Polynucleotides, proteins, viral vectors and preparation methods for expressing SARS-CoV-2 receptor binding domains, vaccine preparations and preparation methods and applications

Abstract

The present invention provides a polynucleotide, protein, viral vector and preparation method, vaccine preparation and preparation method and application expressing SARS‑CoV‑2 receptor binding domain, belonging to the field of biomedicine. Adeno-associated virus is used to simultaneously deliver a structurally optimized SARS‑CoV‑2 receptor binding domain (RBD) coding sequence and a variety of shRNAs targeting immune regulatory genes, so that tumor cells overexpress and efficiently present the antigen RBD, while quickly awakening and enhancing the body's RBD-specific pre-existing immune response, and relieving the inhibitory effect of PD1 / PD‑L1 immune checkpoints on T cell killing. Furthermore, the CpG1018 adjuvant is used in combination, and CpG1018 and AAV are encapsulated into an injectable hydrogel, which achieves the dual effects of enhanced anti-tumor immune response and reduced viral leakage infection, and shows a strong tumor inhibition effect in a variety of solid tumors. The present invention is expected to overcome the problems of limited selection of current tumor vaccine antigens, poor universality and slow onset, and has broad application prospects in the field of tumor immunotherapy.

Description

Technical Field

[0001] The present invention relates to polynucleotides, proteins, viral vectors and preparation methods, vaccine preparations and preparation methods and applications expressing SARS-CoV-2 receptor binding domains, and is intended to treat different solid tumors. The present invention belongs to the field of biomedicine. Background Art

[0002] Tumor vaccines activate the autologous immune system to accurately identify and kill cancer cells. In recent years, clinical studies have shown good tolerance and great anti-tumor potential. However, due to high tumor heterogeneity, limited antigen selection, insufficient antigen presentation, and slow onset of de novo immune response, current tumor vaccines still face problems such as low response rate and poor universality. Therefore, how to improve the immunogenicity, expression level and presentation efficiency of tumor antigens, while quickly and efficiently initiating the body's immune response, is a basic common problem that needs to be solved in the field of tumor vaccines, which has important theoretical significance and application value.

[0003] Currently, tumor vaccines can be divided into two categories: tumor-associated antigen (TAA) vaccines and personalized neoantigen vaccines. Although the two types of tumor vaccines have shown good tolerability and considerable anti-tumor effects in clinical studies in recent years, there are still many problems that need to be solved. Specifically, TAA-specific T cells have central and / or peripheral immune tolerance, and TAA is also expressed to a certain extent in normal tissues. Therefore, the poor immunogenicity and specificity (safety) of TAA-based vaccines are unavoidable and urgently need to be overcome. Similarly, due to the long prediction and verification cycle of neoantigens, poor expression abundance and immunogenicity, and the risk of expression loss, it is also challenging for patients to obtain positive clinical results through personalized neoantigen vaccines. In addition, due to the human leukocyte antigen subtype (HLA) restrictions, personalized neoantigen vaccines are almost impossible to apply to another individual, resulting in poor universality and high cost.

[0004] The antigen presentation process mediated by major histocompatibility complex 1 (MHC I) is the key to the recognition and elimination of tumor cells by killer T cells. Under physiological conditions, if the tumor mutation load is high and the neoantigens encoded by it can be fully presented, autologous killer T cells can effectively recognize "non-self" signals and rapidly proliferate to eliminate tumor cells. By silencing the expression of MHC-I inhibitory factors and improving the efficiency of MHC-I-mediated antigen presentation, the survival rate of various tumor model animals can be significantly improved. In addition, highly expressed membrane antigens can also eliminate tumor cells through a variety of antibody-mediated mechanisms, including antibody-dependent cellular cytotoxicity (ADCC), antibody-dependent phagocytosis (ADCP) and complement-dependent cytotoxicity (CDC). It can be seen that how to achieve efficient expression and presentation of tumor cells with specific membrane antigens with high immunogenicity, thereby strengthening their "non-self" signals, and then using the autologous immune system to efficiently and specifically eliminate tumor cells, is a key issue that current tumor vaccines need to solve. Summary of the invention

[0005] The present invention provides a polynucleotide expressing a SARS-CoV-2 receptor binding domain (RBD) protein, which can efficiently express RBD after codon optimization, and the polynucleotide contains at least 95% homology with the sequence shown in SEQ ID NO: 1. Preferably, the sequence of the polynucleotide contains the sequence shown in SEQ ID NO: 1.

[0006] The present invention provides a protein containing a SARS-CoV-2 receptor binding domain (RBD), which is a highly immunogenic RBD trimer after structural design optimization, and the sequence of the protein contains at least 95% homology with the sequence shown in SEQ ID NO: 2. Preferably, the nucleotide sequence of the protein is as shown in SEQ ID NO: 1. The protein is used as an antigen.

[0007] The present invention also provides a polynucleotide, which can simultaneously transcribe and generate RBD mRNA encoding an optimized structure, and shRNA targeting the immune checkpoint PD-L1 and the MHC-I negative regulatory factor SUSD6, wherein the sequence of the polynucleotide comprises the sequences shown in SEQ ID NO:1, SEQ ID NO:3 and SEQ ID NO:4, and the purpose is to activate cytotoxic T lymphocytes to the maximum extent.

[0008] The present invention also provides a viral vector, which contains a polynucleotide expressing a SARS-CoV-2 receptor binding domain (RBD) protein and / or a protein capable of expressing the aforementioned SARS-CoV-2 receptor binding domain (RBD). The viral vector is one or more of a replication-deficient recombinant adeno-associated virus, a recombinant adenovirus, and a recombinant herpes simplex virus. Preferably, the viral vector is a replication-deficient recombinant adeno-associated virus (AAV), because AAV has a wide spectrum of infection, the carried gene can be expressed for a long time, the vector is highly safe, and has the characteristics of efficiently penetrating solid tumors, making AAV a new type of virus-based safe and long-acting vaccine delivery vector. Preferably, the recombinant adeno-associated virus serotype includes all natural and artificially designed serotypes, the natural serotypes include but are not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV11, AAV12, AAVrh8, AAVrh10, AAVrh74, the artificially designed serotypes include but are not limited to AAVDJ, AAV7m8, PHP.eB, CAP.B10, CPP.16, preferably, the recombinant adeno-associated virus serotype is preferably the artificially designed serotype AAVDJ, which can achieve efficient infection of tumor cells.

[0009] The present invention provides a replication-deficient recombinant adeno-associated virus, the replication-deficient recombinant adeno-associated virus comprises a polynucleotide, the polynucleotide comprises the sequences shown in SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO: 4, and the replication-deficient recombinant adeno-associated virus can simultaneously express SARS-CoV-2 RBD trimer, shRNA targeting PD-L1 and SUSD6 in tumor cells. On the one hand, it can realize the display of RBD trimer on the tumor cell membrane, and on the other hand, it can realize the secretion of virus-like particles carrying RBD trimer, thereby awakening and strengthening the body's pre-existing RBD-specific immune response. The modified tumor cells can also release enveloped virus-like particles carrying RBD, which helps to fully activate and enhance the pre-existing RBD-specific immune response in the body to improve the tumor. The simultaneous expression of shRNA targeting PD-L1 and SUSD6 can reduce the possibility of tumor cell immune escape by improving the recognition and killing efficiency of killer T cells.

