J.

[0051] II. Experimental results

[0052] (1) Construction and characterization of RIETACs.

[0053] In this example, the azido-modified pomalidomide molecule (P) was synthesized, and a Click reaction was performed with the alkyne-modified pHLIP. The successful construction of pHLIP-P was verified by mass spectrometry, and the results are as follows Figure 2The results showed that SA-488-pHLIP-P had a good response to bind to cells at pH 6.5, while SA-488-pHLIP-P had almost no binding to SW480 cells at pH 7.4. Confocal also verified that SA-488-pHLIP-P could be retained on the cell membrane within 24h at pH 6.5, with slight internalization, which was consistent with the previous reported results. Subsequently, the present embodiment used streptavidin to assemble biotin-modified aptamer (Biotin-SYL3C) and Biotin-PHLIP-P at different molar ratios of 3:1, 2:2, 1:3, etc., and used agarose gel to characterize. SW480 cells are human colon adenocarcinoma cells with high expression of EpCAM protein, so it is selected as the targeted tumor cell line of SYL3C. Cell binding verification was performed on the SYL3C-pHLIP-PTAC complex, and the results showed that the series of SYL3C-pHLIP-PTAC maintained good targeting.

[0054] (2) Characterization of the ability of the series of SYL3C-pHLIP-PTAC complexes to degrade EpCAM protein

[0055] As Figure 3Results: In the Western Blot experiment, under the condition of pH 6.5 medium, the SYL3C1-(pHLIP-P)3 was found to have the best degradation effect on EpCAM protein, followed by SYL3C2-(pHLIP-P)2, and the result was further verified by immunofluorescence experiment. In the pH 7.4 medium, SYL3C1-(pHLIP-P)3 could not produce a degradation effect on EpCAM protein, which proved that the insertion of pHLIP-P into the cell caused the ubiquitination of the target protein by E3 ubiquitinase and degradation. However, neither SYL3C3-(pHLIP-P)1 nor SYL3C1-(pHLIP-P)1 showed a greater degradation effect. Subsequently, SYL3C1-(pHLIP-P)3 was selected for concentration gradient experiment under the condition of pH 6.5, 48h, and the results showed that the degradation of EpCAM changed with the concentration in a dependent manner, and the best degradation effect was achieved at 400nM. When the concentration increased, a certain "hook effect" appeared. For the time gradient characterization of pH 6.5 medium and Biotin-SYL3C, and the different concentrations of SYL3C1-(pHLIP)3 under pH 7.4, no degradation of EpCAM was observed. Further, 400nM of Biotin-SYL3C, SYL3C1-(pHLIP)3 without pomalidomide molecules, and Biotin-pHLIP-P were used for drug administration experiment under the condition of pH 6.5, 48h, and the results showed that only SYL3C1-(pHLIP-P)3 could achieve protein degradation, which indicated the effectiveness and necessity of the assembly of RIETACs for protein degradation. For the degradation pathway of cell membrane protein, lysosome inhibitor bafilomycin A1 and proteasome inhibitor MG132 were used to inhibit protein degradation in cells, and the Western Blot experiment results showed that the proteasome inhibitor MG132 could well inhibit the degradation of the protein, while bafilomycin A1 could not. This result showed that the degradation of RIETACs to cell membrane protein was the proteasome pathway rather than the lysosome pathway. Subsequently, the cell viability test found that 400nM of SYL3C1-(pHLIP-P)3 had little effect on the viability of SW480 cells within 48h. However, 400nM of SYL3C1-(pHLIP-P)3 had an inhibition ability of nearly 4 times on the migration ability of SW480 cells.

[0056] (3) Biotin-pHLIP-P can recruit E3 ubiquitin ligase (CRBN) to the vicinity of the cell membrane

[0057] This example demonstrates that the degradation of the protein is caused by Biotin-pHLIP-P recruiting E3 ubiquitin ligase (CRBN) to the inner edge of the cell membrane. In the pH 6.5 medium, this example uses and does not use Biotin-pHLIP-P to incubate SW480 cells for 24 h, and then uses CRBN primary antibody and AF647-goat anti-rabbit secondary antibody for immunofluorescence imaging. This example found that the CRBN protein inside the cell was passively aggregated near the cell membrane by the insertion of Biotin-pHLIP-P into the membrane and the recruitment of pomalidomide, and the protein fluorescence and cell membrane fluorescence overlap correlation coefficient was about 0.79.

