Anti-pcrv monoclonal antibodies and encoding nucleic acids and uses thereof

Abstract

The application discloses anti-PcrV monoclonal antibodies and coding nucleic acids and applications thereof. The anti-PcrV monoclonal antibody comprises a heavy chain and a light chain; the heavy chain comprises a heavy chain variable region, and the light chain comprises a light chain variable region; the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 1, the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 2, or the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 3, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 4. Experimental results show that the anti-PcrV monoclonal antibody can effectively prevent and treat pseudomonas aeruginosa infection, and the protection rate is between 12.5% and 75% for different pseudomonas aeruginosa strains. Further, the application also designs nucleic acid antibodies corresponding to the anti-PcrV monoclonal antibody, and the nucleic acid antibodies have better protection effects compared with the anti-PcrV monoclonal antibody, and the protection rate is between 50% and 75% for different pseudomonas aeruginosa strains.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biomedical technology, in particular to anti-PcrV monoclonal antibody and its encoding nucleic acid and application. BACKGROUND

[0002] Pseudomonas aeruginosa (PA) is a gram-negative non-fermenting and aerobic opportunistic pathogen, which is phenotypically diverse and widely exists in nature and human living environment, and often infects patients with impaired immune defense mechanism, such as cystic fibrosis (CF), sepsis and tumor patients. Pseudomonas aeruginosa is usually not pathogenic, but under certain conditions, it can cause chronic inflammation of secondary infection or mixed infection, and is one of the important pathogenic bacteria of nosocomial infection, and is also one of the pathogenic bacteria with the highest incidence rate in ICU ward, burn, war trauma, etc. PA infection can occur in any tissue and site of human body, and can also cause endocarditis, pneumonia and even sepsis and other systemic infections, and the mortality rate of systemic infection is more than 20%.

[0003] At present, due to the abuse of antibiotics and other reasons, the drug resistance problem of PA is increasingly serious, and pan-drug-resistant Pseudomonas aeruginosa (PDR-PA) and multi-drug-resistant Pseudomonas aeruginosa (MDR-PA) have appeared, and the isolation rate of drug-resistant PA increases year by year. Therefore, it is urgent to find new "non-antibiotic therapy", and developing a safe and effective vaccine is an important strategy. Since the 1960s, at least 60 kinds of vaccines against Pseudomonas aeruginosa have been developed, and the vaccine targets include lipopolysaccharide (LPS), extracellular polysaccharide (EPS), flagellum, outer membrane protein (OMP), bacterial toxin, outer membrane vesicle (OMV), etc. According to different technical routes, they can be divided into component vaccine, subunit vaccine, attenuated live vaccine, whole bacterium inactivated vaccine, and carrier vaccine. So far, four vaccines have entered phase III clinical trials, which are seven-valent lipopolysaccharide vaccine developed by Pfizer, two-valent flagellum vaccine of type A and type B developed by IMMUNO, eight-valent lipopolysaccharide-endotoxin A combined vaccine developed by Swiss Serum and Vaccine Institute, and vaccine IC43 developed by Valneva Austria GmbH, which uses Pseudomonas aeruginosa outer membrane protein OprF190-342 and OprI21-83 fusion protein as antigen, but the four vaccines have all failed, and currently no Pseudomonas aeruginosa vaccine has been approved for marketing.

[0004] Monoclonal antibodies (mAbs) as passive immunotherapy, directly target bacterial surface antigens or secreted toxins, rather than antibiotic targets, whose efficacy is unlikely to be affected by current resistance mechanisms. Furthermore, antibodies specifically kill specific classes of pathogens, which can minimize the emergence of resistance and maintain the stability of the organism microbiome. In addition, mAbs have a long half-life, can simultaneously exert prophylactic and therapeutic effects, all of which suggest that they are well suited for the prevention and treatment of antibiotic-resistant bacterial infections.

[0005] The syringe-like type III secretion system (T3SS) is a key virulence factor of P. aeruginosa that is associated with persistence and mortality of the bacteria in patients. P. aeruginosa V antigen (PcrV) is a key component of the T3SS, located at the needle tip of the T3SS, is essential for assembly of the PopB / PopD transport complex and delivery of effector toxins (ExoS, ExoT, ExoU, and ExoY) into the host cell cytoplasm, leading to host cell lysis and tissue damage. PcrV is a highly conserved protein with 98% homology between different isolates. As PcrV has a critical contribution to pathogenesis and location on the cell membrane, it is an important candidate target for vaccine and antibody development. Several recent studies have explored antibody-mediated PcrV functional ablation to suppress PA virulence. Studies have shown that PcrV antibodies have potent antibody-dependent complement-mediated and opsonophagocytic killing of P. aeruginosa and protect infected animals from acute lung injury, bacteremia, and sepsis in various infection models. In the ongoing battle against P. aeruginosa infection, a series of anti-PcrV mAbs have been developed and subjected to clinical trials. KB001-A is an anti-PcrV pegylated Fab'2 fragment that showed potent activity in a mouse lung infection model, reducing mortality and effectively clearing bacteria from infected lungs. MEDI3902 (gremubamab) is a bispecific human IgGl monoclonal antibody that targets the PcrV protein and Psl exopolysaccharide. It showed synergistic protective activity in a range of animal infection models compared to individual mAbs or a mixture of parental mAbs. Despite these advances, unfortunately, neither of these two mAbs reached the intended endpoint in their clinical phase 2 trials, and there has been a lack of substantial, lasting progress in the treatment of PA infection. This highlights the ongoing challenges in developing effective therapies against this pathogen.