[0010] The present invention also provides a universal tumor vaccine that utilizes autologous pre-existing immunity to kill in situ modified tumor cells, which comprises the viral vector, adjuvant and hydrogel matrix as described above. Preferably, the viral vector is a replication-deficient recombinant adeno-associated virus, and the viral vector comprises a polynucleotide expressing a SARS-CoV-2 receptor binding domain (RBD) protein and / or a protein capable of expressing the aforementioned SARS-CoV-2 receptor binding domain (RBD). Further preferably, the replication-deficient recombinant adeno-associated virus comprises a polynucleotide, and the polynucleotide comprises the sequences shown in SEQ ID NO:1, SEQ ID NO:3 and SEQ ID NO:4; the adjuvant is one or a combination of two or more of aluminum hydroxide, aluminum phosphate, AddaVAX, MF59, AS01B, AS01A, AS03, AS04, CpG1018 and Matrix-M, and the preferred adjuvant is CpG1018; The hydrogel matrix is ​​any one or a combination of at least two of poloxamer, hyaluronic acid, calcium alginate and hydrophilic / hydrophobic modifications thereof, metal ion biomineralization, coating or grafted modified polymers, preferably poloxamer, more preferably poloxamer 407. Preferably, the universal tumor vaccine is one or more of intratumoral injection hydrogel, intramuscular injection hydrogel, percutaneous administration hydrogel, and cavity administration hydrogel, and further preferably, the universal tumor vaccine is intratumoral injection hydrogel.

[0011] The present invention also provides the use of the above-mentioned viral vector and / or the above-mentioned universal tumor vaccine in the preparation of a drug for treating tumors. Preferably, the tumor is a solid tumor. Further preferably, the drug for treating tumors is a therapeutic tumor vaccine.

[0012] At the same time, the present invention also provides a method for preparing the above-mentioned replication-deficient recombinant adeno-associated virus vector STM-shRNA that can simultaneously express SARS-CoV-2 RBD trimer protein, PD-L1 shRNA and SUSD6 shRNA, the method comprising the following steps:

[0013] (1) constructing a cis-plasmid vector containing the polynucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:3 and SEQ ID NO:4; (2) screening the serotype that can efficiently infect tumor cells and constructing the corresponding capsid plasmid; (3) transfecting the plasmids described in steps (1) and (2) together with the auxiliary plasmid into host cells; (4) culturing the host cells described in step (3); (5) harvesting the replication-deficient recombinant adeno-associated virus released from the cells described in step (4); (6) purifying the culture product in step (5), preferably the cells described in steps (3)-(4) are VPC2.0 cells; preferably, the purification method in step (6) is an affinity chromatography based on AAVX medium.

[0014] Further preferably, the preparation method comprises the following steps:

[0015] (1) constructing a cis-plasmid vector containing polynucleotides encoding the transmembrane SARS-CoV-2 RBD trimer, PD-L1 shRNA, and SUSD6 shRNA;

[0016] (2) Screening serotypes that can efficiently infect tumor cells and constructing corresponding capsid plasmids;

[0017] (3) transfecting the cis plasmid from step (1) together with the capsid plasmid and the helper plasmid from step (2) into a host cell;

[0018] (4) culturing the host cells described in step (2) at 37° C., 8% CO 2 , and a rotation speed of 130 rpm / min;

[0019] (5) harvesting the replication-defective recombinant adeno-associated virus released from the cells in step (4);

[0020] (6) Purify the culture product in step (5) to obtain a recombinant adeno-associated virus (AAV-STM-shRNA).

[0021] Preferably, the capsid plasmid vector in step (2) is a recombinant adeno-associated virus serotype 1, 6, or DJ, more preferably DJ.

[0022] Preferably, the cells in steps (3)-(4) are VPC2.0 cells.

[0023] Preferably, the purification method in step (6) is affinity chromatography, preferably POROS TM CaptureSelect TM AAX affinity chromatography.

[0024] The universal solid tumor vaccine with a recombinant adeno-associated virus as a carrier provided by the present invention has achieved unexpected therapeutic effects on a variety of solid tumor models. The research results of the present invention show that the therapeutic universal tumor vaccine designed in the present invention can awaken and significantly enhance the pre-existing SARS-CoV-2 RBD-specific immune response, and improve the expression level and presentation efficiency of the transmembrane RBD trimer. Among them, the combination of adjuvants and the optimization of dosage forms based on injection excipients achieve the purpose of attenuating toxicity and increasing efficacy, and have achieved significant therapeutic effects in a variety of solid tumor models, providing a universal tumor vaccine. In summary, the tumor vaccine of the present invention can produce a strong and lasting therapeutic effect on a variety of solid tumors, showing its potential as a universal tumor vaccine. In addition, all the selected excipients in the vaccine are injectable pharmaceutical excipients, and the selected viral vector is AAV, which is currently widely used in clinical practice, which is beneficial to improving the drugability of tumor vaccines and greatly reducing the risks and costs of clinical transformation. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0026] Figure 1 Schematic diagram of the preparation and action mechanism of universal tumor vaccines. A shows a schematic diagram of the action mechanism of AAV vaccine, B shows a schematic diagram of the preparation process of universal tumor vaccine, C shows a schematic diagram of the action mechanism of universal tumor vaccine, and D shows a schematic diagram of the in vivo action mechanism of universal tumor vaccine.

[0027] Figure 2-1 , Figure 2-2 , Figure 2-3 and Figure 2-4 Represents serotype optimization screening of recombinant adeno-associated viruses. Figure 2-1 Parts A and B in the middle are schematic diagrams of the process of screening the most matching AAV serotype according to tumor type through confocal microscopy imaging and flow cytometry analysis, as well as representative confocal images; Parts C, D, and E respectively represent the average fluorescence intensity of B16F10 cells (C), 4T1 cells (D), and CT26 cells (E) after infection with different serotypes of AAV; Figure 2-2 In the figure, part F shows the representative bioluminescent images of transgene expression at different time points in CT26 tumor-bearing mice, part G shows the statistical graph of tumor growth curve, part H shows the statistical graph of transgene expression dynamics in tumor, and part I shows the statistical graph of transgene expression intensity per unit tumor volume; Figure 2-3Parts J to M in the middle respectively represent the bioluminescence image (J), growth curve (K), transgene expression (L) and its expression intensity per unit tumor volume (M) of 4T1 tumor-bearing animals after intratumoral injection of AAV-Luc; Figure 2-3 Part N in the middle shows the bioluminescence image of B16F10 tumor-bearing mice. Figure 2-4 The O part represents the tumor growth curve, the P part represents the transgene expression, and the Q part represents the intensity per unit tumor volume.

[0028] Figure 3-1 , Figure 3-2 and Figure 3-3 It represents the optimization of SARS-CoV-2 RBD antigen structure and the design of multi-target gene silencing. Figure 3-1 Part A shows the schematic diagram of different antigen constructions that can simultaneously overexpress transmembrane SARS-CoV-2 RBD and secretory RBD eVLPs, among which SP tPA : signal peptide sequence from human tissue plasminogen activator, HR: heptad repeat sequence, TM: transmembrane domain, containing the original transmembrane motif of WT SARS-CoV-2 spike protein, EABR: sequence capable of budding to generate RBD eVLP, derived from the ESCRT protein and ALIX protein binding region; Part B shows the protein blot of antigen expression in cell lysate and culture supernatant; Figure 3-2 Part C in the middle shows the subcellular localization of antigen expression determined by immunofluorescence, and the white arrows indicate the colocalization of RBD and did-labeled cell membranes; Figure 3-3 Part D shows the schematic diagram of the design of AAV expressing antigen and dual-target shRNA; Part E shows the characterization of recombinant AAV expressing different antigens by transmission electron microscopy; Part F shows the verification of antigen expression and dual-target silencing after different tumor cells were infected with AAV expressing antigen and dual-target shRNA (AAV-shRNA-STM); Part G shows the statistical graph of PD-L1 and SUSD6 silencing efficiency in different tumor cells.

[0029] Figure 4 It represents the preparation of hydrogel containing recombinant adeno-associated virus and adjuvant and the investigation of sustained release. Part A represents the investigation of the phase change ability of hydrogel under temperature change for five consecutive cycles; Part B represents the metabolic changes of hydrogel in vivo over time; Part C represents the representative image of sustained release of Cy5-labeled OVA at the injection site over time, and Part D represents the statistical graph of sustained release of Cy5-labeled OVA at the injection site over time.

