An SNP molecular marker related to the growth traits of hens and its application
By detecting the genotype of specific SNP sites on the hen chromosomes, the inefficiency problem of weight selection in brooding breeding in hen breeding is solved, and efficient and accurate breeding methods are achieved, reducing production costs.
Patent Information
- Application Number
- CN202411423006.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-12
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2044-10-12
AI Technical Summary
The prior art is difficult to efficiently and accurately use SNP markers to select hen growth traits, especially weight selection during brooding, resulting in high production costs and low efficiency.
The SNP molecular markers at the 76022389 and 76070237 sites of Chicken chromosome 4 were used, with genotypes A/T and T/C respectively. The genotypes were detected by PCR amplification technology and AA or TT individuals were selected for breeding.
The precise selection of hens’ weight at 0-18 weeks is achieved, the breeding process is simplified, the human and material costs are significantly reduced, and the breeding efficiency and selection accuracy are improved.
Smart Images

Figure CN118995960B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to an SNP molecular marker related to the growth traits of hens and its application. Background Art
[0002] Growth traits are one of the most important economic traits of chickens. During the chicken breeding process, by measuring and analyzing growth traits, the growth and development status of individuals can be understood, and their production performance and genetic potential can be evaluated. The growth process of animals generally has the characteristics of non-linearity. During the growth and development process of animals, the use of non-linear models can better enable researchers to describe and understand the growth and development process of animals. The analysis and fitting of the chicken growth curve is one of the main methods to study the regularity of a part or the whole of a chicken during the growth and development process. Fitting the growth and development indicators through a non-linear model can not only predict the growth trend and growth and development law of chickens, help farmers master the growth and development dynamics of the chicken flock, provide fine management guidance for the daily feeding management of chickens, and timely adjust the feeding management plan, but also, as an important economic indicator, the growth curve characteristics, using mathematical models to predict the growth pattern of poultry is a common way in breeding. By fitting and analyzing the growth curve of chickens, the breeding cost can be reduced. At the same time, it can also help to understand the physiological and biochemical mechanisms of chickens, provide a basis for further optimizing the breeding plan and improving the breeding efficiency, so as to improve the breeding effect. The Gompertz model is often used in chicken breeding and production. Through the parameters of the model, the production data of chickens at different growth stages can be calculated and predicted to explore the growth and development laws of chickens in different growth environments or different breeds, and the effects of environmental factors such as nutrition and temperature on growth can also be studied, so as to guide the feeding management and breeding work of chickens.
[0003] SNP refers to DNA sequence polymorphism caused by single nucleotide variation occurring at the genomic DNA level, which has the characteristics of rich loci, wide distribution, high genetic stability, representativeness, convenient and rapid detection, etc. In view of the fact that growth curve parameters are crucial for improving the production management and production efficiency of chickens, there is an urgent need in scientific research and production to develop SNP markers significantly related to the growth curve and apply them to the feeding management and breed selection work of chickens. Summary of the Invention
[0004] The present invention provides an SNP molecular marker related to the growth traits of hens and its application, and discovers that two main SNPs (4:76022389, 4:76070237) are significantly related to the growth curve. Among them, the AA genotype at the 4:76022389 locus and the TT genotype at the 4:76070237 locus are related to high body weight at 0-18 weeks of age and can be used as molecular markers for the growth traits of local chicken breeds, solving the problems existing in the prior art.
[0005] One of the technical solutions adopted by the present invention is as follows:
[0006] A SNP molecular marker related to the growth traits of hens is provided. The SNP molecular marker is located at positions 76022389 and 76070237 on chicken chromosome 4, and the genotypes are A / T and T / C respectively.
[0007] Table 1 SNP loci related to the growth traits of Wenshang Luhua chickens
[0008]
[0009] Furthermore, the genotypes of the SNP molecular markers at positions 76022389 and 76070237 are AA and TT respectively.