[0006] Monoclonal antibodies (mAbs) are typically produced in Chinese hamster ovary (CHO) and other mammalian cells. However, the manufacture of recombinant antibodies requires expensive production costs, complex protein characterization, and stringent storage conditions, which largely limit the application of mAbs in clinical therapy. In vivo delivery of nucleic acid-encoded mAbs is a clever approach that can circumvent many limitations of traditional antibody biologics. Compared with viral vectors or DNA delivery, mRNA delivery has lower risk of host genome integration and earlier onset of action, making it distinct from the three types of in vivo mAb delivery. To date, a series of LNP (lipid nanoparticle)-encapsulated mRNAs encoding various mAbs have been developed and achieved encouraging results in preclinical studies for combating viral diseases, including human immunodeficiency virus (HIV), influenza virus, and chikungunya virus (CHIKV). Recently, Moderna completed a phase I clinical trial of mRNA antibodies against CHIKV23 (NCT03829384). However, to our knowledge, there is no report on mRNA antibodies against bacterial infections, which is limited to DNA mAb studies.

[0007] Therefore, the prior art still needs to be improved and developed. SUMMARY

[0008] In view of the deficiencies of the prior art described above, the purpose of the present application is to provide anti-PcrV monoclonal antibodies and encoding nucleic acids and applications thereof, aiming to solve the problem that there is currently no effective Pseudomonas aeruginosa vaccine.

[0009] The technical solutions of the present application are as follows:

[0010] In a first aspect of the present application, anti-PcrV monoclonal antibodies or antigen-binding fragments thereof are provided, which comprise a heavy chain and a light chain.

[0011] The heavy chain comprises a heavy chain variable region, and the light chain comprises a light chain variable region.

[0012] The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO. 1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO. 2; or, the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO. 3, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO. 4.

[0013] Preferably, the heavy chain further comprises a heavy chain constant region, and the light chain further comprises a light chain constant region.

[0014] The amino acid sequence of the heavy chain constant region is shown as SEQ ID NO. 5, and the amino acid sequence of the light chain constant region is shown as SEQ ID NO. 6.

[0015] In a second aspect of the present application, a nucleic acid is provided, wherein the nucleic acid comprises a nucleotide sequence encoding the anti-PcrV monoclonal antibody or the antigen binding fragment thereof as described above.

[0016] Preferably, the nucleic acid is mRNA, and the mRNA comprises a heavy chain mRNA and a light chain mRNA.

[0017] The heavy chain mRNA comprises, in order from 5' to 3', the following elements:

[0018] a 5' cap structure, a KOZAK sequence, a 5' non-coding region, a first ORF open reading frame, a 3' non-coding region, and a poly A sequence.

[0019] The first ORF open reading frame comprises, in order from 5' to 3', a nucleotide sequence of a first signal peptide, a nucleotide sequence encoding the heavy chain of the anti-PcrV monoclonal antibody or the antigen binding fragment thereof as described above, and a nucleotide sequence of a His tag.

[0020] The light chain mRNA comprises, in order from 5' to 3', the following elements:

[0021] a 5' cap structure, a KOZAK sequence, a 5' non-coding region, a second ORF open reading frame, a 3' non-coding region, and a poly A sequence.

[0022] The second ORF open reading frame comprises, in order from 5' to 3', a nucleotide sequence of a second signal peptide, a nucleotide sequence encoding the light chain of the anti-PcrV monoclonal antibody or the antigen binding fragment thereof as described above, and a nucleotide sequence of a His tag.

[0023] The uracil in the mRNA is replaced by N1-methyl pseudouridine.

[0024] Preferably, the 5' cap structure is m7GpppN; and / or the KOZAK sequence is CCGCCGCCACC.

[0025] Preferably, the nucleotide sequence of the 5' non-coding region is shown as SEQ ID NO. 7; and / or the nucleotide sequence of the 3' non-coding region is shown as SEQ ID NO. 8.

[0026] Preferably, the length of the poly A sequence is 80-150.

[0027] Preferably, the amino acid sequence encoded by the first ORF open reading frame is as shown in SEQ ID NO. 9, and the amino acid sequence encoded by the second ORF open reading frame is as shown in SEQ ID NO. 10; or, the amino acid sequence encoded by the first ORF open reading frame is as shown in SEQ ID NO. 11, and the amino acid sequence encoded by the second ORF open reading frame is as shown in SEQ ID NO. 12.

