Molecular markers located on chromosome 2 and related to the regeneration ability of plant height after mowing in alfalfa and their application

Abstract

The present invention belongs to the technical field of molecular markers, and discloses an InDel molecular marker located on chromosome 2 and related to the plant height regeneration ability of alfalfa after mowing and its application. The present invention reflects the plant regeneration ability of alfalfa within a certain period of time after mowing by measuring the plant height of alfalfa regenerated two weeks after mowing. The InDel molecular marker is located on chromosome 2 of alfalfa, and the nucleotide sequence of the inserted or deleted fragment is shown in the sequence table SEQ ID NO.3. The primer pair used to amplify the InDel molecular marker has a nucleotide sequence shown in SEQ ID NO.1-2. The InDel molecular marker and the primer pair described in the present invention can identify or assist in identifying the plant height regeneration ability of alfalfa after mowing. At the same time, the present invention also provides a method for quickly identifying the plant height regeneration ability of alfalfa after mowing using the InDel molecular marker. The method is simple and fast, the identification result is accurate, and it has a good prospect for promotion and application.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to an InDel molecular marker located on chromosome 2 and related to the plant height regeneration ability of alfalfa after mowing, and an application thereof. Technical Background

[0002] Alfalfa (Medicago sativa L.) is the most important leguminous forage plant. It is known as the "king of forage grass" because of its high nutritional value, good palatability, rich crude protein, vitamins and minerals, and relatively complete amino acid composition. It has strong adaptability, fast growth, long life, and can be mowed frequently, and its position in modern agricultural and animal husbandry production is becoming more and more prominent. In the main forage producing areas in northern my country, alfalfa is generally harvested 2 to 4 times a year. Although regeneration depends on the biological characteristics of the forage itself, it is also restricted by the growth environment and management factors. The rapid growth of forage under certain mowing conditions has an important influence on the high yield performance of forage.

[0003] Genome-wide association studies (GWAS) have attracted much attention in the field of breeding. By analyzing the association between a large number of genetic markers and target traits, key genes or sites related to the traits can be identified. The research and development and application of this technology have become one of the important hot spots and competitive fields in the current breeding field. Molecular markers are important tools for plant genotyping, variety identification, genetic diversity analysis and assisted breeding. In addition to the widely used SSR (simple sequence repeats) and SNP (single nucleotide polymorphism) markers, InDel (insertion-deletion) has also attracted people's attention because of its rich content and co-dominant characteristics. The present invention uses 231 alfalfa materials to construct a population, resequences it, and develops an InDel site related to plant height regeneration ability in combination with the regenerated plant height trait. It is of great significance for constructing an assisted selection breeding system, improving germplasm resources, and breeding new varieties. Summary of the invention

[0004] One of the purposes of the present invention is to provide an InDel molecular marker related to the plant height regeneration ability of alfalfa after mowing.

[0005] The second object of the present invention is to provide the application of the above-mentioned InDel molecular marker related to the plant height regeneration ability of alfalfa after mowing.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The InDel molecular marker related to the regeneration ability of plant height after mowing disclosed by the invention is located on chromosome 2 of alfalfa, and the molecular marker is named Ms_Chr2_64484137.

[0008] A primer pair for amplifying an InDel molecular marker associated with the plant height regeneration ability of alfalfa, the primer pair sequence corresponding to the molecular marker Ms_Chr2_64484137 is:

[0009] Ms_Chr2_64484137-F:TCTGTGGAAATAATATTCTCGTGGT (shown in SEQ ID NO. 1);

[0010] Ms_Chr2_64484137-R: GGAATAGCAGTTGTTGACCATTGA (shown in SEQ ID NO. 2).

[0011] The present invention also discloses the use of the molecular marker primer pair in the assisted breeding of regenerated plant height after mowing of alfalfa. That is to say, the molecular marker of the present invention can be used in future molecular marker assisted breeding, by extracting DNA from leaves at the seedling stage, detecting whether the molecular marker of the present invention exists, and then identifying the regenerated plant height-related traits of the alfalfa material, thereby determining the strength of the alfalfa plant height regeneration ability. The detection can use the PCR detection method, specifically the molecular marker primer pair mentioned above, and the detection can also be performed by a sequencing method.

