A salt-tolerant α-amylase mutant and its application

Abstract

The present invention discloses a salt-resistant alpha-amylase mutant and its application, the mutant is obtained by directed evolution of wild-type alpha-amylase, including glutamate at position 47 mutated to phenylalanine, or glutamate at position 202 mutated to phenylalanine, or glutamate at position 248 mutated to phenylalanine, or aspartic acid at position 352 mutated to valine, or glutamate at position 248 mutated to phenylalanine and aspartic acid at position 352 mutated to valine. The alpha-amylase mutant provided by the present invention has higher salt tolerance, and its enzyme activity in high concentrations of sodium ions, magnesium ions and calcium ion solutions is higher than that of the original enzyme; the present invention also provides a preparation method and application of the mutant, provides an alpha-amylase mutant or its encoding gene or corresponding vector or corresponding recombinant cell comprising higher salt tolerance, optimizes the application of alpha-amylase in high salt concentration environments.

Description

Technical Field

[0001] The present invention relates to a site-directed mutagenesis and heterologous expression technology of an α-amylase gene, in particular to an α-amylase mutant with improved tolerance to high-concentration salt, its gene, expression strain and preparation method, and belongs to the field of genetic engineering. Background Art

[0002] Starch is a polysaccharide found widely in nature. It is the most common form of energy storage in many plants, plays important physiological and nutritional roles in plants, and is also a major food source for humans. Starch molecules are composed of thousands of glucose monomers linked by α-1,4- and α-1,6-glycosidic bonds. α-Amylases cleave α-1,4-glycosidic bonds within starch molecules, producing smaller carbohydrate units such as glucose and maltose. Several bacterial α-amylases, including Bacillus amyloliquefaciens, Bacillus licheniformis, and Thermomyces lipophilus, have been used on a large scale in industrial applications. However, the catalytic activity of α-amylases is limited by environmental conditions such as temperature, pH, and metal salts. Existing α-amylases are not salt-tolerant enough for applications in the presence of high concentrations of metal salts such as calcium chloride, magnesium chloride, and sodium bicarbonate. Summary of the Invention

[0003] Purpose of the invention: The purpose of the present invention is to provide an α-amylase mutant with improved salt tolerance and its application.

[0004] Technical solution: The first aspect of the present invention provides a salt-tolerant α-amylase mutant, the amino acid sequence of the α-amylase mutant being obtained by mutation of the sequence shown in SEQ ID NO: 1, wherein the mutation includes: mutation of glutamic acid at position 47 to phenylalanine, or mutation of glutamic acid at position 202 to phenylalanine, or mutation of glutamic acid at position 248 to phenylalanine, or mutation of aspartic acid at position 352 to valine, or mutation of glutamic acid at position 248 to phenylalanine and mutation of aspartic acid at position 352 to valine.

[0005] The present invention uses α-amylase derived from Geobacillus stearothermophilus as the starting enzyme. Through 3D modeling of the α-amylase, mutation sites are identified. Acidic amino acids on the protein's surface are mutated into hydrophobic, non-polar amino acids using point mutagenesis. The mutant gene is then introduced into a host bacterium and expressed in the mutant enzyme. Through screening, five salt-tolerant α-amylase mutants were obtained, each exhibiting high enzymatic activity in high-concentration salt solutions (NaHCO3, MgCl2, NaCl, or CaCl2).

[0006] The second aspect of the present invention provides a nucleic acid molecule encoding the α-amylase mutant as described in the first aspect, wherein the nucleotide sequence of the nucleic acid molecule is obtained by base mutation of the sequence shown in SEQ ID NO: 2.

[0007] The third aspect of the present invention provides a vector, wherein the vector comprises the nucleotide sequence described in the second aspect, and the vector is a cloning vector or an expression vector. The vector may be a plasmid or a virus.

[0008] The fourth aspect of the present invention provides a recombinant cell, which comprises the vector according to the third aspect.