[0028] In a third aspect of the present application, a nucleic acid antibody is provided, comprising: a lipid nanoparticle and a nucleic acid as claimed in any one of claims 3-8 loaded in the lipid nanoparticle.

[0029] In a fourth aspect of the present application, use of the anti-PcrV monoclonal antibody or antigen binding fragment thereof as described above, or the nucleic acid as described above, or the nucleic acid antibody as described above in the preparation of a drug for preventing and treating P. aeruginosa infection is provided.

[0030] Beneficial effects: Two new anti-PcrV monoclonal antibodies M4C12 and M2C10 are screened in the present application: the amino acid sequence of the heavy chain variable region of M4C12 is as shown in SEQ ID NO. 1, and the amino acid sequence of the light chain variable region is as shown in SEQ ID NO. 2; the amino acid sequence of the heavy chain variable region of M2C10 is as shown in SEQ ID NO. 3, and the amino acid sequence of the light chain variable region is as shown in SEQ ID NO. 4. Experimental results show that the anti-PcrV monoclonal antibody of the present application can effectively prevent and treat P. aeruginosa infection in sepsis model mice after administration at 0.75 mg / kg, and the protection rate is between 12.5% and 75% against different P. aeruginosa strains. Further, the nucleic acid antibody encoding the above anti-PcrV monoclonal antibody is also designed in the present application, and compared with the anti-PcrV monoclonal antibody, the corresponding nucleic acid antibody has a better protection effect after administration at 0.375 mg / kg, and the protection rate is between 50% and 75% against sepsis model mice caused by infection of different P. aeruginosa strains. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1 is a schematic diagram of the constituent elements of the mRNA prepared in Example 4 of the present application.

[0032] Figure 2 is a molecular structure diagram of the ionizable cationic lipid, cholesterol, neutral helper lipid, and polyethylene glycol modified phospholipid in Example 5 of the present application.

[0033] Figure 3 is a particle size diagram of the mRNA-LNP prepared in Example 6 of the present application.

[0034] Figure 4 is a standard curve graph between mRNA concentration and fluorescence intensity in Example 7 of the present application.

[0035] Figure 5 is a WB result graph of mRNA expressed in different cells in Example 9 of the present application.

[0036] Figure 6 is a WB result graph of protein sample prepared in Example 10 of the present application.

[0037] Figure 7 is a result graph of in vitro functional activity of monoclonal antibodies M4C12 and M2C10 in Example 11 of the present application.

[0038] Figure 8 is a result graph of functional determination of nucleic acid antibodies M4C12-mRNA and M2C10-mRNA in Example 12 of the present application.

[0039] Figure 9 is a result graph of protective effect of monoclonal antibodies and nucleic acid antibodies on mice in Example 13 of the present application.

[0040] Figure 10 is a result graph of protective effect of monoclonal antibodies and nucleic acid antibodies on organs of mice in Example 14 of the present application. DETAILED DESCRIPTION

[0041] The present application provides an anti-PcrV monoclonal antibody, a coding nucleic acid thereof and an application. In order to make the purpose, technical scheme and effect of the present application more clear and explicit, the present application is further illustrated by specific examples.

[0042] Example 1: Memory B cell sorting

[0043] The CPG adjuvant and the antigen (CDS-Pcrv) were mixed at a volume ratio of 1:1 with physiological saline. The prepared antigen was used to intraperitoneally inject Balb / c mice, and the mice were boosted at the specified time nodes according to the immunization scheme. After the final immunization, a small amount of tail blood was collected, and the serum titer was determined by indirect ELISA. A titer greater than 1:100K was considered to meet the serum titer requirement. The mouse spleen was removed, and the surrounding connective tissue was peeled off. The spleen was placed on a cell filter screen and gently crushed with a syringe needle core to obtain a cell suspension. Ficoll-Paque PLUS cell separation medium and the cell suspension were added to a test tube at a volume ratio of 1:2. After centrifugation at 1500 rpm for 15 minutes, the single nucleus cell layer was generally in the middle of the test tube. The single nucleus cell layer was aspirated, and SOL024 solution was added. After centrifugation at 1500 rpm for 10 minutes, the supernatant was removed, and 500 μL of SOL024 solution was added to resuspend the cells. The memory B cells (MBC) can specifically bind to the antigen protein through the B cell receptor (BCR) on the surface of the memory B cells. The MBCs that specifically bind to the antigen protein can be sorted out one by one from the cell suspension by flow cytometry. The antigen-specific MBCs were amplified by RT-PCR, and the single-chain variable fragment (scFv) was constructed. The scFv was expressed in a high-throughput manner to obtain the cell supernatant of the monoclonal antibody. The cell supernatant was detected by indirect ELISA. The variable region of the heavy chain and the light chain of the selected positive clone was sequenced. The amplified heavy chain and light chain Fab base sequences of the two pairs of paired antibodies (M4C12 and M2C10) were respectively connected to the pcDNA3.4 vector containing the human IgG1 Fc fragment to construct light and heavy chain recombinant expression plasmids, which were named pcDNA3.4-M4C12-H, pcDNA3.4-M4C12-L, pcDNA3.4-M2C10-H, and pcDNA3.4-M2C10-L, respectively. The light and heavy chain expression vectors were transfected into 293 cells to express and purify two monoclonal antibodies, which were named M4 (or M4C12) and M2 (or M2C10), respectively.