[0030] Figure 5-1 and Figure 5-2 It indicates that different SARS-CoV-2 vaccines were successfully administered to mice to establish pre-existing immunity. Figure 5-1 Part A shows the schematic diagram of the experimental scheme for establishing pre-existing immunity; Parts B to D respectively show the comparison of antigen-specific antibody titers induced in the host by the inactivated SARS-CoV-2 virus (INV) and the mRNA vaccine, Part B shows the RBD-specific IgG titer, Part C shows the RBD-specific IgG1 titer, and Part D shows the RBD-specific IgG2a titer; Figure 5-2 In the figure, part E shows the ELISpot detection of IFNγ spot images and spot quantity statistics; part F shows the level of IFNγ secretion by splenic lymphocytes stimulated by RBD protein and its epitope peptides; parts G~H respectively show the frequencies of RBD-specific CD4 (G) and CD8 (H) positive memory T cells induced by different vaccines.

[0031] Figure 6-1 , Figure 6-2 and Figure 6-3 It indicates the therapeutic effect of the tumor vaccine CpG gel of the present invention on melanoma. Figure 6-1 Part A shows the schematic diagram of the treatment plan design, and Parts B to C show the survival curves and average tumor volumes over time in the INV pre-vaccinated mouse cohort, respectively; Figure 6-2 In the figure, parts D and E respectively show the survival curves and mean tumor volume over time in the mRNA pre-vaccinated mouse cohort; part F shows the curves of individual tumor volume over time in all groups; Figure 6-3 Parts G to I in the middle show the changes in RBD-specific antibody titers of IgG (G), IgG1 (H), and IgG2a (I) before and after therapeutic vaccination, respectively; Part J shows representative images and quantitative statistical graphs of IFN-γ ELISpots on spleen cells of mice that received or did not receive treatment after stimulation with RBD MCH-I epitope peptide.

[0032] Figure 7-1 and Figure 7-2 The present invention shows the mechanism by which the tumor vaccine CpG gel of the present invention induces anti-tumor immune response in vivo. Figure 7-1Part A shows the abundance of different tumor-infiltrating lymphocytes in tumors isolated from treated animals; Part B shows the characteristics of cytotoxic CD4+ and CD8+ T cells in tumors; Part C shows the ratio of M1 tumor-associated macrophages to M1 tumor-associated macrophages; Part D shows a schematic diagram of the process of T cell activation initiated by mature antigen-presenting cells APC; Part E shows the ratio of mature dendritic (CD11c+) cells and macrophages (F4 / 80+) populations in draining lymph nodes; Part F shows the frequency of activated CD4+ and CD8+ T cells in draining lymph nodes; Part G shows the preparation of stimulators (S) for immune restimulation, where S1 is: epitope peptides predicted by NetMHC-4.0 software; S2 is: B16F10 cells inactivated by mitomycin; Figure 7-2 Part H shows the abundance of cytokine-producing splenocytes stimulated with S1 or S2; Part I shows the levels of secreted cytokines in the culture medium of splenocytes stimulated with S1 or S2; Part J shows the induction of non-RBD-specific memory T cell immunity by antigen spreading; Part K shows representative images and statistical graphs of IFN-γ ELISpots of splenocytes stimulated with S2 alone.

[0033] Figure 8-1 , Figure 8-2 , Figure 8-3 and Figure 8-4 The results show that the tumor vaccine CpG gel of the present invention has therapeutic effects on breast cancer and colon cancer. Figure 8-1 Part A shows the schematic diagram of therapeutic vaccine treatment for breast cancer and colon cancer in Balb / cJGpt mice; Part B shows the average tumor volume of mice inoculated with 4T1 tumor cells over time; Part C shows the survival curve of mice inoculated with 4T1 tumor cells. Figure 8-2 Part D in the middle shows the changes in tumor volume of individual mice inoculated with 4T1 tumor cells; Figure 8-3 Part E in the middle shows the average tumor volume of mice inoculated with CT26 tumor cells over time, and Part F shows the survival curve of mice inoculated with CT26 tumor cells. Figure 8-4 Part G in the middle shows the changes in individual tumor volumes of mice inoculated with CT26 tumor cells.

[0034] Figure 9-1 , Figure 9-2 and Figure 9-3 The results of the anti-tumor mechanism of the tumor vaccine CpG gel of the present invention are shown in FIG. Figure 9-1Part A shows representative flow cytometry histograms; Part B shows the expression level of H-2Kb:OVA in B16F10-OVA cells transduced with AAV-shRNA; Part C shows a schematic diagram of T cell activation assay; Part D shows the galactosidase activity produced by B3Z T cell hybridoma stimulated by B16F10-OVA cells infected with AAV-shRNA and B16F10 cells without OVA; Figure 9-2 In , part E shows representative confocal images of antigen-transduced B16F10, 4T1, and CT26 cells obtained by indirect immunofluorescence test; Figure 9-3 Part F in the middle represents the schematic diagram of antibody-mediated cellular phagocytosis ADCP; Figure 9-2 The middle G part represents the flow gating strategy of phagocytic ADCP; Figure 9-3 Parts H to M in the middle represent representative flow cytometry dot plots and the percentage of phagocytosis in the presence of serum or PBS, respectively. Among them, B16F10 cells (H and K), 4T1 cells (I and L), and CT26 cells (J and M). DETAILED DESCRIPTION

[0035] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0036] Compared with de novo immunization, which requires multiple booster immunizations and a long time to induce a sufficiently strong immune response, the pre-existing immunity of re-exposure to antigens can directly act through antibodies and effector immune cells, and can induce the host to produce stronger and more lasting immune responses faster through immune memory. Therefore, the use of pre-existing immunity for anti-tumor treatment has the potential to respond quickly, efficiently and lastingly. Then, if a suitable highly immunogenic antigen can be identified and most individuals have established pre-existing immunity to the antigen, then the use of biotechnology to specifically label heterogeneous tumor cells with the same transmembrane antigen "tag" will bring great hope for the treatment of various cancers. According to statistics from the World Health Organization, as of now, more than 700 million people have been infected with SARS-CoV-2 worldwide, and more than 13.5 billion doses of COVID-19 vaccines have been administered worldwide, covering more than 90% of the population. Previous studies have shown that SARS-CoV-2 infection and various marketed vaccines can induce antigen (spike protein receptor binding domain, RBD)-specific immune responses and lasting immune memory. Based on this, we innovatively proposed that the SARS-CoV-2 RBD-specific pre-existing immune response shared by most people can effectively kill various tumor cells that have been modified to overexpress and efficiently present transmembrane RBD, thereby significantly improving the effectiveness and universality of tumor vaccines.

[0037] In order to provide a universal and efficient tumor vaccine, the present invention designs a tumor therapeutic vaccine based on adeno-associated virus (AAV), which can transform a variety of tumor cells to overexpress and efficiently present the highly immunogenic transmembrane SARS-CoV-2 receptor binding domain (RBD). In addition, the transformed tumor cells can also release enveloped virus-like particles carrying RBD, thereby helping to fully activate and enhance the pre-existing RBD-specific immune response in the body. In order to maximize the activation of cytotoxic T lymphocytes and reduce the potential risk of AAV leakage infection, the inventors further optimized the tumor vaccine system. The optimization measures include: (1) encapsulating polynucleotides expressing shRNA targeting PD-L1 and SUSD6 and polynucleotides expressing RBD into the same AAV vector to inhibit these negative regulatory factors, thereby reducing the possibility of tumor cell escape; (2) combining the AAV vector with the approved adjuvant CpG1018 and adding it to a thermosensitive injectable hydrogel based on poloxamer 407. This combination prepares an in situ universal therapeutic vaccine that aims to provide more effective immune activation and a safer treatment experience. Through these strategies, the tumor vaccine of the present invention aims to overcome the limitations of existing treatments and provide patients with a safer and more effective tumor treatment option.

[0038] In order to solve the problems of poor antigen selection and low universality faced by current tumor vaccines, the present invention provides a new universal therapeutic tumor vaccine. Figure 1 The preparation and action mechanism of the universal tumor vaccine are shown in Figure 1. A shows the action mechanism of the AAV vaccine, B shows the preparation process of the universal tumor vaccine, C shows the action mechanism of the universal tumor vaccine, and D shows the in vivo action mechanism of the universal tumor vaccine.