[0010] Furthermore, the SNP molecular marker is located in the nucleotide sequences shown in SEQ ID No1 and SEQ ID No2 below; among them, the mutation at position 4:76022389 is located in the sequence shown in SEQ ID No1; the mutation at position 4:76070237 is located in the sequence shown in SEQ ID No2;
[0011] SEQ ID No1:
[0012] ATTTACAGGGCTAATTAGAAAGTGGTTTCTTTGATGTCTTTCTTGGATAACTGTCTCTAATAT CTGCTCCTGACAAGGCTCATGGGAGACGTAATGATTC[T / A]GAGAATGACTCAGCAGAGGATTTCT TACTTTTTTCTAGCCTGAAATAGATACTTGATTAGTGACAGTACACCCAGACCTCATTTTTAGGAAG AAAAGGGT;
[0013] SEQ ID No2:
[0014] CGGGAAAGTGAAACTGAATATGAAAAACACTTGGCTAAGTGCCAAGTTCTTTCTCCAGGGTCG TGCCTTTTATAGCTAAACTTAATGTAGAATTATTTCA[C / T]GGATGCTGGGAAGAAGAATCTTTCA ACTTGCTGAACAGCAGCAACATTATTCTTTACTTGTAACCTCAAGTGCCTGCCGAGGCTCTGCAGGA GGTAACAA.
[0015] Another technical solution adopted by the present invention is as follows:
[0016] Provided is a set of SNP primers for selecting growth traits of hens. The primer set is a primer set for detecting the combination of the aforementioned SNP molecular markers, and the primer set sequences are as follows:
[0017] For the reverse primer of 4:76022389, as shown in SEQ ID No3 and SEQ ID No4, and the forward primer is as shown in SEQ ID No5:
[0018] SEQ ID No3 R1: GAAGGTGACCAAGTTCATGCTAAATCCTCTGCTGAGTCATTCTCA;
[0019] SEQ ID No4 R2: GAAGGTCGGAGTCAACGGATTAAATCCTCTGCTGAGTCATTCTCT;
[0020] SEQ ID No5 F1: TGATGTCTTTCTTGGATAACTGTCTC;
[0021] For the reverse primer of 4:76070237, as shown in SEQ ID No6 and SEQ ID No7, and the forward primer is as shown in SEQ ID No8:
[0022] SEQ ID No6 R1: GAAGGTGACCAAGTTCATGCTATTCTTCTTCCCAGCATCCG;
[0023] SEQ ID No7 R2: GAAGGTCGGAGTCAACGGATTGATTCTTCTTCCCAGCATCCA;
[0024] SEQ ID No8 F1: CAGGGTCGTGCCTTTTATAGC.
[0025] The third technical solution adopted by the present invention is:
[0026] A kit for detecting the aforementioned SNP molecular markers, and the kit contains the above primer set.
[0027] Furthermore, the kit further includes the following PCR amplification system: 2×PARMS master mix 5 μL, Allele X primer (10 μM), Allele Y primer (10 μM) each 0.15 μL, Common primer (10 μM) 0.4 μL, DNA template 10 - 100 ng, supplemented with ddH2O to 10 μL.
[0028] Furthermore, the PCR amplification reaction conditions are as follows: 94°C, 20 min, 1 cycle; 94°C, 20 s, 10 cycles, 65 - 57°C, 1 min, 10 cycles; 94°C, 20 s, 32 cycles, 57°C; 1 min, 32 cycles.
[0029] The present invention also provides the following technical solution four:
[0030] The application of the SNP molecular marker as described above in the selective breeding of hen growth traits.
[0031] Furthermore, by detecting the genotypes of SNP molecular markers related to hen growth traits, individuals with genotypes A / T and T / C at positions 76022389 and 76070237 on chicken chromosome 4 are selected as chicken breeds, and their growth traits are excellent.
[0032] Furthermore, the growth trait is the weight during the brooding and rearing stages; preferably, the high weight at 0 - 18 weeks of age.
[0033] Furthermore, the application includes the following steps:
[0034] (1) Extract genomic DNA from the sample;
[0035] (2) Perform allele sequencing on the DNA of the sample to be tested using the aforementioned primer set;
[0036] (3) Obtain the genotypes of the SNP corresponding sites of the sample to be tested;
[0037] (4) Select individuals with the AA genotype at the 4:76022389 site or the TT genotype at the 4:76070237 site for breeding.
[0038] Furthermore, in step (1), the sample is wing vein blood.
[0039] Advantages of the present invention:
[0040] 1. The present invention first proposes SNP sites related to the hen growth curve.