[0044] In this embodiment, the amino acid sequence of the heavy chain variable region of M4 is shown in SEQ ID NO. 1, the amino acid sequence of the light chain variable region of M4 is shown in SEQ ID NO. 2, the amino acid sequence of the heavy chain variable region of M2 is shown in SEQ ID NO. 3, and the amino acid sequence of the light chain variable region of M2 is shown in SEQ ID NO. 4. The amino acid sequence of the heavy chain constant region of M4 and M2 is shown in SEQ ID NO. 5, and the amino acid sequence of the light chain constant region of M4 and M2 is shown in SEQ ID NO. 6.

[0045] Example 2: Construction of Template Gene

[0046] The heavy chain and light chain sequences verified in pcDNA3.4 vector in Example 1 were cloned into pVAX1 vector respectively, and a secretion signal peptide and a 6*His tag were added at the N- and C-termini of the sequences, the codons were optimized without changing the amino acid sequences, and the sequences were used as ORF open reading frame sequences of mRNA (SEQ ID NO. 9-12). A 5'UTR (SEQ ID NO. 7) and a KOZAK sequence (CCGCCGCCACC) were added at the 5' end of the ORF, and a 3'UTR (SEQ ID NO. 8) and a 120-length polyadenyl (PolyA) sequence were added at the 3' end.

[0047] In this example, four recombinant plasmids were finally obtained, including pVAX1-M4-H containing M4 heavy chain sequence, pVAX1-M4-L containing M4 light chain sequence, pVAX1-M2-H containing M2 heavy chain sequence, and pVAX1-M2-L containing M2 light chain sequence.

[0048] Example 3: Plasmid template amplification and linearization

[0049] The four recombinant plasmids pVAX1-M4-H, pVAX1-M4-L, pVAX1-M2-H, and pVAX1-M2-L obtained in Example 2 were transformed into DH5a competent cells respectively, spread on solid LB plates containing Kan+ resistance, and incubated at 37°C for 12 h. Single colonies were picked and added to liquid LB medium containing Kan+ resistance, and incubated at 37°C, 250 rpm / min for 12 h. The cells were collected by centrifugation, and the amplified plasmids were extracted using a commercial plasmid extraction kit. The linearization enzyme cleavage site of the amplified plasmids was selected as XhoI adjacent to the PolyA tail, and the linearization degree was detected by DNA agarose gel electrophoresis. The linearized plasmid DNA was recovered by a PCR product recovery kit, and the DNA concentration and quality were determined by measuring the values of OD260 and OD260 / OD280 of NanoDrop ultramicro nucleic acid instrument.

[0050] Example 4: In vitro transcription and purification of mRNA

[0051] In vitro RNA synthesis (IVT) uses DNA (linearized plasmid or PCR product) containing the T7 promoter (TAATACGACTCACTATAGGG) or SP6 promoter (ATTTAGGTGACACTATAG) sequence as template DNA. Under the action of T7 or SP6 RNA polymerase, mRNA complementary to one strand of the template DNA is synthesized using NTPs as substrates. The stability of the mRNA is enhanced by adding a cap structure at the 5' end and a polyA tail at the 3' end. In this example, DNA containing the T7 promoter sequence is used as template DNA; the template DNA is the linearized plasmid DNA from Example 3; and N1-methylpseudouridine completely replaces uridine in the NTPs.

[0052] Capping of mRNA can be achieved through co-transcriptional capping or post-transcriptional capping, while tailing can be achieved through template transcription tailing or post-transcriptional enzymatic tailing. In this embodiment, co-transcriptional capping is used for mRNA capping, and template transcription tailing is used for tailing. For example... Figure 1 As shown, the 5' cap structure is m7GpppN. In co-transcriptional capping, cap analogs are added directly to IVT, and they are directly incorporated into the 5' end by an RNA polymerase with relaxation substrate specificity to produce the corresponding 5'-capped mRNA. Since cap analogs lack free 5'-triphosphate, internal incorporation of cap analogs does not occur during IVT. In this example, Trilinker's... Reagent AG (3'OMe) is a cap structure, and transcription begins at 5'AG 3' in the action of T7 polymerase.