[0039] In the embodiments of the present invention, the AAV vaccine is rationally designed to deliver an optimized antigen structure nucleic acid sequence, which can express the SARS-CoV-2 antigen (trimeric RBD) across the membrane and bud to generate the nucleic acid sequence of antigen eVLPs, thereby significantly awakening and enhancing the autologous pre-existing RBD-specific immune response; at the same time, the immunosuppressive molecule shRNA is delivered, which can silence the immune checkpoint PD-L1 and the MHC-I inhibitory molecule SUSD6, respectively, thereby significantly enhancing the antigen presentation efficiency of tumor cells to RBD, and relieving the inhibitory effect of the immune checkpoint on killer T cells (such as Figure 1 AAV and CpG are encapsulated in an injectable hydrogel to prepare a universal tumor vaccine CpG Gel (as shown in Part A of FIG. Figure 1This treatment model is expected to overcome the current problems of limited tumor vaccine antigen selection, poor universality, and slow onset of action. By endowing tumor cells with highly immunogenic pathogen antigens and improving tumor cell antigen presentation and T cell response, it can effectively kill different types of solid tumor cells with the help of the pre-existing pathogen antigen-specific immune response in the body, and induce a lasting immune memory effect, thereby significantly enhancing the therapeutic effect in a variety of solid tumor models ( Figure 1 C and D in the figure).

[0040] The present invention overcomes the above shortcomings from the perspective of utilizing pre-existing immunity in the body and transforming tumor cells: ① Transforming different tumors so that they can all highly express the SARS-CoV-2 antigen RBD with high immunogenicity; ② Based on the characteristics that pre-existing immunity in the body can take effect directly and can quickly produce a stronger and more lasting immune response, the RBD-specific immune response that is already widely present in the population is utilized and further enhanced. Thus, rapid identification and efficient killing of various types of tumor cells can be achieved through enhanced autologous pre-existing immunity. Furthermore, in order to reduce the immune escape of tumor cells, shRNA targeting immune checkpoints and / or MHC-I negative regulators is further introduced into the tumor vaccine; ③ The AAV vector and the approved adjuvant CpG1018 are combined to further enhance the immune response, and the AAV vector and CpG1018 are encapsulated in a thermosensitive injectable hydrogel of poloxamer 407 to reduce the risk of virus leakage and infection.

[0041] Example 1. Construction of a universal tumor vaccine using an injectable hydrogel to encapsulate a replication-deficient adeno-associated virus

[0042] 1. Optimization of serotype screening

[0043] For in vitro experiments, B16F10, 4T1, and CT26 cells seeded in 12-well and 8-well plates were infected with different serotypes of AAV1-CAG-GFP, AAV5-CAG-GFP, AAV6-CAG-GFP, AAV8-CAG-GFP, AAV9-CAG-GFP, AAVDJ-CAG-GFP, and AAVPHP.eB-CAG-GFP at an MOI of 100,000. After 48 hours of treatment, the cells were observed by confocal microscopy and analyzed by flow cytometry. The results showed that serotypes AAV1, AAV 6, and AAV DJ could efficiently infect the three tumor cells, among which the infection efficiency of AAV DJ serotype on the three cells was significantly higher than that of all other serotypes, with infection rates exceeding 99% ( Figure 2-1Therefore, we selected AAV DJ serotype for subsequent experiments. Subsequently, we further conducted in vivo experiments to explore the ability of AAV to achieve sustained high expression of target antigens in situ in solid tumor cells.

[0044] 2. In vivo expression experiments

[0045] For in vivo experiments, 1×10 5 B16F10, 2×10 5 4T1 and 2×10 5 CT26 cells were implanted subcutaneously into the right back or right axillary mammary fat pad of male C57BL / 6JGpt and female Balb / cJGpt mice. Seven days after tumor inoculation (dpi7), 50 μL of 1×10 10 vg recombinant virus AAVDJ-CAG-Luc (such as Figure 2-2 , Figure 2-3 and Figure 2-4 The mouse was then injected intraperitoneally with 0.15 mg / g D-Luciferin and anesthetized with isoflurane gas at designated time points. Bioluminescence was collected and analyzed on an IVIS imaging system. Meanwhile, tumor growth was monitored (as shown in Figure 2-2, Part G, Figure 2-3 The K part and Figure 2-4 ) and the dynamics of transgene expression in tumors (as shown in parts H, I, and Figure 2-4 The results showed that AAV can achieve sustained expression in three tumor types (as shown in Figure 2-2, Part F, Figure 2-3 Further calculations showed that the intensity of antigen expression per unit tumor volume could remain high for a long time, indicating that AAV-based antigen expression can continuously mark tumor cells and reduce the risk of immune escape due to antigen loss (e.g. Figure 2-2 Part I Figure 2-3 The middle M part and Figure 2-4 (as shown in the Q section).

[0046] 3. Structural optimization of RBD antigen and design of multi-target and gene silencing

[0047] 3.1 Structural optimization of antigens

[0048] The core antigen of the universal tumor vaccine is the spike protein receptor binding domain (RBD) of the wild-type strain of SARS-CoV-2 (Genebank No.: NC_045512.2), which includes the spike protein amino acid sequence 330 to 583. The present invention improves the expression level of RBD and the stability of RBD trimer by optimizing the structural design of RBD, and changes the subcellular localization of the protein, thereby improving the immunogenicity of the vaccine.

[0049] First, the tissue plasminogen activator signal peptide tPA was introduced at the N-terminus of the protein, and a Kozak sequence was added before the translation start codon to further improve the expression and secretion of the RBD protein. Secondly, in order to better mimic the natural trimer structure of the S protein RBD, a trimer domain derived from T4 phage was embedded at the C-terminus of the protein as a trimerization motif to obtain the antigen S T4 (SEQ ID NO:5); or select the heptad-repeat sequences (HR) of the spike protein itself as the trimerization motif to obtain antigen S HR (SEQ ID NO:6). At the same time, at the C-terminus of the trimerization motif, the spike protein's own transmembrane sequence and the ESCRT and ALIX binding regions are further connected in series, so that it can simultaneously achieve transmembrane expression and budding secretion of RBD virus-like particles, exerting the synergistic effects of immune enhancement and immune activation, and obtaining STM for antigen secretion and transmembrane expression respectively. T4 (SEQ ID NO:7) and STM HR (SEQ ID NO:2). Finally, codon optimization was performed by comprehensively considering various factors that affect protein translation efficiency, such as tRNA utilization efficiency and mRNA secondary structure. At the same time, in order to enhance the stability of mRNA, we appropriately increased the GC content of the RBD gene and distributed G and C nucleotides as evenly as possible in the entire GP gene. Secondly, in order to further improve the expression level of RBD, we added a Kozak sequence in front of the translation start codon of the tissue plasminogen activator signal peptide tPA. After our optimized design of the RBD gene, the gene sequence was synthesized and constructed into a viral packaging plasmid vector. Based on the above research, we designed a total of four sequences that can express the SARS-CoV-2 receptor binding domain (RBD) trimer, namely, S that is only secreted and expressed. T4 With S HR , secreted and transmembrane expressed STM T4 and STM HR (like Figure 3-1 (shown in part A).

[0050] 3.2 Vector construction and in vitro expression and identification of RBD

[0051] Plasmids with different antigen structure designs were transfected into HEK293T cells using PEI 40K (Polyscience). Cells and culture supernatants were collected 48 hours later and then subjected to Western Blot (WB) detection after denaturation or non-denaturation treatment. The results showed that HR could form a more stable trimerization structure compared with the T4 trimerization sequence design. At the same time, STM T4 Unable to achieve secretory expression of virus-like particles (e.g. Figure 3-1 Part B, black dashed box), STM only HR Simultaneous transmembrane and secretory expression (e.g. Figure 3-1 In addition, by analyzing the molecular weights of the undenatured and denatured proteins (the two lanes 5), it was found that STM T4 The stable polymer morphology was maintained in the culture supernatant, indicating the generation of virus-like particles. Subsequently, the effect of Triton-x-100 on cells was compared, and the immunofluorescence results showed that S T4 and S HR Unable to achieve membrane localization expression, while STM T4 and STM HR All of them have successfully achieved transmembrane expression (such as Figure 3-2 Combined with the results of secretory expression Western blotting (WB), STM HR Subsequent experiments were carried out, and the optimized nucleotide sequence was shown in SEQ ID NO: 1.

