Burkholderia cepacia S8183 and its application

Abstract

The invention discloses a Burkholderia cepacia S8183 and its application. The Burkholderia cepacia S8183 has a deposit number of GDMCC NO: 64863. The Burkholderia cepacia S8183 can effectively inhibit the mycelial growth of 17 pathogenic fungi, including stem base rot pathogens or wilt pathogens of 6 plants, anthracnose pathogens on 4 plants, 2 alternariae and black spore mold, crescent spore, acid scab Streptomyces, citrus spores, and fusarium oxysporum; the fermentation liquid of S8183 can effectively inhibit the mycelial growth and spore production and germination of passion fruit and polygonatum stem base rot pathogens, and has a good disease prevention effect on 3 passion fruit stem base rot pathogens, and has a significant growth-promoting effect on the growth of rice and passion fruit seedlings, and has potential commercial development and application value in the practice of biological control of diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of plant disease and insect pest control, and specifically relates to a Burkholderia cepacia S8183 and an application thereof. Background Art

[0002] Plant root rot and stem base rot are currently one of the major soil-borne diseases in the fruit tree production process. Once the disease spreads, it will cause a devastating blow to the plants. Among them, fruit tree root rot and stem base rot often manifest as browning and rotting of the roots and stem bases of fruit trees, some of which are covered with white mold layers, eventually causing the entire plant to wilt and die; the pathogens currently reported include Fusarium oxysorum, F. solani, Pythium, Neofusicoccum parvum and Botryosphaeria dothidea. These pathogens often infect plants one or several together, causing root rot and stem base rot. The same pathogen from different plants also has differences in pathogenicity and host range. Since most fruit trees are perennial plants and there is a lack of disease-resistant varieties and effective chemical fungicides, once root rot and stem base rot occur, one or several plants may die at the very least, and there may be a risk of destroying the orchard at worst.

[0003] Plant anthracnose is an airborne disease caused by infection by the fungus Colletotrichum spp. It has a wide host range and can harm plants during both the growing period and the late fruit harvesting period. During the growing period, it mainly harms different parts of the plant, such as flowers, leaves, fruits, and stems. When anthracnose harms leaves, it usually invades from the tip or edge of the leaf in the early stage, and then gradually expands into yellow-brown cloud-like lesions, mostly in a "V" shape, which can cause a large number of leaves to fall in severe cases. When anthracnose harms branches and tips, it often occurs at the top of the branches, initially as light brown oval lesions, and eventually the entire top of the branch dies. When anthracnose harms fruits, it initially appears as small white spots, and when the environment is suitable, the lesions gradually expand to the entire fruit. Currently known pathogens include C. gloeosporioides, C. acutatum, C. karstii, C. fructicola, and C. siamense.

[0004] Leaf spot can occur in almost all plants throughout their growth period, including brown spot, black spot, angular spot and stripe, etc. It can be caused by fungi, bacteria, viruses, etc., affecting plant photosynthesis, resulting in reduced yields, greatly affecting plant yields and economic value. Common leaf spot diseases on fruit trees are mainly caused by Colletotrichum spp., Alternaria Nees, Streptomyces sp., Curvularia sp., etc. The same genus of fungi causes different symptoms on different hosts, and often a single fungus or a combination of several fungi occurs on plants.

[0005] Pitaya canker is one of the major diseases in pitaya production. Its pathogens include Neoscytalidium dimidiatum and Fusarium oxysorum. Fusarium oxysorum is a newly identified pathogen of pitaya canker in recent years. This pathogen mainly harms the fleshy stems, flowers and fruits of pitaya, and is prone to occur in patches. It likes warm and rainy weather. High temperatures in summer can inhibit the occurrence and spread of this pathogen. At present, chemical fungicides are mainly used to prevent and control pitaya canker. However, due to the complexity of the pathogen and the emergence of drug resistance, chemical fungicides have little effect on the prevention and control of the disease, and new prevention and control methods continue to be sought.