[0041] 2. The SNP molecular markers used in the present invention are derived from the whole - genome SNP dataset, different from the previous situation of only using the growth curve to simulate the growth of chickens, and the identification of the growth traits of the sample is more accurate.
[0042] 3. The two SNP sites determined by the genome - wide association analysis of 362 Wenshang Luhua hen can be used for the weight selection at any time during the brooding and rearing periods of hens, different from the previous situation where SNPs can only be applied to the weight selection in a single time period. Using the two SNP sites provided by the present invention is more efficient and the effect is more accurate.
[0043] 4. The weight selection of chicken flocks during the brooding and rearing periods can be achieved by using the two SNP loci identified by the present invention. The method is simple and fast, solving the problem of simulating the growth curve by weighing the whole flock in the past, saving a large amount of manpower and material resources, and significantly reducing the production cost.
[0044] 5. The present invention provides strong technical support for the selection of growth traits and genetic breeding of hens in the future. BRIEF DESCRIPTION OF THE DRAWINGS
[0045] Figure 1 They are QQ-plots and Manhattan plots of GWAS;
[0046] Figure 2 They are growth curves of different genotypes at the 4:76022389 locus of the present invention and Gompertz growth curves;
[0047] Figure 3 They are growth curves of different genotypes at the 4:76070237 locus of the present invention and Gompertz growth curves;
[0048] Figure 4 They are polymorphism detection maps of the 4:76022389 and 4:76070237 loci of the present invention. DETAILED DESCRIPTION OF THE INVENTION
[0049] To clearly illustrate the technical features of the present solution, the present invention will be described in detail below through specific embodiments in conjunction with the accompanying drawings.
[0050] Example 1 Screening SNPs Related to Growth Curves
[0051] 1. Experimental Materials and Trait Measurement
[0052] 362 Wenshang Luhua hens were randomly selected from Shandong Jinqiu Animal Husbandry Technology Co., Ltd., and the individual weights at 0, 2, 4, 6, 8, 10, 12, 14, 16, and 18 weeks of age were recorded.
[0053] 2. Estimation of Gompertz Growth Curve Parameters
[0054] In the R environment, the nlme software package was used to fit three parameters of the non-linear model Gompertz for each chicken. Among them, A is the mature weight, which means the final weight of the individual; b is the time scale parameter, which represents the time when the individual reaches the maximum growth rate; k is the maturation rate, which means the rate at which the individual approaches its mature weight.
[0055] 3. Genome Re-sequencing
[0056] Blood was collected from the wing veins of the experimental chickens, and total genomic DNA was extracted using the conventional phenol-chloroform method. The quality and quantity of the DNA were determined using a NanoDrop ND-2000 spectrophotometer and agarose gel electrophoresis. All individuals were sequenced using the DNBSEQ sequencing platform (BGI Genomics, Shenzhen, China) with paired-end reads of 150 bp, and sequence data for all libraries were obtained, with an average sequencing depth of 7X.
[0057] 4. Genome-wide association analysis of growth curve parameters
[0058] The linear mixed model in the Genome-wide Efficient Mixed Model Association (GEMMA) software (v0.98.4) was used to perform association analysis of A, b, and k in chickens genotyped by whole-genome sequencing. The formula for GWAS is as follows:
[0059] y = Wα + Xβ + u + e
[0060] where y represents the vector of phenotypic values; w represents the vector of covariates; α is the vector of SNP corresponding coefficients; x represents the SNP vector; β represents the SNP effect; u represents the vector of random polygenic effects; and e is the error vector.
[0061] After GWAS analysis, the obtained SNPs were subjected to linkage disequilibrium (LD) pruning with a window size of 25 SNPs and a step size of 5 SNPs, and an r 2 threshold of 0.2, resulting in 837,332 independent SNP markers. The genome-wide significant and suggestive significance thresholds were corrected by Bonferroni test (0.05 / 837,332 and 1 / 837,332, respectively). Manhattan and QQ plots were drawn using the CMplot package in the R environment.