[0052] 3.3 Packaging and purification of recombinant viruses carrying dual-target shRNA and optimized antigens

[0053] Silencing immune checkpoints and MHC-I negative regulatory genes can effectively increase the activation of cytotoxic T cells and produce more powerful cytotoxic effects. Therefore, simultaneous targeting of silencing immune checkpoints and MHC-I negative regulatory genes is expected to maximize the anti-tumor T cell immune response. Among them, the targeted immune checkpoint molecules include but are not limited to PD-L1 and CTLA4, and the targeted MHC-I negative regulatory genes include but are not limited to SUSD6 and TMEM127, preferably a combination of PD-L1 (SEQ ID NO: 3) and SUSD6 (SEQ ID NO: 4). Online software is used to predict shRNAs with high silencing efficiency and low off-target efficiency, and they are cloned into AAV expression vectors. The silencing efficiency of target genes is compared by in vitro immunoblotting, and the optimal sequence is selected and cloned into the AAV expression vector of the optimized antigen, thereby constructing shRNA-STM that can silence PD-L1 (SEQ ID NO: 3) and SUSD6 (SEQ ID NO: 4) in series and express the optimized antigen at the same time. HRPlasmid ( Figure 3-3 Based on the screening of the best AAV serotype DJ, the STM-carrying vector was obtained by packaging and purification. HR High-quality recombinant AAV with dual shRNA (such as Figure 3-3 (as shown in Part E in the figure). Specifically:

[0054] The constructed target gene plasmid and auxiliary plasmid were co-transfected with pAAVDJ adeno-associated virus capsid plasmid into VPC2.0 cells for packaging of recombinant adeno-associated virus. The process is as follows:

[0055] a) VPC2.0 cells were inoculated into 500 mL triangular shake flasks with Vrial production medium (VPM, Thermo Fisher Scientific) and cultured overnight in a cell shaker incubator at 37°C, 8% CO2, and 130 rpm / min.

[0056] b) When the cell density reaches 2×10 6 When the cell count was 1.5447 cells / mL, the above plasmid was transfected according to the instructions attached to PEI 40000 (Polyscience, USA). The specific steps are as follows:

[0057] (1) Mix 120 μg of target gene plasmid, 120 μg of capsid plasmid pAAVDJ, and 240 μg of auxiliary plasmid evenly; dilute the plasmid with 12 mL VPM medium. Add 1 mL of PEI 40000 (1 mg / mL) transfection reagent to the plasmid diluted in the medium and vortex for 30 seconds to mix thoroughly.

[0058] (2) The transfection reagent and plasmid mixture was incubated at room temperature for 20 minutes and then added to the cell shaker. The culture was continued for 72 hours, and the cell pellet and culture supernatant were collected. The cell pellet was resuspended with 10 mL RB buffer (1 mM MgCl2, 50 mMTris·Cl, pH 7.4), and the virus was repeatedly frozen and thawed three times in a -80°C refrigerator and a 37°C water bath. Benzonase (50 U / mL) was added and enzymatically hydrolyzed in a 37°C water bath for 1 hour. 0.5% CHAPS (3-[(3-cholamidopropyl)dimethylamino]propanesulfonic acid inner salt) was added and incubated in a shaker at 37°C, 100 rpm for 1 hour. Subsequently, the supernatant containing the virus was collected by centrifugation at 12000 g for 10 minutes at 4°C, and filtered with a 0.45 μm PES membrane for later use. The culture supernatant was centrifuged at 12000 g at 4 °C for 15 min and filtered through a 0.45 μm PES membrane for later use.

[0059] (c) Purification of recombinant adeno-associated virus

[0060] The purification column was flushed with equilibration buffer (PBS, pH 7.4) at a flow rate of 4 mL / min until the UV280nm absorption peak of the eluent no longer changed. TM CaptureSelect TM AAX affinity medium was used to separate and purify adenovirus particles. The collected virus solution was loaded onto the column at a low speed of 2 mL / min and eluted with equilibrium buffer until the UV280 absorption peak reached the baseline. Subsequently, the eluent (50 mM citric acid, 50 mM sodium citrate, pH2.5) was further eluted at 2 mL / min. The eluent containing the purified virus with a clear absorption peak at UV280nm was collected. Neutralization buffer (1M Tris, pH9.0) was immediately added to neutralize the purified virus solution. The recombinant viruses carrying different RBD structural sequences and shRNA were recorded as S HR 、STM HR shRNA-STM HR .

[0061] d) Detect the titer and purity of the recombinant adeno-associated virus by qPCR and transmission electron microscopy. Specifically, design qPCR specific primers and probes for the target gene sequence, and the sequence 5'-3' is as follows:

[0062] RBD-F: TTCAACGCCACAAGATTCGC

[0063] RBD-R: TTGGTGAAGCACAGGTCGTT

[0064] RBD-TaqMan probe: FAM-AAGAATCAGCAACTGCGTGGCCG-BHQ1.

[0065] Take 15 μL of the sample to be tested for negative staining with phosphotungstic acid and take the virus morphology under transmission electron microscope. The results are as follows: Figure 3-3 As shown in part E, the virus has high purity and low empty shell rate.

[0066] 3.4 Carrying STM HR Viral functional validation with dual shRNA

[0067] AAV carrying shRNA and antigen gene (shRNA-STM HR ) were used to infect B16F10, 4T1, and CT26 cells in vitro, and the expression of antigens and silencing target proteins was detected. As expected, shRNA-STM HR Successfully expressed trimeric RBD and effectively silenced the expression of PD-L1 and SUSD6 ( Figure 3-3 (as shown in parts F to G in the figure).

[0068] 4. Preparation of injectable hydrogels encapsulating viruses and adjuvants and investigation of their local retention capacity

[0069] Adjuvants that have been approved for marketing include aluminum hydroxide, aluminum phosphate, AddaVAX, MF59, AS01B, AS01A, AS03, AS04, CpG1018 and Matrix-M. The clinical use is at least one or a combination of two or more of them. In the present invention, CpG1018 (5′-TGACTGTGAACGTTCGAGATGA-3′) is preferred, which has a synthetic modification of a thiophosphate backbone that resists nucleases. Currently, the most promising hydrogel matrices include poloxamer, hyaluronic acid, calcium alginate and their hydrophilic modification, hydrophobic modification, metal ion biomineralization, coating or grafted modified derivatives. Based on the convenience of clinical transformation, the present invention selects poloxamer 407, an FDA-approved pharmaceutical excipient for injection, as the hydrogel matrix. Specifically, CpG 1018 powder is dissolved in 18% poloxamer 407 to obtain a CpG thermosensitive hydrogel. The phase transition stability of the hydrogel was examined by keeping the hydrogel at 37°C for 15 seconds, melting it in an ice bath for 15 seconds, and repeating this phase transition cycle 5 times in succession. Subsequently, 100 μL of the hydrogel was injected subcutaneously into each mouse, and the changes in the gel over time were recorded. To detect the local retention ability, lyophilized Cy5-labeled AAV was mixed with the hydrogel at 4°C. Then 100 μL of the gel was injected subcutaneously and the fluorescence signal was collected by the IVIS system.

[0070] The results showed that the injectable hydrogel had good phase transition stability (e.g. Figure 4 A in the middle), and can form an in situ reservoir at the injection site in vivo (as shown in Figure 4 This method effectively confines AAV to local tumor tissue. After administration, the hydrogel can significantly prolong the retention time of free protein at the injection site compared with free AAV, indicating that the hydrogel has the potential to avoid side effects caused by off-target infection of AAV (such as Figure 4 C and D in the figure).