[0009] The fifth aspect of the present invention provides a method for preparing the α-amylase mutant, comprising the following steps:

[0010] (1) Using a plasmid with the sequence shown in SEQ ID NO: 2 as a template, a PCR reaction was performed using a point mutation primer to obtain a point mutation gene sequence and a plasmid; the template plasmid was digested with an endonuclease, and the digested product was then subjected to a recombination reaction;

[0011] (2) transferring the expression vector carrying the mutant gene into the host bacteria for fermentation expression;

[0012] (3) Collecting the host bacteria expressing the α-amylase mutant, resuspending the bacteria and breaking the cells, and centrifuging and collecting the supernatant to obtain a crude enzyme solution containing the α-amylase mutant.

[0013] Preferably, in step (1), the pET22b plasmid carrying the original enzyme gene is used as a template; and the methylated template plasmid is digested with DpnI endonuclease.

[0014] Preferably, in step (2), the recombinant product is transformed into E. coli BL21 (DE3) to express the exogenous protein.

[0015] Preferably, in step (3), the host bacteria are collected by centrifugation; and the cells are disrupted by ultrasound.

[0016] Preferably, the sequence of the point mutation primer is as shown in Table 1 ("-F" represents the upstream primer, and "-R" represents the downstream primer):

[0017] Table 1 Primer sequences

[0018] Primer name Sequence (5'-3') E47F-F CAATATTTTTTTTGGTATCTGCCGGATGATGGC E47F-R GATACCAAAAAAAATATTGCATCATGGTGCCATT E202F-F TTGGGATTTTAGCCGCAAACTGAGCCGCATTT E202F-R TTGCGGCTAAAATCCCAATCCACGCCATCAAAAT E248F-F GTGACCTTTCTGAAAAACTGGGGCAAATGGT E248F-R TTTCAGAAAGGTCACCACTTCCGGATGATCCAT D352V-F CTGATGAAAGTGCAGCCGACCCTGGCGGTGACC D352V-R CGGCTGCACTTTCATCAGGGTGTTGGTCATCAG

[0019] Preferably, the PCR reaction system is as shown in Table 2:

[0020] Table 2 PCR reaction system

[0021] Ingredients volume 2×ProofastMaxMasterMix 12.5μL 10 pmol / μL Forward Primer 1 μL 10 pmol / μL Reverse Primer 1 μL DNA template <50ng ddH2O up to 25 μL

[0022] Preferably, the conditions for the PCR reaction are as shown in Table 3:

[0023] Table 3 PCR reaction conditions

[0024]

[0025]

[0026] Preferably, the DpnI endonuclease digestion conditions are: 37°C for 2 hours, and the enzyme digestion system is as shown in Table 4:

[0027] Table 4 Enzyme digestion system

[0028] Ingredients content PCR reaction products 25 μl DpnI 1 μl

[0029] Preferably, the recombination reaction conditions are: 37°C for 1 hour, and the reaction system is as shown in Table 5:

[0030] Table 5 Recombination reaction system

[0031] Ingredients content DpnI digestion products 4 μl 5×UFOBuffer 4 μl UvsXase 2 μl ddH2O up to 20 μL

[0032] The sixth aspect of the present invention provides a product, characterized in that the product comprises the α-amylase mutant as described in the first aspect, or the nucleic acid molecule as described in the second aspect, or the vector as described in the third aspect, or the recombinant cell as described in the fourth aspect.

[0033] The seventh aspect of the present invention provides applications of the product described in the sixth aspect in food processing, oil extraction, biofuel production, and the like.

[0034] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The α-amylase mutant has higher salt tolerance, and the enzyme activity in high-concentration sodium ion, magnesium ion, and calcium ion solutions is higher than that of the original enzyme, with an increase of up to 57.4%; 2. The present invention provides a preparation method and application of the mutant; 3. The present invention provides an α-amylase mutant with higher salt tolerance or its encoding gene or corresponding vector or corresponding recombinant cell, which optimizes the application of α-amylase in high-concentration salt environments. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a diagram showing the enzymatic activity of wild-type α-amylase and its mutants in different types of high-concentration salt solutions;

[0036] Figure 2 Schematic diagram of the mutation site of α-amylase mutants. DETAILED DESCRIPTION

[0037] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0038] Example 1 A salt-tolerant α-amylase mutant E47F