[0006] Burkholderia cenocepacia is a group of complexes with similar phenotypes but different genotypes, also known as the Burkholderia cepacia complex (Bcc). It is a Gram-negative bacterium that is widely found in water, plants and soil. It inhibits pathogens by producing a variety of secondary metabolites with antibacterial activity, such as nitropyrrole, phenazine, phenylpyrrole, Cepaciamide A and Cepacidine A, pyrrolonitrosine, catechol and ergotamine. So far, it has been reported that this group of bacteria has a broad-spectrum antibacterial effect on a variety of plant diseases, such as strawberry gray mold, peach brown rot, sweet cherry brown rot, red stem rot, tomato wilt, cucumber wilt, banana wilt, etc., but there are few reports on other plant diseases and growth promotion. Summary of the invention

[0007] The object of the present invention is to provide a Burkholderia cepacia S8183 strain and its application in preventing and controlling plant diseases and / or promoting plant growth in view of the deficiencies in the prior art.

[0008] The first object of the present invention is to provide a Burkholderia cepacia S8183, with a deposit number of GDMCC NO: 64863.

[0009] The second object of the present invention is to provide the use of the above-mentioned Burkholderia cepacia S8183 in plant disease prevention and control and / or plant growth promotion.

[0010] Preferably, the plant disease is plant stem rot, wilt, plant anthracnose and / or plant leaf spot.

[0011] Preferably, the pathogen of the plant stem base rot is passion fruit stem base rot, polygonatum stem base rot or pitaya canker; the pathogen of the wilt is banana wilt or guava wilt; the pathogen of the plant anthracnose is Colletotrichum; the pathogen of the plant leaf spot is Alternaria, Nigrospora, Streptomyces, Fusarium, Curvularia or Diaporthe.

[0012] Preferably, the pathogen of plant anthracnose is citrus anthracnose, Sanhua plum anthracnose, litchi anthracnose or perilla anthracnose, and the pitaya ulcer pathogen is Fusarium oxysorum; the citrus anthracnose pathogen is C. fructicola or C. gloeosporioides, the Sanhua plum anthracnose pathogen is C. fructicola, the litchi anthracnose pathogen is C. gloeosporioides, and the perilla anthracnose pathogen is C. fructicola.

[0013] Preferably, the Alternaria fungus is Alternaria alternata or Alternaria tenuissima; the Curvularia fungus is Curvularialunata; the Streptomyces fungus is Streptomyces acidiscabies; and the Diaporthe fungus is Diaporthe citri.

[0014] Preferably, the promoting plant growth is promoting the increase of plant height and fresh weight.

[0015] Preferably, the plant is rice or passion fruit.

[0016] The third object of the present invention is to provide an agent containing the above-mentioned Burkholderia cepacia S8183 as an active ingredient.

[0017] Preferably, the agent is a biocontrol agent or a plant growth regulator, and the Burkholderia cepacia S8183 is live bacteria, broken bacteria, fermentation liquid, fermentation supernatant or metabolites of Burkholderia cepacia S8183.

[0018] Beneficial effects of the present invention:

[0019] The newly discovered cepacia Burkholderia cepacia of the present invention has a prevention and control efficiency of more than 80% for stem base rot of passion fruit, polygonatum, etc.; at the same time, in terms of promoting the growth of rice plants, the fresh weight is increased by nearly 200%.

[0020] The onion Burkholderia S8183 provided by the present invention has a wider antibacterial spectrum, and can effectively inhibit the mycelial growth of 17 pathogenic fungi, including stem base rot or wilt pathogens of 6 plants, anthracnose fungi on 4 plants, 2 kinds of Alternaria and Glomerella, Crescent Curvularia, Acidic Scab Streptomyces, Citrus Intersepta, and Fusarium oxysporum; the fermentation liquid of S8183 can effectively inhibit the growth of mycelium and the production and germination of spores of passion fruit and Polygonatum stem base rot pathogens; the fermentation liquid of S8183 has a good disease prevention effect on 3 kinds of passion fruit stem base rot pathogens, and has a significant growth-promoting effect on the growth of rice and passion fruit seedlings. The above functions are not reported in the prior art. Since the strain S8183 is isolated from the plant rhizosphere soil and has a growth-promoting effect on plants, it can be considered to use S8183 to prevent and control soil-borne diseases. This strain can avoid the potential adverse effects of chemical pesticides on the environment and crop safety, and has potential commercial development and application value in the practice of biological control of diseases.