[0058] (4) RIETACs strategy expansion

[0059] This example investigates whether the strategy of this example can be applied to the degradation of other proteins, and the results are as follows Figure 4As a cell membrane receptor Met is a target of clinical drugs. Abnormal activation of MET pathway occurs in many solid tumors, including brain cancer, breast cancer. Mapt aptamer is a nucleic acid aptamer targeting Met protein, which has been widely used in Met protein targeting detection of tumor cells. Based on the results of EpCAM protein degradation, this embodiment uses flow cytometry to characterize the ability of nucleic acid aptamer Mapt1-(pHLIP-P)3 to target Hela cells with Mapt, which shows that it is not affected by pHLIP-P. In the Western Blot experiment results, it can be seen that the degradation of Met protein is event-dependent and concentration-dependent. At pH 6.5, 36h, 400nM of Mapt1-(pHLIP-P)3 can degrade 87% of the cell membrane Met protein, and at pH 7.4, protein degradation does not occur, and as the concentration increases, a certain "hook effect" is shown. 400nM of B-Mapt does not achieve degradation, indicating that Mapt nucleic acid aptamer itself does not have a protein degradation effect. Cell scratch experiment shows that 400nM of Mapt1-(pHLIP-P)3 has an inhibition ability of about 2 times on the migration ability of Hela cells. Although there have been many reports of nucleic acid aptamers used for drug research, the number is limited, and existing aptamers have more characteristics of more targets. In order to realize the more universal verification of the strategy of this embodiment, this embodiment looks for aptamers as ligands targeting proteins. This embodiment assembles and combines commercial biotin-anti-EpCAM and biotin-pHLIP-P through SA. There are 3-6 biotins on a biotin-anti-EpCAM, so this embodiment modifies the ratio combination of biotin-anti-EpCAM:SA:biotin-pHLIP-P=1:3:9(referred to as: anti-EpCAM-pHLIP-P), which is verified by agarose gel electrophoresis with SA-488 fluorescence to be successfully assembled, and flow cytometry to characterize anti-EpCAM-pHLIP-P can target and bind SW480 cell EpCAM protein. Western Blot experiment results show that anti-EpCAM-pHLIP-P can also degrade cell membrane EpCAM protein. The strategy of this embodiment is also applicable to the change of aptamer as a ligand targeting protein.

[0060] In summary, this application reports the design and construction of RIETACs for proteasome-targeted degradation of membrane-associated proteins. The specific principle is as follows Figure 1 As shown, RIETACs can target tumor cell membrane proteins, recruit E3 ubiquitin ligase in the cell interior through pHLIP-P transmembrane, and transport cell membrane proteins to the proteasome for degradation.

[0061] The present application has the following key advantages:

[0062] (1) Compared with the reported methods, the targeted membrane protein chimera designed in the present application can achieve the degradation of cell membrane proteins in the tumor micro-acid environment, while it does not occur in the normal healthy tissue environment.

[0063] (2) The aptamer type in the present application can be simply changed for different proteins, so that the strategy has wide applicability.

[0064] (3) The aptamer preparation process in the present application is simple, which can be easily synthesized and combined to have a specific binding site.

[0065] (4) The aptamer and pHLIP-P in the present application can be precisely and flexibly assembled in quantity, and three pHLIP-P can recruit the abundant E3 ubiquitin ligase inside the cell to improve the degradation efficiency.

[0066] The RIETACs established in the present application will provide a powerful and promising universal platform for degrading cell membrane proteins, thereby providing new ideas and application prospects for targeted protein degradation technology and clinical drug design.

[0067] The above description is only a preferred embodiment of the present application, and therefore cannot limit the scope of the present application. Any equivalent changes and modifications made in accordance with the scope and content of the present patent should still be within the scope of the present application.