[0053] In this embodiment, four mRNAs were finally obtained: mRNA-M4-H encoding the M4 heavy chain (SEQ ID NO.13), mRNA-M4-H encoding the M4 light chain (SEQ ID NO.14), mRNA-M2-H encoding the M2 heavy chain (SEQ ID NO.15), and mRNA-M2-H encoding the M2 light chain (SEQ ID NO.16).

[0054] Example 5: mRNA-LNP preparation

[0055] The four mRNAs obtained in Example 4 were each loaded on lipid nanoparticles to form nucleic acid antibodies. The mRNA-loaded lipid nanoparticles comprise four components, ionizable cationic lipids, neutral helper lipids, cholesterol, and PEGylated lipids. The preparation process of the specific LNP is as follows: ionizable cationic lipids (DLin-MC3-DMA, SM-102), cholesterol (Cholesterol), neutral helper lipids (DSPC), and PEGylated lipids (mPEG2000-DMG) were dissolved in anhydrous ethanol at a ratio of 50:38.5:10:1.5, with a total concentration of 10 mg / mL, to form an organic phase; the mRNA encoding the antigen protein was dissolved in a sodium citrate buffer (50 mM, pH = 4) at a total concentration of 0.1 mg / mL to form an aqueous phase; the organic phase and the aqueous phase were mixed at a ratio of 1:3 at a speed of 12 mL / min using a microfluidic device to obtain an LNP-mRNA mixture; the LNP-mRNA mixture was diluted 40 times with sterile PBS (10 mM, pH = 7.2) and transferred to a pre-sterilized Ultra-15 centrifugal filter (cut-off = 100 KDa). To achieve buffer exchange and product concentration, centrifugation was performed at 4000 x g for 30 minutes, and repeated three times after adding fresh PBS, and the mRNA-LNP was concentrated to a concentration of 2 mg / mL. The final product was stored at 4°C until use.

[0056] Example 6: Determination of the particle size and uniformity of mRNA-LNP

[0057] The particle size and uniformity of the mRNA-LNP prepared in Example 5 were determined using a dynamic light scattering instrument (DLS). The specific operation is as follows: the concentrated sample was diluted again in sterile PBS at a ratio of 1:100, and the HORIBA-SZ100 device was used at a scattering angle of 25° and 90°, repeated three times, to obtain the particle size distribution and PDI value (Polymer dispersity index) of the mRNA-LNP. The particle size result is given as the ratio of particle size to intensity. The DLS test results are shown in Figure 3 It can be seen from Figure 3 that the average particle size of the mRNA-LNP is about 100 nm, which is appropriate.

[0058] Example 7: Determination of the encapsulation efficiency of mRNA-LNP

[0059] The encapsulation efficiency of mRNA in the mRNA-LNP prepared in Example 5 was determined using Quant-iT TM RiboGreenTM RNA kit assay, the principle of the assay is: Quant-iT TM RNA reagent is a super-sensitive fluorescent nucleic acid stain that can detect 1-200 ng of nucleic acid in solution. This nucleic acid dye cannot penetrate LNP, so only free nucleic acid that is not encapsulated by LNP can be bound. Triton-100 is often used as a demulsifier as a surfactant. The use of 1% Triton-100 to treat the obtained LNP-mRNA can release the encapsulated nucleic acid, and the total nucleic acid amount is obtained. The drug loading amount is obtained by calculating the difference in nucleic acid amount before and after demulsification, and then divided by the total nucleic acid amount to obtain the encapsulation efficiency, that is:

[0060] Encapsulation efficiency (%) = (post-demulsification quantification - pre-demulsification quantification) / post-demulsification quantification

[0061] The specific operation method is as follows: prepare mRNA standard solutions with different concentrations (i.e. 1000, 500, 250, 125, 62.5, 31.25, 15.625 and 0 ng / mL) in TE (Tris-EDTA) buffer. The mRNA to be tested is dissolved in TE buffer to prepare a sample of about 250 ng / mL mRNA. Similar samples are also prepared in TE buffer supplemented with Triton-X100 surfactant (0.5%). 100 μL of each sample (including standard solution and mRNA LNP sample) is added to the microwells of a 96-well plate. Then, 100 μL of 1:200 diluted Ribogreen reagent is added. After incubation in the dark and at room temperature for 5 minutes, the fluorescence intensity is recorded using Cytation 3 (Biotek, Winooski, VT, USA), and excitation and emission are applied at 485 and 528 nm, respectively. The fluorescence obtained from the mRNA-LNP samples dispersed in TE and TE / Triton-X100 is theoretically attributed to free (unencapsulated) and total mRNA, respectively. However, even without Triton-X100, the Ribogreen reagent can slightly penetrate the LNP. Therefore, the fluorescence obtained from the filtered sample dispersed in TE is subtracted from the fluorescence emitted by a similar unfiltered sample in TE. The standard curve plotted using the standard solution is used to convert the fluorescence intensity to concentration, and finally, the encapsulation efficiency is calculated according to the formula. As Figure 4 The standard curve shown in Figure 8 shows a linear relationship between mRNA concentration and fluorescence intensity (R2=0.9993). The encapsulation efficiency was calculated using the standard curve, and an encapsulation efficiency of about 95% was obtained.