[0021] Burkholderia cepacia S8183 was deposited in the Guangdong Microbiological Culture Collection Center (GDMCC) on July 11, 2024. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province, Postal Code 510070, the deposit number is GDMCC No: 64863, and the classification name is: Burkholderia cepacia. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Schematic diagram of the morphology of strain S8183 on different culture media (26°C, 7d).

[0023] Figure 2 This is the phylogenetic tree of strain S8183 (based on 16S rDNA sequence).

[0024] Figure 3 Schematic diagram of the confrontation culture of strain S8183 with pitaya, passion fruit, banana and polygonatum stem base rot or wilt.

[0025] Figure 4 Schematic diagram of confrontation culture of strain S8183 with fungi of genera such as Colletotrichum, Alternaria, Nigrosporium, Streptomyces, Fusarium, Curvularia and Metaspora, among which Streptomyces spp. is Streptomycesacidiscabies; Diaporthesp. is Diaporthe citri.

[0026] Figure 5 This is a schematic diagram of the control effect of the fermentation liquid of strain S8183 on passion fruit and Polygonatum cyrtonema stem rot.

[0027] Figure 6 Schematic diagram of the growth-promoting effect of the fermentation liquid of strain S8183 on rice seedlings.

[0028] Figure 7 This is a schematic diagram of the effects of the fermentation liquid of strain S8183 on promoting growth and preventing stem base rot of passion fruit at the seedling stage. DETAILED DESCRIPTION

[0029] In order to better explain the present invention, the principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention. The technical solutions involved in the embodiments of the present invention, if not otherwise specified, are all conventional solutions in the field; the reagents or materials, if not otherwise specified, are all derived from commercial channels.

[0030] Example 1: Isolation, identification and biological characteristics analysis of Burkholderia cepacia S8183

[0031] 1. Isolation of strain S8183

[0032] The applicant collected orchard rhizosphere soil from Maoming City, Guangdong Province, prepared a soil suspension with sterile water, and evenly coated the soil suspension on the surface of a PDA culture medium plate using a gradient dilution separation method. After the moisture on the surface of the plate was dried, it was cultured at 26°C, and a single colony was picked every day for confrontation culture with the passion fruit stem base rot pathogen. After primary screening and rescreening, a Holderella strain with a significant inhibitory effect on the passion fruit stem base rot pathogen was obtained, named S8183.

[0033] 2. Morphological characteristics of strain S8183

[0034] Strain S8183 can grow on NA (peptone 10.0 g / L, beef powder 3.0 g / L, sodium chloride 5.0 g / L, agar 10 g / L), LB (tryptone 10.0 g / L, yeast extract 5.0 g / L, sodium chloride 5.0 g / L, agar 10 g / L), TSA (tryptone 15.0 g / L, soytone 5.0 g / L, sodium chloride 5.0 g / L, agar 10 g / L), PDA (potato dextrose agar powder 39 g / L) medium at 26°C. Its colonies are round, yellow, raised, glossy, smooth, with neat edges and a faint rubber smell ( Figure 1 ).

[0035] 3. Identification of the taxonomic attributes of strain S8183

[0036] The strain S8183 was inoculated into 100 mL PDB (potato glucose powder 24 g / L) liquid medium, cultured overnight at 180 rpm in a 26°C shaker, centrifuged at 10000 rpm / 7 min to collect the bacteria, ground in liquid nitrogen, and the genomic DNA of the strain S8183 was extracted using a conventional DNA extraction kit. The genomic DNA of the strain S8183 was used as a template, and PCR amplification and sequencing were performed using bacterial 16S rDNA universal primers 27F (SEQ ID NO.1, 5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (SEQ ID NO.2, 5'-GGTTACCTTGTTACGACTT-3'). The 16S rDNA sequencing results (SEQ ID NO.3) of the strain S8183 were compared with BLASTn on NCBI to obtain the sequence information of closely related species, and the 16S rDNA sequences of closely related species and related model strains were downloaded to construct a phylogenetic tree. The strain S8183 was identified as Burkholderia cepacia S8183 ( Figure 2 ).

[0037] Burkholderia cepacia S8183 was deposited in the Guangdong Microbiological Culture Collection Center (GDMCC) on July 11, 2024. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province, Postal Code 510070, the deposit number is GDMCC No: 64863, and the classification name is: Burkholderia cepacia S8183.