[0012] The present invention also discloses the use of the above molecular markers in identifying the regeneration plant height trait of alfalfa after mowing, especially in screening and identifying the regeneration ability of alfalfa plant height after mowing. Specifically, the specific steps for identifying the regeneration plant height trait of alfalfa after mowing are as follows:

[0013] (1) The DNA of the test germplasm was used as a template for PCR amplification, and the primer pair corresponding to the above molecular marker Ms_Chr2_64484137 was used for PCR amplification. The reaction system of PCR amplification is shown in Table 1:

[0014] Table 1 PCR amplification reaction system

[0015]

[0016] Pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 54.5°C for 24 s, extension at 72°C for 24 s, 40 cycles; extension at 72°C for 10 min; storage at 4°C.

[0017] (2) Agarose gel electrophoresis detection of PCR products: Take 4 μL and judge the results of alfalfa plant height traits based on the results of the bands.

[0018] PCR amplification was performed using primer pairs Ms_Chr2_64484137-F and Ms_Chr2_64484137-R. If the PCR amplification product had only one characteristic band with a length of 200 bp as shown in SEQ ID NO.4, the alfalfa was a dwarf type (weak plant height regeneration ability); if the PCR amplification product had only one characteristic band with a length of 175 bp as shown in SEQ ID NO.5, the alfalfa was a tall type (strong plant height regeneration ability); or if there was both a characteristic band with a length of 200 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 175 bp as shown in SEQ ID NO.5, the alfalfa was a semi-dwarf type (medium plant height regeneration ability).

[0019] In addition, the present invention also protects a kit for identifying the regeneration ability trait of alfalfa plant height, wherein the kit comprises primer pairs Ms_Chr2_64484137-F and Ms_Chr2_64484137-R. The other components of the kit are all conventional reagents. Specifically, 10×PCR Buffer, dNTP and Taq DNA polymerase are also included. The present invention has no special restrictions on the concentration of the primer pair, and the primer concentration well known in the art can be used. The present invention has no special restrictions on the sources of the 10×PCR Buffer, dNTP and Taq DNA polymerase, and ordinary PCR amplification reagents well known in the art can be used.

[0020] The kit of the present invention can be used to quickly identify the plant height regeneration ability of alfalfa after mowing, and can also quickly identify the plant height genotype of alfalfa after mowing. The specific method refers to the specific steps for identifying the plant height regeneration trait of alfalfa after mowing, and the PCR amplification product is subjected to electrophoresis detection and / or sequencing. If the PCR amplification product has only one characteristic band with a length of 200 bp as shown in SEQ ID NO.4, the alfalfa is a homozygous short stem (weak plant height regeneration ability) genotype; if the PCR amplification product has only one characteristic band with a length of 175 bp as shown in SEQ ID NO.5, the alfalfa is a homozygous tall stem (strong plant height regeneration ability) genotype; if the PCR amplification product has both a characteristic band with a length of 200 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 175 bp as shown in SEQ ID NO.5, the alfalfa is a heterozygous semi-dwarf (medium plant height regeneration ability) genotype.

[0021] The present invention has the following advantages:

[0022] (1) The inventors of the present invention screened out a molecular marker Ms_Chr2_64484137 related to the plant height regeneration ability of alfalfa after mowing. The molecular marker is located on chromosome 2. The molecular marker Ms_Chr2_64484137 of the present invention can be used to quickly and accurately identify the plant height regeneration ability of alfalfa after mowing.

[0023] (2) Screening with markers linked to the ability to regenerate plant height after mowing is beneficial to molecular marker-assisted selection breeding. The method is simple and feasible, and is beneficial to improving efficiency and saving costs.