[0062] Example 8: Transfection of nucleic acid antibody cells

[0063] The mRNA-LNP encoding M4 heavy chain and the mRNA-LNP encoding M4 light chain prepared in Example 4 were mixed at a molar ratio of 1:1 to form a nucleic acid antibody encoding M4, named M4-mRNA (or M4C12-mRNA). The mRNA-LNP encoding M2 heavy chain and the mRNA-LNP encoding M2 light chain prepared in Example 4 were mixed at a molar ratio of 1:1 to form a nucleic acid antibody encoding M2, named M2-mRNA (or M2C10-mRNA).

[0064] The transfection method was to directly add M4-mRNA or M2-mRNA into 293T cells and macrophage J774A.1 grown to about 70%, respectively, wherein the total concentration of mRNA was about 0.5 μg / cm 2 , and the transfection time was 48 h.

[0065] Example 9: WB identification of mRNA cell expression

[0066] Whether the target protein in the cell culture supernatant and cell lysate obtained by transfecting M4-mRNA and M2-mRNA in Example 8 was expressed as expected was identified by WB. The cell culture supernatant and cell lysate were added with 6x loading buffer and then subjected to polyacrylamide gel electrophoresis in a boiling water bath for 5 min; gel electrophoresis was performed to transfer the protein to PVDF; 1% BSA was used for room temperature blocking for 60 min, and PBST was used for washing 3 times; anti-His-HRP antibody was used for room temperature incubation for 2 h, and TBST was used for washing 3 times, followed by color development using an enhanced chemiluminescence kit (ECL) and scanning and photographing, and the results are shown in Figure 5 .

[0067] Example 10: Monoclonal antibody expression and purification

[0068] The starting culture of HEK293F suspension cells 100 mL was grown in a 250 mL conical cell culture flask, and then inoculated into a 1 L culture flask with an inoculation volume of 300 mL and a cell density of 0.5x10 6 cells / mL. Incubation was performed in a shaking incubator at 37°C, 120 rpm and 5% CO2 for 24 hours until the cells reached 1.0x10 6Example 10: Preparation of monoclonal antibody Figure 6

[0069] Example 11: In vitro functional assay of monoclonal antibody

[0070] To determine the efficacy of monoclonal antibody against P. aeruginosa, the antibody function was determined by in vitro experiment in this example. The main contents are as follows: 1. The monoclonal antibodies M4 (M4C12) and M2 (M2C10) have strong binding force with the antigen PcrV, which is determined by BLI biological membrane interference experiment. The specific results are shown in A and B of Figure 7 2. The 0.5 μg / mL monoclonal antibody can bind to bacteria, which is determined by Elisa method. The specific results are shown in Figure 7 ​As shown in Figure C. 3. Monoclonal antibodies M4 and M2 were added to cultured macrophages, followed by bacterial infection at a multiplicity of infection (MOU) of 10. After incubation for 2 hours, the supernatant was diluted and plated for counting. The phagocytic opsonization and damaging effects of M4 and M2 were statistically analyzed. Specific results are shown in Figure C. Figure 7 As shown in D, by Figure 7 From D, it can be seen that M4 and M2 have the best lethality against PAO1, reaching 70%, followed by PA16 with at least 60% lethality, and finally PA117 with only about 40% lethality. 4. [The last sentence appears to be incomplete and possibly contains errors. It's unclear what the intended meaning is.] 6 A mixture of CFU / mL *Pseudomonas aeruginosa* PAO1 & EGFP, 30 μg / mL monoclonal antibody, and 30% v / v guinea pig serum was prepared to a final volume of 100 μL and added to a 96-well plate. The plate was then incubated for 24 hours. The bacterial biofilm adhered to the inner wall of the plate. 25 μL of 1% (w / v) crystal violet solution was added to each well. After staining for 15 minutes at room temperature, the dye solution was removed, and the wells were washed three times with distilled water and allowed to dry. 200 μL of 95% ethanol was added to dissolve the crystal violet adhering to the inner wall of the 96-well plate. 125 μL of the solution was transferred from each well to a new 96-well plate, and the absorbance and plexus activity at 600 nm were measured. The results are shown below. Figure 7 As shown in E and G, by Figure 7 As shown in E and G, M4 and M2 can significantly inhibit biofilm formation and bacterial plexus activity. 5. Because PcrV is the control switch for the type III secretion system of Pseudomonas aeruginosa, to verify whether the anti-PcrV monoclonal antibody of this invention can inhibit toxin secretion and affect cell viability, an A549 cytotoxicity experiment was conducted in this embodiment. The results are as follows: Figure 7 As shown in F, by Figure 7 As shown in Figure F, M4 and M2 provide excellent protection. 6. The complement lethality test results for M4 and M2 are as follows: Figure 7 As shown in H and I, by Figure 8 As can be seen from H and I, M4 and M2 can significantly kill bacteria under complement conditions.