[0071] Example 2. Pharmacodynamic evaluation of different tumor vaccines constructed in mouse models

[0072] 1. Establishment of SARS-CoV-2 specific pre-existing immunity

[0073] This study selected the most widely used inactivated vaccine in China and the mRNA vaccine representing cutting-edge technology, and immunized mice according to their corresponding preclinical research vaccination schemes to induce a strong SARS-CoV-2-specific immune response, thereby establishing pre-existing immunity. In addition, in order to fully simulate the current status of vaccination in the population, tumors were inoculated on the 150th day (long-term) after the initial immunization to investigate the anti-tumor effect. 90 SPF-grade male C57BL / 6JGpt mice (6-8 weeks old). The inactivated virus BBIBP-CorV (INV) and mRNA SARS-CoV-2 vaccine that have been on the market were selected, and mice were immunized according to their standard vaccination schemes. The immunization schemes are as follows: Figure 5-1 As shown in Part A, in order to establish a SARS-CoV-2-specific pre-existing immune response, the immune status of the SARS-CoV-2-infected and vaccinated population is simulated. Table 1 shows the pre-existing immunity establishment plan.

[0074] Table 1. Pre-existing immune establishment scheme

[0075]

[0076] On the 28th and 42nd day after the initial immunization, blood was collected from the orbital vein to collect serum samples. After 3-fold dilution, the levels of RBD-specific IgG, IgG1, and IgG2a antibodies in the serum were determined by ELISA to confirm that a strong humoral immune response was generated in the mice. At the same time, some immunized mice were sacrificed, and three experiments, cell culture supernatant cytokine detection, ELISPOT detection, and cellular immune memory T cell detection, were performed to confirm that a strong cellular immune response had been activated in the mice and immune memory had been formed. Specifically, lymphocytes in the spleen were separated and collected, and then stimulated with antigen epitope peptide libraries or inactivated tumor cells. ELISPOT detected the number of spots secreted by cells after stimulation; ELISA detected the secretion level of IFN-γ in the culture supernatant; and flow cytometry detected the ratio of effector memory T cells (defined as CD44+CD62L-) to central memory T cells (defined as CD44+CD62L+).

[0077] 2. Investigation of pre-existing immune response

[0078] After immunization, blood was collected from mice at set time points, serum was separated, and ELISA was used to detect the titers of IgG, IgG1, and IgG2a antibodies against SARS-CoV-2 RBD protein in the serum. The results showed that high levels of antigen-specific antibodies were successfully induced in mice ( Figure 5-1 As shown in the B-D section of the figure), both the inactivated vaccine (INV) and the mRNA vaccine can significantly enhance the secretion of IFN-γ by spleen lymphocytes, indicating a strong cellular immune response ( Figure 5-2 (as shown in parts E to F in the figure).

[0079] In addition, mice were killed on day 70 after immunization and spleen lymphocytes were isolated. After restimulation with RBD and its epitope peptides, the detection results of different memory T cell subtypes showed that both inactivated vaccine (INV) and mRNA vaccine successfully established antigen-specific immune memory (e.g. Figure 5-2 (P<0.05 was defined as a statistically significant difference)

[0080] 3. Pharmacodynamics study of the universal tumor vaccine of the present invention

[0081] Table 2. Treatment options for universal tumor vaccines

[0082]

[0083] In order to simulate the actual immune status of the SARS-CoV-2 vaccinated population in the post-epidemic era, tumors were subcutaneously inoculated into the backs of male C57BL / 6JGpt mice on day 150 after the initial immunization, when the vaccine efficacy was significantly reduced. Then, 1×10 11 vg free AAV-S HR (S), AAV-STM HR (STM), AAV-STM HR -shRNA (STM-shRNA), or hydrogel formulation (CpG gel) (e.g. Figure 6-1 In the cohort that received INV pre-immunization, all intervention groups that received AAV-encoded antigens, except the S group, showed enhanced tumor growth inhibition and prolonged overall survival compared with the vector group. The median survival time of STM, STM-shRNA, and CpG gel was 18, 19, and 22 days, respectively, compared with 13 days in the free vector group and 15 days in the S group (as shown in Figure 2A). Figure 6-1 Part B and Part C and Figure 6-2 Similarly, in the cohort pre-immunized with mRNA vaccine, all intervention groups showed a trend consistent with the INV pre-vaccinated cohort. The median survival time of STM, STM-shRNA, and CpG gel was 16, 19, and 21 days, respectively ( Figure 6-2In addition, compared with the RBD-specific binding antibody before the injection of AAV antigen, STM-shRNA and CpG gel increased the antibody titer levels to varying degrees. Interestingly, the STM-shRNA group showed more obvious IgG and IgG1 titer enhancement than the CpG gel group. Among them, in terms of IgG2a, in the mRNA vaccine group, the CPG gel group showed an increase of about 300% compared with the STM-shRNA group, indicating that CpG tends to regulate cellular immune responses ( Figure 6-3 Consistently, the number of IFNγ and IL4-specific spots generated by splenocytes in the two CpG gel groups after stimulation with RBD MHC-I epitope peptides was significantly higher than that in the no-CpG group (e.g. Figure 6-3 These data collectively indicate that the treatment groups (STM-shRNA vs. CpG gel), especially the CpG gel group, can induce more effective and balanced humoral and cellular immunity against RBD, thereby facilitating the use of pre-existing immunity to generate a more powerful anti-tumor immune response.

[0084] 4. Investigation of the immune response mechanism induced by the universal tumor vaccine of the present invention

[0085] Mice were euthanized on day 13 after tumor vaccination, and tumors and spleens were collected and immersed in ice-cold PBS containing 2% FBS. The spleen was ground through a 70 μm filter and stored in 5 mL 1× mouse lymphocyte separation medium (Dakewe, China). The tissue mash was subjected to density gradient centrifugation at 800 g for 30 minutes and then lysed with ACK lysis buffer to obtain qualified spleen cells. The tumor was cut into approximately 1 mm pieces with scissors. 3 The pellet was then digested with 0.5 mg / mL collagenase IV and 0.1 mg / mL DNase I at 37 °C for 30-60 min while shaking. The tumor suspension was filtered through a 70 μm cell strainer and centrifuged at 2200 rpm for 7 min. The tumor cell pellet was resuspended in 30% Percoll (Solarbio, China, #P8370) and an equal volume of 70% Percoll top layer was carefully added. After centrifugation, tumor infiltrating lymphocytes (TILs) were collected at the junction of 70% Percoll and 30% Percoll, and single cell suspensions of splenocytes and TILs were counted for subsequent flow cytometry staining or ELISpot analysis.

[0086] To identify the antitumor mechanism, we first analyzed the detailed characteristics of tumor-infiltrating lymphocytes (TILs), especially CD4+ T, CD8+ T, NK, dendritic cells (DCs), and macrophages. Figure 7-1 As shown in Part A, the frequencies of CD4+ T cells, NK cells, DC cells, and macrophages in the two CpG gel groups were significantly higher than those in all other groups, indicating that the characteristics of TILs were altered at the population level during in situ therapeutic vaccine injection. In addition, to analyze cytotoxic T cells in the tumor microenvironment (TME), we found that all treatment groups in the INV and mRNA vaccine groups induced a high proportion of CD4+ T cells producing granzyme B (GranzB), but only the CpG gel group in the mRNA vaccine group produced a different subset of GranzB+ CD8+ T cells ( Figure 7-1 In addition, tumor-associated macrophages (TAMs) have been reported to promote tumor growth and metastasis by generating an immunosuppressive TME. The ratio of proinflammatory M1-like TAMs (CD86-CD206+ TAMs) to immunosuppressive M2-like TAMs (CD86+CD206- TAMs) indicated that both STM-shRNA and CpG gel have the potential to repolarize M2-like TAMs ( Figure 7-1 In summary, these therapeutic vaccines can reprogram the tumor immune microenvironment.