[0039] The salt-tolerant α-amylase mutant E47F was obtained by mutating the glutamic acid at position 47 of the α-amylase nucleotide sequence shown in SEQ ID NO: 2 to phenylalanine. The preparation method is as follows:

[0040] 1. Construction of recombinant plasmid

[0041] Plasmids pET-22b and E. coli BL21 (DE3) were both deposited by the applicant and were obtained from commercial sources. The wild-type α-amylase gene from Geobacillus stearothermophilus was synthesized by Jin Weizhi (Suzhou) Co., Ltd. The primers used to introduce mutation sites are shown in Table 1 (E47F-F and E47F-R), the PCR reaction system is shown in Table 2, the template for point mutation PCR is the pET-22b plasmid with the wild-type α-amylase gene sequence, and the other components used for point mutation PCR are all from the MutUFOFast Mutagenesis Kit (Nanjing Jujiang Biological). The PCR reaction conditions are shown in Table 3. After the PCR was completed, since the product contained the original template plasmid, in order to prevent it from forming false positive transformants in subsequent transformations, it was digested with DpnI (constant temperature reaction at 37°C for 2h), and the digestion reaction system is shown in Table 4. After the DpnI digestion reaction was completed, the DpnI digestion product was subjected to a recombination reaction (constant temperature reaction at 37°C for 1h), and the reaction system is shown in Table 5. The resulting product is a recombinant plasmid containing the designed point mutation, which was sequenced and confirmed by GenWeichi (Suzhou) Co., Ltd.

[0042] 2. Expression of mutant enzymosomes and preparation of crude enzyme solution

[0043] The recombinant plasmid was transformed into the E. coli BL21 (DE3) host bacteria and spread onto the surface of LB solid medium containing 100 μg / mL ampicillin. The culture was incubated at 37°C overnight. A single colony of E. coli was picked and inoculated into 3 mL of LB liquid medium containing 100 μg / mL ampicillin. The culture was incubated at 37°C for 10 hours. The seed solution was inoculated at a 5% inoculum into a 250 mL Erlenmeyer flask containing 30 mL of TB medium. The culture was incubated at 37°C and 200 rpm. After 6 hours of culture, IPTG was added to a final concentration of 0.4 mM. The culture temperature was set to 22°C and the culture was continued for 18 hours. The fermentation broth was centrifuged at 4000g for 10 minutes, the bacteria were collected, and resuspended in a preset high-concentration salt solution (100g / LNaHCO3, 150g / L MgCl2, 160g / LNaCl, 300g / L CaCl2). The cells were ultrasonically disrupted for 5-8 minutes until the liquid became slightly clear. The supernatant was centrifuged at 4000g for 10 minutes, and the supernatant was used as the crude enzyme solution of mutant E47F. The above strain culture and crude enzyme solution preparation experiments were carried out in triplicate.

[0044] Example 2 A salt-tolerant α-amylase mutant E202F

[0045] The glutamic acid at position 202 of the α-amylase nucleotide sequence shown in SEQ ID NO: 2 was mutated to phenylalanine to obtain a salt-tolerant α-amylase mutant E202F. The preparation method was the same as in Example 1, except that the primers were E202F-F and E202F-R.

[0046] Example 3 A salt-tolerant α-amylase mutant E248F

[0047] The glutamic acid at position 248 of the α-amylase nucleotide sequence shown in SEQ ID NO: 2 was mutated to phenylalanine to obtain a salt-tolerant α-amylase mutant E248F. The preparation method was the same as in Example 1, except that the primers were E248F-F and E248F-R.

[0048] Example 4 A salt-tolerant α-amylase mutant D352V

[0049] The aspartic acid at position 352 of the α-amylase nucleotide sequence shown in SEQ ID NO: 2 was mutated to valine to obtain a salt-tolerant α-amylase mutant D352V. The preparation method was the same as in Example 1, except that the primers were D352V-F and D352V-R.

[0050] Example 5 A salt-tolerant α-amylase mutant E248F / D352V

[0051] A salt-tolerant α-amylase mutant, E248F / D352V, was obtained by mutating glutamic acid at position 248 to phenylalanine and aspartic acid at position 352 to valine in the α-amylase nucleotide sequence shown in SEQ ID NO: 2. The preparation method was the same as in Example 1, except that primers E248F-F, E248F-RD352V-F, and D352V-R were used.