[0024] (3) The molecular marker of the present invention has the characteristics of convenient detection, stable amplification product and high specificity, and can be simply, quickly and high-throughput applied to the breeding practice and material identification of the plant height regeneration ability of alfalfa after mowing. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The whole genome association analysis result of alfalfa regeneration plant height after mowing is a Manhattan diagram obtained by EMMAX software analysis. The red dots indicate the positions of the associated InDels of the present invention.

[0026] Figure 2 The box plot of the plant height distribution corresponding to the genotype of the Ms_Chr2_64484137 locus of the alfalfa population in Example 1 of the present invention. 0 / 0 means that the genotype of the Ms_Chr2_64484137 locus is a homozygous short stem (weak plant height regeneration ability) genotype, 0 / 1 means that the Ms_Chr2_64484137 locus is a heterozygous semi-dwarf stem (medium plant height regeneration ability) genotype; 1 / 1 means that the genotype of the Ms_Chr2_64484137 locus is a homozygous tall stem (strong plant height regeneration ability) genotype. The dots are extreme values ​​of the data, * represents p < 0.05, ** represents P < 0.01, and **** represents P < 0.0001.

[0027] Figure 3 This is the result of partial sequence alignment in the region associated with plant height regeneration ability between short-stem (weak plant height regeneration ability) materials and tall-stem (strong plant height regeneration ability) materials.

[0028] Figure 4 This is the electrophoresis diagram of the molecular marker amplified from 14 alfalfa germplasm resources at the Chr2_64484137 site. The concentration of the agarose gel is 3.5%.

[0029] In the figure, M represents DNA marker. DETAILED DESCRIPTION

[0030] The present invention will be further described below in conjunction with specific examples, and the advantages and features of the present invention will become clearer as the description proceeds. However, the specific experimental methods involved in the following examples are all conventional methods or implemented under the conditions recommended by the manufacturer's instructions unless otherwise specified.

[0031] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be purchased from the market.

[0032] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0033] Example 1 Development of molecular markers related to the ability of alfalfa to regenerate plant height after mowing

[0034] The present invention measures the plant height regeneration ability of alfalfa by the height of the regenerated plant when mowed in the early flowering period. The higher the value, the taller the alfalfa is (stronger plant height regeneration ability); the lower the value, the shorter the alfalfa is (weaker plant height regeneration ability). The regenerated plant height of the alfalfa population was measured two weeks after mowing. Through GWAS analysis, an InDel site was located in alfalfa ( Figure 1 Red site), named Ms_Chr2_64484137. This site is located at the 64484137th site on chromosome 2 of the alfalfa reference genome, of which the first allele type is 0 / 0; the second allele type is 0 / 1; and the third allele type is 1 / 1. The plant height distribution box plot corresponding to the genotype of the population Ms_Chr2_64484137 site ( Figure 2 ), indicating that the height of the regenerated plants of the alfalfa strain with genotype 0 / 1 after two weeks of mowing was significantly different from that of the alfalfa strain with genotype 0 / 0; the height of the regenerated plants of the alfalfa strain with genotype 1 / 1 after two weeks of mowing was very significantly different from that of the alfalfa strain with genotype 0 / 0; the height of the regenerated plants of the alfalfa strain with genotype 1 / 1 after two weeks of mowing was extremely significantly different from that of the alfalfa strain with genotype 0 / 1. At the 64484137th site on chromosome 2 of alfalfa, the insertion / deletion fragment AGTTCTTTAAAAAAAAGATTTACTG (shown in SEQ ID NO.3) ( Figure 3), which has an impact on the plant height regeneration ability of alfalfa two weeks after mowing. The alfalfa with the fragment shown in SEQ ID NO.3 inserted is a type of alfalfa with weak plant height regeneration ability two weeks after mowing; the alfalfa without the fragment shown in SEQ ID NO.3 is a type of alfalfa with strong plant height regeneration ability two weeks after mowing.