[0062] 5. Results and analysis
[0063] See Figure 1 the Manhattan and QQ-plots of the GWAS in. In the QQ-plot, most of the points are near the diagonal, indicating that the results are relatively accurate. In the Manhattan plot, there are 44 significant SNPs for mature body weight (A), located on chicken chromosomes (GGA) 1, 4, 5, 6, and 7. There are 103 significant SNPs for the time-scale parameter (b), located on GGA 1, 3, 4, and 13. For the maturation rate (K), five significant loci are located on GGA 12, 15, 17, and 26, respectively. All results are shown in Table 2, where 4:76022389 and 4:76070237 are used as lead SNPs and are significantly associated with mature body weight (A) and the time-scale parameter (b), respectively.
[0064] Table 2 SNPs significantly associated with growth curve parameters
[0065]
[0066]
[0067]
[0068]
[0069] Example 2 Difference analysis of growth curve fitting and body weight traits of different genotypes at two SNP loci 4:76022389 and 4:76070237
[0070] 1. Experimental method
[0071] The growth curves of individuals with different genotypes at loci 4:76022389 and 4:76070237 were generated using EXCEL and compared with the Gompertz growth curve. The difference comparison analysis of growth traits of different genotypes at two SNP loci was carried out using SPSS 25.0 software.
[0072] 2. Results and analysis
[0073] 2.1 Fitting of growth curves of individuals with different genotypes to the Gompertz growth curve
[0074] From Figure 2 and Figure 3 it can be seen that the body weight curves of AA and TT genotype individuals at locus 4:76022389 are consistent with the Gompertz growth curve, and the body weight of AA genotype individuals is higher than that of TT genotype individuals at the same week age. The body weight curves of CC and TT genotype individuals at locus 4:76070237 are consistent with the Gompertz growth curve, and the body weight of TT genotype individuals is higher than that of CC genotype individuals at the same week age.
[0075] 2.2 Comparative analysis of growth traits of different genotypes at two significantly correlated SNPs loci
[0076] As can be seen from Table 3, for locus 4:76022389, the body weight of AA genotype individuals at 0 - 18 weeks of age is higher than that of TT genotype individuals, and there are significant differences (p < 0.05) between the two genotypes at other weeks except for the 2nd and 4th weeks. For locus 4:76070237, the body weight of TT genotype individuals is higher than that of CC genotype at other weeks except for the 2nd week, and there are significant differences (p < 0.05) between the two genotypes from the 8th to 18th weeks.
[0077] Table 3. Comparison results of body weight between individuals with different genotypes of significantly correlated SNPs
[0078]
[0079] Note: Different capital letters in the same row with superscripts indicate significant differences (p < 0.05).
[0080] Example 3 Design and verification of KASP primers for two SNP loci 4:76022389 and 4:76070237
[0081] 1. Experimental materials
[0082] Forty-eight experimental samples of Wenshang Luhua chicken hens were from Shandong Jinqiu Animal Husbandry Technology Co., Ltd. Blood was collected from the wing vein, and genomic DNA was extracted by the conventional phenol-chloroform method.
[0083] 2. Primer design and PCR amplification
[0084] Primers were designed according to the flanking sequences of the two SNP loci. The two SNP loci and their flanking sequences are as follows (the mutation points are shown in the boxes): Primer information is shown in Table 4.
[0085] 4:76022389: ATTTACAGGGCTAATTAGAAAGTGGTTTCTTTGATGTCTTTCTTGGATAACT GTCTCTAATATCTGCTCCTGACAAGGCTCATGGGAGACGTAATGATTC[T / A]GAGAATGACTCAGC AGAGGATTTCTTACTTTTTTCTAGCCTGAAATAGATACTTGATTAGTGACAGTACACCCAGACCTCA TTTTTAGGAAGAAAAGGGT
[0086] 4:76070237: CGGGAAAGTGAAACTGAATATGAAAAACACTTGGCTAAGTGCCAAGTTCTTT CTCCAGGGTCGTGCCTTTTATAGCTAAACTTAATGTAGAATTATTTCA[C / T]GGATGCTGGGAAGA AGAATCTTTCAACTTGCTGAACAGCAGCAACATTATTCTTTACTTGTAACCTCAAGTGCCTGCCGAG GCTCTGCAGGAGGTAACAA
[0087] Table 4 KASP detection primer sequences
[0088]
[0089] The PCR amplification reaction system is as follows:
[0090] Table 5 PCR Amplification Reaction System
[0091]
[0092] The PCR amplification reaction conditions are as follows:
[0093] Table 6 PCR Amplification Reaction Conditions
[0094]
[0095] 1. Genotyping
[0096] After PCR is completed, use a TECAN infinite M1000 microplate reader to read the fluorescence signal, then use the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) to analyze and convert the fluorescence signal, and output the genotype results according to different colors.