[0071] Example 12: Nucleic Acid Antibody Function Assay

[0072] This embodiment performs functional assays on the overexpressed M4-mRNA and M2-mRNA verified in Examples 8 and 9, mainly including the following: 1. The specific concentrations of M4-mRNA and M2-mRNA in 293T cells were detected, and the specific results are as follows: Figure 8 As shown in A and B, by Figure 8As shown in A and B, the antibody concentration in the cell supernatant reached a maximum of 1.5 μg / mL after 48 hours, while the antibody concentration in the cell lysate was 5.8–8 μg / mL. 2. M4-mRNA and M2-mRNA were added to cultured macrophages, followed by bacterial infection at a multiplicity of infection (MOU) of 10. After 2 hours of incubation, the supernatant was diluted, plated, and the phagocytic opsonization and damaging effects of the antibodies were statistically analyzed. Specific results are shown below. Figure 8 As shown in C, by Figure 8 As shown in Figure C, the antibody showed the best killing effect against PAO1, reaching 80%, followed by PA16 with at least 60% killing rate, and finally PA117 with only about 30-40% killing rate. 3. This example detected changes in exotoxins ETA and ExoU in macrophages J774A.1, because M4 and M2 antibodies can block exotoxin secretion by binding to the PcrV protein on Pseudomonas aeruginosa. The detection results are as follows... Figure 8 As shown in D and E. From Figure 8 According to D, the exotoxin ETA concentration in the blank control LNP group was approximately 35 ng / L, the exotoxin ETA concentration in the protein antibody M4 and M2 groups was 15–18 ng / L, and the exotoxin ETA concentration in the nucleic acid encoding antibody M4-mRNA and M2-mRNA groups was approximately 5 ng / L; Figure 8 As shown in Figure E, the exotoxin ExoU concentration in the blank control LNP group was approximately 10 ng / L, the exotoxin ExoU concentration in the protein antibody M4 and M2 groups was approximately 5 ng / L, and the exotoxin ExoU concentration in the nucleic acid-encoding antibody M4-mRNA and M2-mRNA groups was approximately 5 ng / L. 4. For subsequent animal experiments, in this example, M4-mRNA conjugated with CY5 was injected into mice for organ imaging. Specific results are as follows... Figure 9 As shown in F, by Figure 9 As can be seen from F, M4-mRNA can reach all organs except the heart, mainly accumulating in the liver, which may be beneficial for bacterial clearance.

[0073] Example 13: Protective effect of monoclonal antibodies and nucleic acid antibodies on mice

[0074] In this embodiment, the protective effect of the vaccine is evaluated through a challenge experiment with Pseudomonas aeruginosa. The specific implementation method is as follows:

[0075] Mice (Balb / c) were injected intravenously via the tail vein with LNP, M4-mRNA, M2-mRNA, M4, M2, and M4+M2 (M4 to M2 in a 1:1 weight ratio). The dosage of LNP / M4-mRNA / M2-mRNA was 0.375 mg / kg, and the dosage of M4 / M2 / M4+M2 was 0.75 mg / kg. Two hours after the injection, lethal doses of Pseudomonas aeruginosa strains PAO1, PA16, and PA117 were injected intravenously via the tail vein. The wounds and mortality of the mice were observed and recorded. The specific procedures are as follows: Figure 9 As shown in Figure A, the specific results are as follows: Figure 9 As shown in B, C, and D. (By...) Figure 9 As shown in Figure B, after challenge with the PAO1 strain, all mice in the LNP group (blank immunized control group) died. The protection rates of M4, M2, and M4+M2 were 50%–75%, with the protection rates of M4-mRNA and M2-mRNA reaching as high as 75%. Figure 9 As shown in Figure C, after challenge with the PA117 strain, all mice in the LNP group (blank immunized control group) died. The protection rates of M4, M2, and M4+M2 ranged from 12.5% ​​to 50%, while the protection rates of M4-mRNA and M2-mRNA were 50%. Figure 9 According to the results from the study, after challenge with the PA16 strain, only 20% of the mice in the LNP group (the blank immunized control group) survived. The protection rates of M4, M2, and M4+M2 were 50-75%, and the protection rates of M4-mRNA and M2-mRNA were 75%.

[0076] For mice euthanized within 48 hours, the organs were dissected and the bacterial load was measured. The results are as follows: Figure 9 As shown in E, F, G, H, I, J, and K. (By...) Figure 9 According to E, F, G, H, I, J, and K, the number of bacteria in organs can be significantly reduced under the action of M4-mRNA, M2-mRNA, M4, M2, and M4+M2. The comparison shows that M4-mRNA and M2-mRNA are more effective. It was also found that the bacteria in the blood are mainly taken up by the liver.