Claims

1. A method of repositioning an intracellular E3 ubiquitin ligase for degradation of a membrane protein for non-therapeutic purposes, characterized in that, It comprises the following steps: (1) an aptamer targeting membrane protein modified by biotin, a low-pH insertion peptide with N-terminal modified by biotin and C-terminal modified by pomalidomide molecule and streptavidin are assembled to prepare a membrane protein targeting chimera, the low-pH insertion peptide can insert into the cell membrane under the condition of low extracellular pH of pH=6.0-6.8, but not under the condition of physiological pH of pH=7.2-7.4; the low-pH insertion peptide with N-terminal modified by biotin and C-terminal modified by pomalidomide molecule is prepared by Click reaction of azide-modified pomalidomide molecule and low-pH insertion peptide with N-terminal modified by biotin and C-terminal modified by alkynyl, and the amino acid sequence is shown as SEQ ID NO. 05; the nucleotide sequence of the aptamer is shown as SEQ ID NO. 01 or SEQ ID NO. 03, and the aptamer is connected to the low-pH insertion peptide through streptavidin; (2) the membrane protein targeting chimera is close to a target cell with the membrane protein targeted by the aptamer and low extracellular pH, so that the aptamer in the membrane protein targeting chimera is combined with the membrane protein targeted by the aptamer, and the low-pH insertion peptide is inserted into the cell membrane of the target cell due to the low extracellular pH, thereby triggering pomalidomide to recruit CRBN protein, repositioning CRBN distributed in the target cell to the inside of the cell membrane, and degrading the intracellular domain of the targeted membrane protein by ubiquitination.

2. The method of claim 1, wherein: The preparation method of the membrane protein targeting chimera comprises: A. synthesizing and preparing a low-pH insertion peptide with N-terminal modified by biotin and C-terminal modified by pomalidomide molecule; B. in a DPBS buffer, the aptamer is mixed with the streptavidin at room temperature, then the low-pH insertion peptide with N-terminal modified by biotin and C-terminal modified by pomalidomide molecule is added, and the mixture is further incubated at room temperature.

3. The method of claim 2, wherein: The molar ratio of the aptamer to the streptavidin is 1-3: 1-2.

4. The method of claim 2, wherein, The step A comprises: mixing 4-fluorosalidomide, azide-PEG3-amine, anhydrous DMF and DIPEA, and stirring and reacting at 80-90°C for 3-5h; after the reaction is completed, ethyl acetate is added, then washed with brine, and then sequentially dried, purified by silica gel column chromatography, gradient eluted with petroleum ether and ethyl acetate, to obtain a reaction product; then the low-pH insertion peptide, the reaction product, CuSO4·5H2O and NaVC are dissolved in a DMSO-H2O mixed solvent, stirred and placed in vacuum, and then reacted at room temperature for 10-12h, and then sequentially purified by high performance liquid chromatography (HPLC) and freeze-dried.

5. A targeted membrane protein chimera, characterized in that: The aptamer targeting membrane protein modified by biotin, the low-pH insertion peptide with N-terminal modified by biotin and C-terminal modified by pomalidomide molecule and the streptavidin are assembled, the aptamer is connected to the low-pH insertion peptide through the streptavidin, and the low-pH insertion peptide can insert into the cell membrane under the condition of low extracellular pH of pH=6.0-6.8, but not under the condition of physiological pH of pH=7.2-7.4; The low-pH insertion peptide of the above-mentioned molecule modified with biotin at the N terminus and pomalidomide at the C terminus is prepared by Click reaction of an azide-modified pomalidomide molecule and a low-pH insertion peptide modified with biotin at the N terminus and an alkyne group at the C terminus, and has an amino acid sequence as shown in SEQ ID NO. 05; the nucleotide sequence of the above-mentioned aptamer is as shown in SEQ ID NO. 01 or SEQ ID NO.

03. The low-pH insertion peptide of the above-mentioned molecule modified with biotin at the N terminus and pomalidomide at the C terminus is prepared by Click reaction of an azide-modified pomalidomide molecule and a low-pH insertion peptide modified with biotin at the N terminus and an alkyne group at the C terminus, and has an amino acid sequence as shown in SEQ ID NO. 05; the nucleotide sequence of the above-mentioned aptamer is as shown in SEQ ID

Images