[0038] In the present invention, Burkholderia cepacia S8183 is abbreviated as S8183.

[0039] Example 2: Cultivation and fermentation of Burkholderia cepacia S8183

[0040] 1. Cultivation of strain S8183

[0041] Use an inoculation loop to scrape an appropriate amount of bacteria from the surface of the colony of strain S8183, streak on the surface of the PDA medium, and then culture overnight at 26°C ( Figure 1 ).

[0042] 2. Preparation of fermentation broth of strain S8183

[0043] Use an inoculation loop to scrape an appropriate amount of bacteria from the colony surface of strain S8183, inoculate it into PDB liquid culture medium, and then culture it overnight at 26°C and 180rpm as seed solution.

[0044] 1 mL of seed solution was drawn with a sterile 1 mL pipette tip and inoculated into a 250 mL sterile Erlenmeyer flask containing 100 mL of PDB liquid culture medium. After culturing at 26°C and 180 rpm for 3 days, the fermentation broth was filtered through a single layer of sterile gauze and the filtrate was collected to obtain the fermentation broth of strain S8183.

[0045] Example 3: Antagonistic effect of Burkholderia cepacia S8183 against plant stem rot pathogens / wilt pathogens

[0046] In this experiment, passion fruit stem rot pathogens (Fursarium oxysporum, F.solani, Phytophthoranicotianae), Polygonatum oxysporum (F.solani), banana wilt pathogens (F.oxysporum), and pitaya canker pathogens (F.oxysporum) were selected for confrontation culture with S8183 to determine the antibacterial activity of S8183 against plant stem rot pathogens / fusarium oxysporum ( Figure 3 ).

[0047] Passion fruit stem rot pathogen, Polygonatum wilt pathogen, banana wilt pathogen, and pitaya canker pathogen were inoculated on PDA culture medium plates respectively. After culturing at 26°C for 5 days, a mycelium block with a diameter of 5 mm was taken from the edge of the colony and inoculated on a new PDA culture medium plate 2 cm away from the edge. Scrape the S8183 bacteria with an inoculation loop and spread it at a distance of 4.5 cm from the pathogen. The treatment without S8183 inoculation was used as the control. Each treatment was repeated 5 times. After culturing the plate at 26°C for 5 days, the width of the inhibition zone was measured and the inhibition rate was calculated. Inhibition rate (%) = (4.5-width of the inhibition zone of the treatment group) / 4.5×100.

[0048] The results are as follows Figure 3As shown in the results, strain S8183 has a strong antibacterial effect on the tested stem base rot pathogens / wilt pathogens. The inhibition rates of three passion fruit stem base rot pathogens are F.oxysorum 66.67%, F.solani 44.44%, and Phytophthora nicotianae 40%, respectively; the inhibition rates of pitaya rot disease are 48.89%, banana wilt pathogens are 33.33%, and Polygonatum cyrtonema stem base rot pathogens are 37.78%. There is no significant difference in the inhibitory effect between 5 days and 13 days of culture. Therefore, strain S8183 has a long inhibitory effect on plant stem base rot pathogens / wilt pathogens and has good biocontrol potential.

[0049] Example 4: Inhibitory effect of Burkholderia cepacia S8183 fermentation broth on the mycelial growth of passion fruit and Polygonatum cyrtonema stem rot pathogens

[0050] 1. Preparation of sterile fermentation broth plates of strain S8183

[0051] To 90 mL of melted PDA medium (cooled to below 40° C.), add 1000 μL, 500 μL, 250 μL and 100 μL of sterile fermentation broth of strain S8183 (preparation method is the same as step 2 in Example 2), respectively, add sterile PDA medium to make up to 100 mL, mix well and pour into plates, 25 mL of medium per dish, prepare fermentation broth plates with dilution concentrations of 1000 times, 500 times, 250 times and 100 times, respectively, and add 1000 μL PDB medium to the control group.