[0087] In general, the typical process of initiating an adaptive immune response involves the maturation of antigen-presenting cells (APCs), which phagocytose antigens and subsequently activate T lymphocytes ( Figure 7-1 In the draining lymph nodes (dLN), both the STM-shRNA and CpG gel groups promoted the expression of the co-stimulatory molecule CD86 and high levels of T cell activation ( Figure 7-1 In addition, to verify whether antigen spreading occurs during the killing of RBD-expressing B16F10 cells, RBD MHC-I epitope peptides and mitomycin-treated B16F10 tumor cells without RBD expression were used as different stimuli to restimulate splenocytes ( Figure 7-1 The results showed that both STM-shRNA and CpG gel groups induced a strong Th1 immune response ( Figure 7-2H). Notably, only in the cohort with pre-existing immunity established by INV vaccination, the CpG gel group induced high levels of IL-4 +CD4+ T cells when stimulated with B16F10 cells treated with mitomycin, and the overall number of cytokine-positive T cells targeting B16F10 was higher than that targeting RBD. Consistently, the CpG gel group produced the highest levels of cytokines after restimulation, including IL-4, IL-6, IL-17a, TNF-α, IFN-γ, and GranzB ( Figure 7-2 In addition, we found that the CpG gel group significantly increased the frequency of whole CD4 + memory T cells under two different stimulators ( Figure 7-2 Meanwhile, regardless of the stimulus used, the IFN-γ and IL-4 spots in the CpGgel group were significantly more than those in the other CpG-free groups ( Figure 7-2 Overall, these results highlight that in situ therapeutic vaccines can enhance pre-existing immunity and induce antigen spreading through treatment-mediated tumor destruction, inducing robust memory immune responses against the target antigen RBD and secondary tumor antigens.

[0088] Example 3. Pharmacodynamic evaluation and exploration of tumor vaccines in different mouse models

[0089] Due to the specificity of human leukocyte antigen (HLA) alleles, there are differences in the major histocompatibility complex (MHC) region of individuals. This characteristic limits the prediction and validation of HLA binding peptides to specific individuals, which significantly weakens the universality of the new antigen vaccine. In order to evaluate the universality of the designed vaccine, we further investigated the therapeutic effects of tumor vaccines on various tumor types in Balb / cJGpt mice, which have different tissue compatibility genes from C57BL / 6JGpt mice. Similar to that described in Example 2, the same immunization scheme was used to vaccinate inactivated vaccines (INV) to establish RBD-specific pre-existing immunity. 150 days after the initial immunization, 4×10 5 4T1 or 2×10 5 CT26 cells, and the tumor-bearing mice were injected intratumorally with tumor vaccine or control virus on days 7, 13, and 19 after tumor inoculation. Figure 8-1 (Part A).

[0090] Since the pre-injection of mRNA vaccine in Example 2 did not bring significant therapeutic advantages, we chose to vaccinate INV with a wider coverage to establish SARS-CoV-2-specific pre-existing immunity.

[0091] In the colon and breast cancer animal models, all tumor vaccines were injected starting on day 7 to establish a volume of approximately 100 mm 3 of tumors ( Figure 8-1 In the 4T1 orthotopic breast cancer model, all intervention groups showed strong tumor growth inhibition and significantly longer overall survival than the vector group. The median survival of the STM, STM-shRNA, and CpG gel groups was 36.5, 41, and 47 days, respectively, compared with 32 days in the control empty vector group ( Figure 8-1 Part B, Part C and Figure 8-2 In the D part of the figure, one mouse in the CpG gel group achieved complete remission. In the CT26 ectopic colon cancer model, CpG gel showed a more significant tumor inhibition effect, achieving a complete remission rate of 40% ( Figure 8-3 Part E, Part F and Figure 8-4 (see Section G in the figure).

[0092] Example 4. Exploration of the mechanism of action of universal tumor vaccines

[0093] 1. Improvement of antigen presentation efficiency

[0094] In a 12-well plate, 1 × 10 cells were infected with AAVDJ-shSUSD6 or AAVDJ-shNT at a multiplicity of infection (MOI) of 100,000. 5 B16F10-OVA cells, and the positive control group was treated with SIINFEKL (5 μg / well). After 48 h, the cells were collected, washed once with PBS, and stained with anti-mouse H-2Kb (Anti-Mouse H-2kb-PE, BioLegend) conjugated with SIINFEKL antibody at 4 °C for 45 min. Finally, the cells were washed again and resuspended in PBS for FACS analysis. For the T cell activation assay of B3Z T cell hybridoma co-culture, each group was co-cultured with 2×105 B3Z T cell hybridomas for 24 h. The cells were collected by centrifugation and added with 200 μL CPRG (Macklin, China, #C915817) lysis buffer (1×PBS, containing 9 mmol / L magnesium chloride, 0.2% Triton X-100, 100 mmol / L β-mercaptoethanol and 0.15 mmol / L CPRG). The cells were transferred into a 96-well plate with 150 μL per well and 3 replicate wells per group. The cells were incubated at 37°C in the dark for 72 h and the absorbance at a wavelength of 570 nm was detected using an enzyme reader.

[0095] As a negative regulator of MHC-I, SUSD6 inhibits the expression of antigen-specific pMHC-I and common HLA / MHC-I in human and mouse cell lines. Using a validated shRNA targeting mouse SUSD6, we demonstrated that genetic silencing of SUSD6 promoted MHC class I antigen processing and presentation in B16F10-OVA cells ( Figure 9-1 Part A and Part B). Given the key role of MHC-I or HLA antigen presentation pathways in initiating CD8+ T cell immune responses, we then examined whether SUSD6 inhibition could enhance antigen-specific CD8+ T cell activation. By co-culturing H-2Kb:OVA-specific B3Z CD8+ T cell hybridomas with B16F10 or B16F10-OVA cells infected or not with AAV-shSUSD6, we verified that SUSD6 inhibition in tumor cells could effectively amplify T cell responses by measuring β-galactosidase activity ( Figure 9-1 Part C and Part D).

[0096] 2. Antibody-mediated anti-tumor mechanism based on high-density transmembrane RBD expression

[0097] 2.1 Verification of high-density transmembrane RBD expression

[0098] As essential effector molecules of the immune system, antibodies are making great breakthroughs as tumor biotherapeutics. A large body of evidence shows that antibodies not only play a key role in humoral immune responses, but also have a surprising efficacy in eliminating cancer cells through their Fc domain-mediated effector functions, such as complement-dependent cytotoxicity (CDC), antibody-dependent cellular cytotoxicity (ADCC), and antibody-dependent cellular phagocytosis (ADCP). In addition, different types of effector functions are triggered at different target occupancy levels and antibody densities on the target cell surface, suggesting that high-density membrane antigen expression may fully utilize the above mechanisms to kill tumors. Considering that IgG1 is an important subtype involved in CDC, ADCC, and ADCP, we tested whether the sera of treated mice contained sufficient IgG1 to recognize AAV-infected tumor cells by indirect immunofluorescence detection.

[0099] Specifically: B16F10, 4T1 and CT26 cells were seeded in 8-chamber chambers and infected with AAVDJ-STM HR(MOI100,000) for 48 hours. All samples were fixed with 4% paraformaldehyde (PFA) for 15 minutes at room temperature. The fixed cells were washed three times with pre-cooled PBS. Subsequently, fixed, non-permeabilized B16F10, 4T1, and CT26 cells were incubated with diluted serum from immune mice, and FITC-labeled polyclonal goat anti-mouse IgG1 (upingBio, China, #YPE800094) was added as a secondary antibody, and DAPI was labeled at a dilution of 1:1000.

[0100] The results showed that 1:80 diluted sera from therapeutic vaccine-treated mice produced a strong IgG1-specific signal to recognize infected B16F10, 4T1, and CT26 cells ( Figure 9-2 (Part E).