[0097] 2. Results and Analysis
[0098] The detection rate of the KASP technology for 48 samples is 100%, and the polymorphism detection map is clear, indicating that the detection primers designed for the 2 loci are effective and the detection method is feasible.
[0099] Table 7 Polymorphism Detection of 2 Loci
[0100]
[0101] The above specific implementation manners cannot be used as a limitation to the protection scope of the present invention. For those skilled in the art of this technology, any alternative improvement or transformation made to the implementation manner of the present invention falls within the protection scope of the present invention.
[0102] Where the present invention is not described in detail, it is common knowledge to those skilled in the art of this technology.
Claims
1. Application of a SNP molecular marker combination in selective breeding for body weight growth traits of hens, characterized in that, The SNP molecular marker combination is located at positions 76,022,389 and 76,070,237 on chicken chromosome 4, with the genotypes being AA and TT respectively; among them, the mutation at position 4:76022389 is located in the sequence shown in SEQ ID No: 1; the mutation at position 4:76070237 is located in the sequence shown in SEQ ID No: 2; SEQ ID No: 1: ATTTACAGGGCTAATTAGAAAGTGGTTTCTTTGATGTCTTTCTTGGATAACTGTCTCTAATATCTGCTCCTGACAAGGCTCATGGGAGACGTAATGATTC[T / A]GAGAATGACTCAGCAGAGGATTTCTTACTTTTTTCTAGCCTGAAATAGATACTTGATTAGTGACAGTACACCCAGACCTCATTTTTAGGAAGAAAAGGGT; SEQ ID No: 2: CGGGAAAGTGAAACTGAATATGAAAAACACTTGGCTAAGTGCCAAGTTCTTTCTCCAGGGTCGTGCCTTTTATAGCTAAACTTAATGTAGAATTATTTCA[C / T]GGATGCTGGGAAGAAGAATCTTTCAACTTGCTGAACAGCAGCAACATTATTCTTTACTTGTAACCTCAAGTGCCTGCCGAGGCTCTGCAGGAGGTAACAA。 2. The application according to claim 1, characterized in that, By detecting the genotypes of SNP molecular markers related to the body weight growth traits of hens, individuals with genotypes AA and TT at positions 76022389 and 76070237 on chicken chromosome 4 are selected as chicken breeds, and they have good body weight growth traits during the brooding and rearing stages.
3. The application according to claim 2, characterized in that, It includes the following steps: (1) Extract genomic DNA from the sample; (2) Use a primer set to perform allele sequencing on the DNA of the sample to be tested; (3) Obtain the genotypes of the SNP corresponding sites of the sample to be tested; (4) Select individuals with the AA genotype at the 4:76022389 site and the TT genotype at the 4:76070237 site for breeding; Among them, the primer set sequences are: The reverse primers for 4:76022389 are as shown in SEQ ID No: 3 and SEQ ID No: 4, and the forward primer is as shown in SEQ ID No: 5: SEQ ID No: 3 R1: GAAGGTGACCAAGTTCATGCTAAATCCTCTGCTGAGTCATTCTCA; SEQ ID No: 4 R2: GAAGGTCGGAGTCAACGGATTAAATCCTCTGCTGAGTCATTCTCT; SEQ ID No: 5 F1: TGATGTCTTTCTTGGATAACTGTCTC; The reverse primers of 4:76070237 are shown as SEQ ID No: 6 and SEQ ID No: 7, and the forward primer is shown as SEQ ID No: 8: SEQ ID No: 6 R1: GAAGGTGACCAAGTTCATGCTATTCTTCTTCCCAGCATCCG; SEQ ID No: 7 R2: GAAGGTCGGAGTCAACGGATTGATTCTTCTTCCCAGCATCCA; SEQ ID No: 8 F1: CAGGGTCGTGCCTTTTATAGC.