[0052] 2. Inhibitory effect of aseptic fermentation broth of strain S8183 on the mycelial growth of passion fruit and Polygonatum cyrtonema stem rot pathogens

[0053] Mycelium blocks with a diameter of 5 mm were taken from the edges of the colonies of passion fruit stem base rot pathogen, polygonatum stem base rot pathogen, banana wilt pathogen and pitaya stem rot pathogen that were freshly cultured for 5 days and inoculated into the center of the sterile fermentation liquid plates with different concentrations in the above step 1, and cultured at 26°C. Each treatment was repeated 5 times. The above bacterial stacks were inoculated into blank PDA culture medium as a control group. Starting from the 3rd day of culture, the colony diameter was observed and measured every day until the 5th day, and the mycelium growth inhibition rate of the sterile fermentation liquid of strain S8183 on the above measured pathogens was calculated. Mycelium growth inhibition rate (%) = (control group colony diameter - treatment group colony diameter) / control group colony diameter × 100.

[0054] The results are as follows Figure 5As shown in the figure, the aseptic fermentation liquid of strain S8183 has a strong inhibitory effect on the mycelial growth of passion fruit stem base rot pathogen, polygonatum stem base rot pathogen, banana wilt pathogen and pitaya stem rot pathogen, and the inhibitory effect increases with the increase of the concentration of aseptic fermentation liquid. After 5 days of treatment, the 1000-fold diluted aseptic fermentation liquid has the highest inhibition rate on the mycelial growth of the three pathogens causing passion fruit stem base rot, which are 87.18% (F.oxysporum), 94% (F.solani), and 94.12% (P.nicotianae); the inhibition rate of the other four pathogens is above 70%. It can be seen that the aseptic fermentation liquid of strain S8183 also has a long antibacterial time effect on passion fruit, polygonatum, pitaya and banana stem base rot pathogen / wilt pathogen. The morphology of mycelium and spores of passion fruit stem rot and Polygonatum cyrtonema stem rot growing on plates containing different concentrations of S8183 was observed under a microscope. It can be seen that S8183 inhibits the growth of pathogenic bacteria by inhibiting the normal growth of pathogenic mycelium and the production of spores ( Figure 5 ).

[0055] Example 5: Antagonistic effect of Burkholderia cepacia S8183 on important Colletotrichum fungi on citrus, litchi, plum and perilla

[0056] The present invention uses a confrontation culture method to determine the antibacterial activity of strain S8183 against Colletotrichum fungi that cause anthracnose on citrus, litchi, Sanhua plum, and perilla. The tested fungi are C. fructicola from citrus, Sanhua plum, and perilla, and C. gloeosporioides from litchi ( Figure 4 ).

[0057] Take a 5mm diameter mycelium block from the edge of the above-mentioned Colletotrichum fungus colony that has been freshly cultured for 5 days and inoculate it on a new PDA medium plate 2cm away from the edge. Use an inoculation loop to scrape the S8183 bacteria and apply it at a distance of 4.5cm from the pathogen. The treatment without S8183 inoculation is used as a control. Each treatment is repeated 5 times. After the plate is cultured at 26°C for 5 days, the width of the inhibition zone is measured and the inhibition rate is calculated. Inhibition rate (%) = (4.5-width of the inhibition zone of the treatment group) / 4.5×100.

[0058] The results are as follows Figure 4As shown, strain S8183 has a strong antibacterial effect on all the tested Colletotrichum fungi. Strain S8183 has the strongest antibacterial effect on the anthracnose pathogen of Sanhua plum, C. fructicola, which is 88.89%, and the weakest antibacterial effect on the litchi anthracnose pathogen, C. gloeosporioides, which is 53.33%. It can be seen that strain S8183 has a good potential for preventing and controlling plant anthracnose.

[0059] Example 6: Antagonistic effect of Burkholderia cepacia S8183 on seven important plant pathogenic fungi

[0060] In this experiment, the antifungal activity of strain S8183 against seven pathogenic fungi causing plant diseases was determined by the confrontation culture method. These pathogenic fungi include two species of Alternaria (A. alternata and A. tenuissima) that cause plant leaf spot, Nigrospora, Streptomyces, Fusarium, Curvularia and Diaporthe. The determination method is the same as that in Example 5.