[0077] Furthermore, this embodiment detected the level of exotoxins in the blood, and the results are as follows: Figure 10 As shown in L and M. From Figure 10 As shown in the data, the exotoxin ETA in the treatment group decreased from 35 ng / L to 10–18 ng / L; ​ The results showed that the exotoxin ExoU level in the treatment group was reduced from 150 ng / L to about 50-80 ng / L, which significantly reduced the exotoxin content and thus protected the mice.

[0078] Example 14: Protective effects of monoclonal antibodies and nucleic acid antibodies on mouse organs

[0079] From Example 13, it can be seen that P. aeruginosa is distributed in various organs. In order to observe the protective effect of antibodies and nucleic acid antibodies on the organs of mice, the organs of the mice were dissected and fixed with 4% paraformaldehyde, and then HE section staining was performed, and the specific results are shown in ​ ​ It can be seen that, compared with the normal group, the lung of the LNP group showed obvious pathological changes such as inflammatory substance invasion, bleeding, and disappearance of most complete alveolar structure, and other tissues had no obvious lesions; the M4 and M2 antibody groups could improve this condition, and the M4-mRNA and M2-mRNA groups better protected the lung than the antibody groups, and the lung inflammation and other lesions were the lightest.

[0080] It should be understood that the above examples are only used to illustrate the technical solutions of the present application, but not to limit them; for those skilled in the art, the above description can be improved or changed, and all these improvements and changes should belong to the protection scope of the appended claims of the present application.​

Claims

1. An anti-PcrV monoclonal antibody or antigen-binding fragment thereof, characterized in that, The anti-PcrV monoclonal antibody antigen binding fragment comprises a heavy chain and a light chain; The heavy chain comprises a heavy chain variable region, and the light chain comprises a light chain variable region; The amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 1, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 2; or, the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 3, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO.

4.

2. The anti-PcrV monoclonal antibody or antigen-binding fragment thereof according to claim 1, characterized in that, The heavy chain further comprises a heavy chain constant region, and the light chain further comprises a light chain constant region; The amino acid sequence of the heavy chain constant region is shown as SEQ ID NO. 5, and the amino acid sequence of the light chain constant region is shown as SEQ ID NO.

6.

3. A nucleic acid, characterized in that, The nucleic acid comprises a nucleotide sequence encoding the anti-PcrV monoclonal antibody or the antigen binding fragment thereof according to any one of claims 1-2.

4. The nucleic acid of claim 3, wherein, The nucleic acid is mRNA, and the mRNA comprises a heavy chain mRNA and a light chain mRNA; The heavy chain mRNA comprises, in order from 5' to 3', the following elements: a 5' cap structure, a KOZAK sequence, a 5' non-coding region, a first ORF open reading frame, a 3' non-coding region, and a poly A sequence; The first ORF open reading frame comprises, in order from 5' to 3', a nucleotide sequence of a first signal peptide, a nucleotide sequence encoding the heavy chain of the anti-PcrV monoclonal antibody or the antigen binding fragment thereof according to any one of claims 1-2, and a nucleotide sequence of a His tag; The light chain mRNA comprises, in order from 5' to 3', the following elements: a 5' cap structure, a KOZAK sequence, a 5' non-coding region, a second ORF open reading frame, a 3' non-coding region, and a poly A sequence; The second ORF open reading frame comprises, in order from 5' to 3', a nucleotide sequence of a second signal peptide, a nucleotide sequence encoding the light chain of the anti-PcrV monoclonal antibody or the antigen binding fragment thereof according to any one of claims 1-2, and a nucleotide sequence of a His tag; The uracil in the mRNA is replaced by N1-methyl pseudouridine.

5. The nucleic acid of claim 4, wherein The 5' cap structure is m7GpppN; and / or, the KOZAK sequence is CCGCCGCCACC.

6. The nucleic acid of claim 4, wherein The nucleotide sequence of the 5' non-coding region is shown as SEQ ID NO. 7; and / or, the nucleotide sequence of the 3' non-coding region is shown as SEQ ID NO.

8.

7. The nucleic acid of claim 4, wherein The length of the poly A sequence is 80-150.

8. The nucleic acid of claim 4, wherein The amino acid sequence encoded by the first ORF open reading frame is shown as SEQ ID NO. 9, and the amino acid sequence encoded by the second ORF open reading frame is shown as SEQ ID NO. 10; or, the amino acid sequence encoded by the first ORF open reading frame is shown as SEQ ID NO. 11, and the amino acid sequence encoded by the second ORF open reading frame is shown as SEQ ID NO.

12.

9. A nucleic acid antibody characterized in that, The nucleic acid antibody comprises: a lipid nanoparticle and the nucleic acid as claimed in any one of claims 3 to 8 loaded in the lipid nanoparticle.

10. Use of the anti-PcrV monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 2, or the nucleic acid according to any one of claims 3 to 8, or the nucleic acid antibody according to claim 9 in the preparation of a medicament for the prevention and treatment of Pseudomonas aeruginosa infection.

Images