[0052] Example 6 Comparison of the enzyme activities of α-amylase and its mutants in different types of high-concentration salt solutions

[0053] The cells extracted from Examples 1-5 were resuspended in 100 g / L NaHCO 3 , 150 g / L MgCl 2 , 160 g / L NaCl , and 300 g / L CaCl 2 , respectively, and ultrasonically disrupted. The supernatants were centrifuged and the enzyme activity was determined using the DNS method.

[0054] The DNS enzyme activity assay method is as follows: prepare glucose solutions at concentrations of 0.500, 0.375, 0.250, 0.188, and 0.125 mg / mL, aliquot 150 μL into a clean EP tube, add 150 μL of DNS solution to each solution, incubate in a boiling water bath for 10 minutes, and measure the absorbance at 540 nm for plotting a standard curve. Add 30 μL of crude enzyme solution and 120 μL of 1% starch solution to the EP tube, react at 65°C for 5 minutes, quickly cool to room temperature, terminate the reaction by adding 150 μL of DNS solution, and incubate in a boiling water bath for 10 minutes. After quickly cooling to room temperature, dilute appropriately with deionized water, and measure the absorbance at 540 nm. Additionally, a negative control was prepared by adding 30 μL of crude enzyme solution to 120 μL of deionized water using the same DNS solution and treatment. Enzyme activity was calculated according to the above method, with 1 activity defined as the amount of enzyme that catalyzes the decomposition of 1 μmol of reducing sugar in 1 minute under the established reaction conditions.

[0055] The results are as follows Figure 1 As shown, the five mutants of the enzyme showed improved enzymatic activity compared to the original enzyme in high-concentration salt solutions. In a 100 g / L NaHCO solution, the enzyme activity of mutant E248F increased by 36.0% compared to the original enzyme; in a 150 g / L MgCl solution, the enzyme activity of mutant D352V increased by 57.4% compared to the original enzyme; in a 160 g / L NaCl solution, the enzyme activity of mutant E248F increased by 27.7%; and in a 300 g / L CaCl solution, the enzyme activity of mutant E248F increased by 27.8%. These results demonstrate that the five mutants constructed by the present invention enhance the enzymatic activity of α-amylase in solutions with high concentrations of sodium, magnesium, and calcium ions.

Claims

1. A salt-tolerant α-amylase mutant, characterized in that The amino acid sequence of the α-amylase mutant is obtained by mutating the sequence shown in SEQ ID NO: 1, and the mutant is E47F, E202F, E248F, D352V or E248F+D352V.

2. A nucleic acid, characterized in that The nucleic acid encodes the α-amylase mutant according to claim 1.

3. The nucleic acid according to claim 2, characterized in that The nucleotide sequence of the nucleic acid is obtained by base mutation of the sequence shown in SEQ ID NO:

2.

4. A carrier, characterized in that The vector comprises the nucleotide sequence of claim 3.

5. The carrier according to claim 4, characterized in that The vector is a cloning vector or an expression vector.

6. A recombinant cell, characterized in that The recombinant cell comprises the vector of claim 4.

7. A method for preparing the α-amylase mutant according to claim 1, characterized in that: The steps include: (1) Using the plasmid with the sequence shown in SEQ ID NO: 2 as a template, a PCR reaction was performed using a point mutation primer to obtain a point mutation gene sequence and a plasmid; the template plasmid was digested with an endonuclease, and the digested product was then subjected to a recombination reaction; (2) The expression vector carrying the mutant gene is transferred into the host bacteria for fermentation expression; (3) Collect the host bacteria expressing the α-amylase mutant, resuspend the bacteria, break the cells, and centrifuge to obtain the supernatant to obtain the crude enzyme solution containing the α-amylase mutant.

8. The preparation method according to claim 7, characterized in that The endonuclease in step (1) is DpnI.

9. A product, characterized in that The product comprises the α-amylase mutant according to claim 1, or the nucleic acid according to any one of claims 2 to 3, or the vector according to claim 4, or the recombinant cell according to claim 6.

10. Use of the product according to claim 9 in food processing, oil extraction, and biofuel production.

Images