[0061] The results are as follows Figure 4 As shown in the figure, strain S8183 has a strong antibacterial effect on the seven plant pathogenic fungi tested, among which the highest inhibition rate is 93.33% against Neofusicoccumparvum, the pathogen of guava fruit rot, and the lowest inhibition rate is 53.33% and 48.89% against Alternaria alternata and Alternaria tenuissima, the pathogens that cause citrus leaf spot. It can be seen that strain S8183 has a wide antibacterial spectrum and has good development and application value in the practice of biological control of plant diseases.

[0062] Example 7: Growth-promoting effect of fermentation broth of Burkholderia cepacia S8183 on rice and passion fruit seedlings

[0063] This experiment used OD 600 =2.0 of S8183 fermentation liquid was used to root-irrigate rice (2-leaf stage) and passion fruit seedlings (6-leaf stage) to determine the growth-promoting effect of S8183 fermentation liquid on rice and passion fruit.

[0064] Preparation of inoculum: prepare concentrations of OD 600 = 2.0 of strain S8183 and 2×10 6spores / mL passion fruit stem rot (F.oxysorum:F.solani:Phytophthora nicotianae=1:1:1) conidia suspension was used as the mother solution, and the strain S8183 bacterial solution and the passion fruit stem rot bacterial mother solution were mixed in equal volumes to prepare the treatment group inoculation solution. The final concentration of the strain S8183 bacterial solution in the inoculation solution was OD 600 =1.0 and the final concentration of passion fruit stem rot pathogen was 1×10 6 The mother solution of passion fruit stem rot pathogen was mixed with equal volumes of distilled water to a final concentration of 1×10 6 The positive control group inoculation solution of passion fruit stem rot pathogen with spores / mL was used. Sterile distilled water was used as negative control. All treatments were prepared and used immediately.

[0065] Inoculation: Plant rice and passion fruit seedlings in seedling cups in a light incubator. Select seedlings with consistent growth and inoculate the inoculum of the treatment group and the control group into the root soil of the seedlings, 35 mL per plant. Twelve rice and nine passion fruit seedlings were inoculated in each treatment; another 12 rice and nine passion fruit seedlings were watered with distilled water as the control group.

[0066] Investigation: After 15 days of routine management, the plant height, root length and fresh weight of each rice plant were measured; and the plant height of passion fruit was measured and photographed at 12, 20, 27 and 35 days (Tables 1 and 2).

[0067] The results are as follows Figure 6-7 As shown in Tables 1 and 2, the fermented liquid of strain S8183 can significantly promote the growth of rice and passion fruit seedlings. Compared with the control, the fermented liquid of S8183 can significantly increase the plant height of rice and passion fruit seedlings, especially the effect of the fermented liquid of strain S8183 on the fresh weight of rice seedlings is about 200%. It can be seen that strain S8183 also has the potential to be developed into a plant growth regulator or microbial fertilizer.

[0068] Table 1 The growth promotion effect of S8183 on rice plants

[0069]

[0070] Table 2 The growth promotion results of S8183 on passion fruit plants

[0071]

[0072]

[0073] Example 8: Disease prevention effect of Burkholderia cepacia S8183 on passion fruit stem rot

[0074] In this experiment, the live root inoculation method was used in the passion fruit seedling stage to determine the disease prevention effect of the fermentation liquid of strain S8183 on passion fruit stem base rot.

[0075] Preparation of inoculum: prepare concentrations of OD 600 = 2.0 of strain S8183 and 2×10 6 spores / mL passion fruit stem rot (F.oxysorum:F.solani:Phytophthora nicotianae=1:1:1) conidia suspension was used as the mother solution, and the strain S8183 bacterial solution and the passion fruit stem rot bacterial mother solution were mixed in equal volumes to prepare the treatment group inoculation solution. The final concentration of the strain S8183 bacterial solution in the inoculation solution was OD 600 =1.0 and the final concentration of passion fruit stem rot pathogen was 1×10 6 The mother solution of passion fruit stem rot pathogen was mixed with equal volumes of distilled water to a final concentration of 1×10 6 The positive control group inoculation solution of passion fruit stem rot pathogen with spores / mL was used. Sterile distilled water was used as negative control. All treatments were prepared and used immediately.

[0076] Inoculation: passion fruit seedlings were planted in a seedling cup with a diameter of 8 cm in the greenhouse. Passion fruit seedlings at the 6-leaf stage with consistent growth were selected, and the inoculation solution of the treatment group and the control group was inoculated into the root soil of the seedlings, 35 mL per plant, 3 passion fruit seedlings were inoculated in each treatment, and each treatment was repeated 3 times.