[0035] According to the InDel variant and its upstream and downstream sequences, the following primers were designed using NCBI (https: / / www.ncbi.nlm.nih.gov / ):

[0036] Ms_Chr2_64484137-F:TCTGTGGAAATAATATTCTCGTGGT (shown in SEQ ID NO. 1);

[0037] Ms_Chr2_64484137-R: GGAATAGCAGTTGTTGACCATTGA (shown in SEQ ID NO. 2).

[0038] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of the homozygous alfalfa sample with weak plant height regeneration ability two weeks after mowing had only a 200bp characteristic band, the PCR product of the heterozygous alfalfa sample with medium plant height regeneration ability two weeks after mowing had both a 200bp characteristic band and a 175bp characteristic band, and the PCR product of the homozygous alfalfa sample with strong plant height regeneration ability two weeks after mowing had only a 175bp characteristic band.

[0039] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention

[0040] 231 germplasms were identified, and the specific germplasm materials used are shown in Table 2:

[0041] Table 2 Plant height of 231 germplasm materials regenerated two weeks after mowing and the genotype corresponding to the Chr2_64484137 locus

[0042]

[0043]

[0044]

[0045]

[0046] 1) using the genomic DNA of alfalfa to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;

[0047] The reaction system of PCR amplification is as follows: template DNA 10-100ng, 10μM forward primer 1μL, 10μM reverse primer 1μL, 2×Taq PCR Master Mix 10μL, deionized water to 20μL; the reaction program of PCR amplification is preferably: 94℃ pre-denaturation for 4min; 94℃ denaturation for 30s, 54.5℃ annealing for 24s, 72℃ extension for 20s, 40 cycles; 72℃ extension for 10min; 4℃ storage. 3.5% agarose gel electrophoresis separation, after spotting, electrophoresis at 140V DC voltage for 80min, and then read the PCR band type of each sample.

[0048] 2) judging the plant height of the alfalfa after mowing according to the size of the PCR product: when the fragment shown in SEQ ID NO.3 is missing in the PCR product of the alfalfa to be identified, the alfalfa to be identified is a tall-stalked alfalfa (strong plant height regeneration ability);

[0049] When the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is a dwarf alfalfa (weak plant height regeneration ability) type;

[0050] Specifically, when the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the band length of the PCR product is 200 bp (SEQ ID NO.4), and the alfalfa to be identified is a dwarf alfalfa (weak plant height regeneration ability).

[0051] The sequence of SEQ ID NO.4 is as follows:

[0052]

[0053] When the fragment shown in SEQ ID NO.3 is missing from the PCR product of the alfalfa to be identified, the band length of the PCR product is 175 bp (SEQ ID NO.5), and the alfalfa to be identified is a tall-stalked (strong plant height and regeneration ability) type alfalfa.

[0054] The sequence of SEQ ID NO.5 is as follows:

[0055]

[0056] When the PCR product of the alfalfa to be identified is two bands, namely a band in which the fragment shown in SEQ ID NO.3 is inserted and a band in which the fragment shown in SEQ ID NO.3 is deleted, and one band of the PCR product is 200 bp in length and the other is 175 bp in length, then the alfalfa to be identified is a heterozygous semi-dwarf (medium plant height regeneration ability) type alfalfa.

[0057] Moreover, it can be seen from Table 2 that among the 231 alfalfa germplasms identified in this study, 5 alfalfa materials had a genotype of 0 / 0 at the Chr2_64484137 locus. After measurement, the average plant height of these 5 alfalfa materials was 25.21 cm, which was a dwarf alfalfa (weak plant height regeneration ability) type; 111 alfalfa materials had a genotype of 0 / 1 at the Chr2_64484137 locus. After measurement, the average plant height of these 111 alfalfa materials was 32.29 cm, which was a semi-dwarf alfalfa (medium plant height regeneration ability) type; 115 alfalfa materials had a genotype of 1 / 1 at the Chr2_64484137 locus. After measurement, the average plant height of these 5 alfalfa materials was 38.11 cm, which was a tall alfalfa (strong plant height regeneration ability) type. Variance analysis showed that there was a significant difference in plant height between dwarf alfalfa (weak plant height regeneration ability) and semi-dwarf alfalfa (medium plant height regeneration ability) (P < 0.05); there was a very significant difference in plant height between dwarf alfalfa (weak plant height regeneration ability) and tall alfalfa (strong plant height regeneration ability) (P < 0.01); there was an extremely significant difference in plant height between semi-dwarf alfalfa (medium plant height regeneration ability) and tall alfalfa (strong plant height regeneration ability) (P < 0.0001).