[0101] 2.2 Antibody-mediated cellular phagocytosis (ADCP)

[0102] Finally, we used CFSE-labeled AAVDJ-STM to infect HR The three tumor cells were used as target cells, and RAW264.7 cells were used as effector cells to evaluate ADCP ( Figure 9-3 F). B16F10, 4T1, and CT26 cells were infected with AAVDJ-STMHR as described above and labeled with 5 μM carboxyfluorescein succinimidyl ester (CFSE) for 20 min at 37°C. 4 CFSE-labeled tumor cells (B16F10, 4T1, or CT26) and 3×10 5 Macrophage Raw 264.7 cells were seeded in wells of a 48-well plate and co-cultured in the presence of 1:80 diluted serum. After culturing at 37°C, 5% CO2 for 36 h, the cells were trypsinized and stained with anti-mouse CD45 PerCp-Cy5.5 antibody for 40 min at 4°C. The washed cells were then analyzed using BD FACSCelesta (BD Biosciences, USA) to calculate the phagocytosis of macrophage Raw 264.7 on tumor cells, with PerCp-Cy5.5 and SSC signals as gates, and FITC-positive cells gated with PerCp-Cy5.5-positive cells represent tumor cells phagocytosed by Raw264.7 cells, and their proportion is defined as the phagocytosis percentage ( Figure 9-2G in the middle). The results showed that the percentage of phagocytosis induced by the 1:80 dilution of vaccine-injected serum was significantly higher than that of other culture medium controls, including PBS-injected serum. Specifically, the phagocytic rates of B16F10 cells, vaccine-injected serum, and PBS-injected serum were 3.75% and 2.76%, respectively; in 4T1 cells, they were 2.56% and 1.78%, respectively; and in CT26 cells, they were 3.05% and 1.65%, respectively, indicating that the promoting effect of antibodies in serum on phagocytosis is applicable to a variety of cell types. In contrast, the culture medium control had a low phagocytic effect similar to that of PBS-injected serum ( Figure 9-3 Together, these findings suggest that in situ therapeutic vaccines can enhance tumor cell elimination by improving antigen presentation and membrane antigen expression.

[0103] In summary, the universal solid tumor vaccine with recombinant adeno-associated virus as a carrier provided by the present invention has achieved unexpected therapeutic effects on a variety of solid tumor models. The present invention screened the recombinant adeno-associated virus serotype and obtained a recombinant adeno-associated virus serotype that infected 100% of various tumor cells such as melanoma cells B16F10, colon cancer cells CT26 and breast cancer cells 4T1. The transmembrane and secretory expression of SARS-CoV-2 antigens in tumor cells was achieved by rationally designing the antigen sequence, so that tumor cells can express SARS-CoV-2 RBD trimers, thereby marking tumor cells, so that tumor cells can be accurately identified by the immune system; and can quickly awaken and strengthen the specific immune response to SARS-CoV-2 that already exists in the body. In addition, the viral vector of the present invention can simultaneously express PD-L1 shRNA and SUSD6 shRNA to silence the tumor cell immune checkpoint PD-L1 and MHC I antigen presentation inhibitory molecule SUSD6 expression, enhance the killing of killer T cells, and reduce the risk of tumor cell escape. At the same time, the present invention will significantly reduce the risk of virus leakage infection through the application of hydrogel dosage forms. Furthermore, the hydrogel combined with an approved adjuvant significantly inhibited tumor growth and prolonged animal survival, especially in the colon cancer model, with a complete remission rate of 40%. The mechanism of action exploration found that the therapeutic vaccine of the present invention can significantly improve the MHC-I antigen presentation of tumor cells, and can effectively utilize antibody-mediated cell killing, such as antibody-mediated cellular phagocytosis (ADCP). In summary, the research results of the present invention show that the therapeutic tumor vaccine designed in the application can significantly pre-existing SARS-CoV-2 RBD-specific immune response, and improve the expression level and presentation efficiency of transmembrane RBD trimers. Among them, the combination of adjuvants and the optimization of dosage forms based on injection excipients achieve the purpose of attenuation and efficacy, and have achieved significant therapeutic effects in a variety of solid tumor models, providing a universal tumor vaccine. In addition, all selected excipients in the vaccine are injectable pharmaceutical excipients, and the selected viral vector is AAV, which is currently widely used in clinical practice, which is beneficial to improve the drugability of tumor vaccines and greatly reduce the risk and cost of clinical transformation.

Claims

1. A polynucleotide expressing a SARS-CoV-2 receptor binding domain, characterized in that: The nucleic acid sequence of the polynucleotide is shown in SEQ ID NO:

1.

2. A protein of SARS-CoV-2 receptor binding domain, characterized in that The sequence of the protein is shown in SEQ ID NO:

2.

3. A viral vector, characterized in that The viral vector comprises a polynucleotide whose sequence is shown in SEQ ID NO: 1, and the viral vector is one or more of a replication-deficient recombinant adeno-associated virus, a recombinant adenovirus and a recombinant herpes simplex virus.

4. The viral vector according to claim 3, characterized in that The viral vector is a replication-deficient recombinant adeno-associated virus, and the serotype of the recombinant adeno-associated virus is a natural serotype or an artificially designed serotype.

5. The viral vector according to claim 4, characterized in that The recombinant adeno-associated virus serotypes include: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV11, AAV12, AAVrh8, AAVrh10, AAVrh74, AAVDJ, AAV7m8, PHP.eB, CAP.B10, and CPP.

16.

6. The viral vector according to claim 5, characterized in that The viral vector also contains a polynucleotide that can express one or more shRNAs targeting immune checkpoints and / or major histocompatibility complex class I molecules MHC-I negative regulatory genes, wherein the immune checkpoint is PD-L1, and the MHC-I negative regulatory gene is SUSD6 or TMEM127.

7. The method for preparing a viral vector according to claim 6, characterized in that: The polynucleotide sequence of the shRNA targeting PD-L1 in the viral vector is shown in SEQ ID NO:3, the polynucleotide sequence of the shRNA targeting SUSD6 in the viral vector is shown in SEQ ID NO:4, and the preparation method of the viral vector comprises the following steps: Step 1, constructing a cis plasmid vector containing the polynucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO: 4; Step 2: Screening serotypes that can efficiently infect tumor cells and constructing corresponding capsid plasmids; Step 3, transfecting the cis plasmid vector described in step 1 and the capsid plasmid described in step 2 into a host cell; Step 4, culturing the host cells described in step 3; Step 5, harvesting the replication-defective recombinant adeno-associated virus released from the host cells described in step 4; Step 6, purifying the replication-defective recombinant adeno-associated virus harvested in step 5 to obtain a recombinant adeno-associated virus; Among them, the host cells described in steps 3 and 4 are VPC 2.0 cells; the purification method described in step 6 is affinity chromatography based on AAVX medium.

8. A hydrogel vaccine preparation, characterized in that: The hydrogel vaccine preparation comprises a viral vector, an adjuvant and a hydrogel matrix, wherein the viral vector is the viral vector according to any one of claims 3 to 6, and the adjuvant is one or a combination of two or more of aluminum hydroxide, aluminum phosphate, AddaVAX, MF59, AS01B, AS01A, AS03, AS04, CpG1018, and Matrix-M.

9. The hydrogel vaccine formulation according to claim 8, characterized in that The adjuvant is CpG1018; the matrix of the hydrogel is any one of poloxamer, hyaluronic acid, calcium alginate and hydrophilic / hydrophobic modifications thereof or a combination of at least two thereof.

10. The hydrogel vaccine formulation according to claim 8 or 9, characterized in that: The hydrogel vaccine preparation is one or more of an intratumor injection hydrogel, an intramuscular injection hydrogel, a percutaneous administration hydrogel, and a cavity administration hydrogel.

11. The method for preparing the hydrogel vaccine formulation according to any one of claims 8 to 10, characterized in that: The method comprises the following steps: Step 1, dissolving the hydrogel matrix poloxamer, CpG1018 and the viral vector according to any one of claims 3 to 6 together; Step 2: Place the hydrogel vaccine preparation obtained in step 1 at 0-8°C.

12. Use of the viral vector according to any one of claims 3 to 6 or the hydrogel vaccine preparation according to any one of claims 8 to 10 in the preparation of drugs for treating melanoma, colon cancer and breast cancer.

Images