[0077] Disease investigation: After inoculation, the disease condition of the plants was followed up and observed. The disease grade of each plant was investigated at 12, 20, 27 and 35 days after inoculation, and the disease index and disease prevention effect were calculated. Disease prevention effect (%) = (disease index of positive control group - disease index of treatment group) / disease index of positive control group × 100.

[0078] The results are as follows Figure 7 As shown in Figure 2, the bacterial solution of strain S8183 has a good disease prevention effect on passion fruit stem rot. Compared with the positive control inoculated with passion fruit stem rot alone, OD 600 =2.0, the leaves of passion fruit plants were greener, the growth was better, the symptoms of stem base rot were lighter, and the disease index was significantly reduced. The disease prevention effect of S8183 spore solution was the best at 20 and 27 days after inoculation, which were 79% and 75% respectively; although the control effect showed a decreasing trend with the extension of time, the disease prevention effect of S8183 was still 56% at 35 days after inoculation. It can be seen that the disease prevention time of strain S8183 against passion fruit stem base rot is also longer.

[0079] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit the present invention.

[0080] Anyone familiar with the technology can modify or change the above embodiments without violating the spirit and scope of the present invention. Therefore, all equivalent modifications or changes made by those with ordinary knowledge in the relevant technical field without departing from the spirit and technical ideas disclosed by the present invention should still be covered by the claims of the present invention.

[0081] SEQ ID NO.1

[0082] AGAGTTTGATCCTGGCTCAG

[0083] SEQ ID NO.2

[0084] GGTTACCTTGTTACGACTT

[0085] SEQ ID NO.3 (16S rDNA sequence of strain S8183)

[0086]

Claims

1. A strain of Burkholderia cepacia ( Burkholderia cepacia )S8183, the deposit number is GDMCC NO:64863.

2. The use of Burkholderia cepacia S8183 according to claim 1 in plant disease prevention and control and / or plant growth promotion, wherein the plant diseases are plant stem base rot, wilt, plant anthracnose and / or plant leaf spot, the pathogen of the plant stem base rot is passion fruit stem base rot, polygonatum stem base rot or pitaya canker; the pathogen of the wilt is banana wilt or guava wilt; the pathogen of the plant anthracnose is a fungus of the genus Colletotrichum; the pathogen of the plant leaf spot is a fungus of the genus Alternaria Alternaria Fungi, Nigrospora Nigrospora , Streptomyces Streptomyces Fusarium Fusarium Curvularia Curvularia Metaschisome Diaporthe The pathogen of plant anthracnose is citrus anthracnose, Sanhua plum anthracnose, litchi anthracnose or perilla anthracnose, and the dragon fruit ulcer pathogen is Fusarium oxysporum Fusarium oxysorum The citrus anthracnose pathogen is Colletotrichum spp. Colletotrichum fructicola Colletotrichum gloeosporioides Colletotrichum gloeosporioides The anthracnose pathogen of Sanhua plum is Colletotrichum oleraceus Colletotrichum fructicola, The litchi anthracnose pathogen is Colletotrichum gloeosporioides Colletotrichum gloeosporioides The perilla anthracnose pathogen is Colletotrichum gloeosporioides Colletotrichum fructicola , the genus Alternaria Alternaria Alternaria alternata Alternaria alternata Alternaria tenuissima Alternaria tenuissima ; The Curvularia spp. Curvularia Curvularia lunata Curvularia lunata ; The Streptomyces genus Streptomyces Streptomyces acidocrustatus Streptomyces acidiscabies The interseat shell belongs to Diaporthe Aspergillus citrinum Diaporthe citri , The promoting of plant growth is promoting the growth of plant height and fresh weight of rice or passion fruit plants.

3. A reagent, characterized in that The invention contains the Burkholderia cepacia S8183 according to claim 1 as an active ingredient.

4. The reagent according to claim 3, characterized in that The reagent is a biocontrol agent or a plant growth regulator, and the Burkholderia cepacia S8183 is live bacterial cells, broken bacterial cells or fermented liquid of Burkholderia cepacia S8183.

Images