[0058] 14 germplasms ('CF040145', 'Gongnong 4', 'Algonquin', 'Jueneng 995', 'CF039747', 'Challenger', 'CF050248', 'Zhonglan 12', 'WL440HQ', 'Crown', 'Jueneng 601', 'Ranger', 'Knight 2', 'Huaiyang 4') were selected and PCR tests were performed on them. The test results were consistent with the genotype at the Chr264484137 locus and the actual plant height measurement results ( Figure 4 ), therefore, the InDel molecular marker of the present invention can effectively identify the plant height of alfalfa after mowing, and can be used for the prediction and screening of alfalfa materials with strong plant height regeneration ability after mowing.

[0059] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, other implementation methods can certainly be easily made by replacement or modification based on the technical contents disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. An InDel molecular marker located on chromosome 2 and associated with the plant height regeneration ability of alfalfa after mowing, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4 or SEQ ID NO.

5. The molecular marker is an insertion / deletion fragment AGTTCTTTAAAAAAAAGATTTACTG on chromosome 2 of the alfalfa reference genome. The primer pair sequence corresponding to the InDel molecular marker is: Ms_Chr2_64484137-F:TCTGTGGAAATAATATTCTCGTGGT; Ms_Chr2_64484137-R: GGAATAGCAGTTGTTGACCATTGA.

2. Use of the primer pair corresponding to the InDel molecular marker according to claim 1 in molecular marker-assisted breeding of alfalfa.

3. The use according to claim 2, characterized in that: The InDel molecular marker is used for identifying or assisting in identifying the regeneration ability of alfalfa plant height after mowing.

4. A method for identifying the plant height regeneration ability of alfalfa after mowing, characterized in that: The method comprises the following steps: (1) Extracting genomic DNA from alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determination is made based on the electrophoresis bands and / or sequencing results of step (2). The specific criteria are: PCR amplification was performed using primer pairs Ms_Chr2_64484137-F and Ms_Chr2_64484137-R. If the PCR amplification product had only one characteristic band with a length of 200 bp as shown in SEQ ID NO.4, the alfalfa was of a weak plant height regeneration ability type; if the PCR amplification product had only one characteristic band with a length of 175 bp as shown in SEQ ID NO.5, the alfalfa was of a strong plant height regeneration ability type; if there was both a characteristic band with a length of 200 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 175 bp as shown in SEQ ID NO.5, the alfalfa was of a medium plant height regeneration ability type.

5. A kit for use in identifying the genotype of plant height regeneration ability of alfalfa after mowing, characterized in that: The kit comprises the primer pair described in claim 1.

6. The use according to claim 5, characterized in that: The method for identifying the genotype of plant height regeneration ability of alfalfa after mowing using the kit is as follows: (1) Extracting genomic DNA from alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) The PCR amplification products were subjected to electrophoresis detection and / or sequencing. If the PCR amplification product had only one characteristic band with a length of 200 bp as shown in SEQ ID NO.4, then the alfalfa was a homozygous genotype with weak plant height regeneration ability; if the PCR amplification product had only one characteristic band with a length of 175 bp as shown in SEQ ID NO.5, then the alfalfa was a homozygous genotype with strong plant height regeneration ability; if the PCR amplification product had both one characteristic band with a length of 200 bp as shown in SEQ ID NO.4 and one characteristic band with a length of 175 bp as shown in SEQ ID NO.5, then the alfalfa was a heterozygous genotype with medium plant height regeneration ability.

Images