A strain of Trichoderma aspergillus TAZ61, microbial agent and application thereof

Abstract

The invention provides a strain of Trichoderma aspergillus TAZ61, a microbial agent and an application thereof. The Trichoderma aspergillus TAZ61 is preserved in the China Center for Type Culture Collection, and its preservation number is CCTCC M 20242342. The active ingredient of the microbial agent includes the above-mentioned Trichoderma aspergillus TAZ61 strain. The Trichoderma aspergillus TAZ61 has a broad-spectrum antibacterial property, has high antibacterial activity against a variety of pathogens, has a fast growth rate, high antibacterial activity, strong heavy parasitism ability, and has good salt-alkali tolerance. It also has a growth-promoting effect on plants, can be used as a biocontrol bacterium and is widely used in the prevention and treatment of a variety of plant disease pathogens such as pine trunk rot, apple rot, apple ring rot, apple anthracnose, wheat stem base rot, tomato wilt, cucumber wilt, tobacco root rot, tobacco black shank disease, Solanaceae crop verticillium wilt, crop white rot, crop sheath blight, etc., and has a good market application prospect in agricultural production.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and in particular to a strain of Trichoderma acanthosporum TAZ61, a microbial agent and applications thereof. Background Art

[0002] Sustained agricultural production and harvest is a decisive factor in my country's food security. However, crops are easily infected by pathogens during their growth and may even suffer from diseases under suitable conditions, causing huge losses to agricultural production. With global warming, the outbreak and spread of crop diseases and insect pests will become more frequent. It is predicted that by the end of this century, the incidence of crop diseases and insect pests will increase by 243-460%. Diseases have become an important limiting factor for stable and high yields of crops.

[0003] In order to effectively prevent and control plant diseases and reduce losses to agricultural production and forestry, many plant disease and insect pest control technology systems have been established. However, in the practice of disease and insect pest control, the application of chemical pesticides still dominates the market, accounting for 80%. In order to promote the green development of agricultural production and reduce the use of chemical pesticides, it is urgent to develop and promote green plant disease and insect pest control technologies. Our country has begun to develop and promote the application of technologies to reduce the use of chemical pesticides and chemical fertilizers in agricultural production.

[0004] Biological control is an important measure for plant disease prevention and control. Biocontrol bacteria can effectively prevent and control plant diseases and insect pests by inducing plant resistance, competition for nutrition and ecological niches, antagonism, parasitism, and bacteriolysis. In addition, biocontrol agents are environmentally friendly, ecologically safe, and harmless to natural enemies. Biocontrol agents prepared using antagonistic bacteria are the best alternative to chemical agents. It can be seen that biological control measures are the development direction and important means of plant disease prevention and control. They have very broad application prospects in agricultural production and are of great significance to ensuring the healthy and sustainable development of agricultural production.

[0005] At present, there are many commercialized biocontrol agents in the world, which have been widely used in the prevention and control of plant diseases such as plant oomycetes, plant fungal diseases, and plant nematode diseases. However, the functions of existing biocontrol agents are relatively single, and their salt-alkali resistance is poor, which limits their practical application. There are few reports on excellent strain resources that have the functions of disease prevention and control, salt-alkali resistance, and plant growth promotion.

[0006] Therefore, the prior art needs to be further improved. Summary of the invention

[0007] In view of the above problems, the present invention provides a strain of Trichoderma aspergillus TAZ61, a microbial agent and an application thereof. The Trichoderma aspergillus TAZ61 has a wide lysis spectrum, high antibacterial activity against a variety of pathogens, good salt-alkali resistance, and a growth-promoting effect on plants. It can be widely used as a biocontrol bacterium in the prevention and treatment of a variety of plant disease pathogens.

[0008] To solve the above problems, this application provides the following technical solutions:

[0009] In the first aspect, the present application provides a strain of Trichoderma spinulosum ( Trichoderma asperellum )TAZ61, its accession number is CCTCC M 20242342.

[0010] The strain was isolated from the rhizosphere soil of grapes at the internship base of Qingdao Agricultural University. Its morphological characteristics are as follows: white circular colonies are formed on PDA plates. As the culture time increases, the colonies gradually turn green, i.e., conidia are produced. The spore-producing cells are phial-shaped, and the conidia are nearly circular or elliptical. The results of its morphological identification and molecular biological identification indicate that the strain is a new strain of Trichoderma spinulosum, which is named TAZ61.

[0011] The strain was deposited in the China Type Culture Collection of Wuhan University on October 25, 2024, and its deposit number is CCTCC M 20242342.

[0012] Experiments have shown that the Trichoderma aspergillus TAZ61 has good antibacterial properties against a variety of plant disease pathogens, exhibits a wide lysis spectrum, and can be widely used in the prevention and control of diseases of a variety of economic crops; in addition, the fungus also has good salt-alkali tolerance and growth-promoting and other multifunctional effects, enriching the multifunctional strain resources of biocontrol bacteria and laying the foundation for the research and development of antagonistic bacterial agents.

[0013] In a second aspect, the present application also provides a microbial agent, which includes the aforementioned Trichoderma aspergillus TAZ61.

[0014] Based on the broad-spectrum antibacterial and growth-promoting properties of Trichoderma aspergillus TAZ61, it can be used as an active ingredient to prepare microbial agents for the prevention and control of various plant diseases.

[0015] In addition, in order to further optimize and improve the bactericidal effect or growth-promoting effect of the microbial agent, the microbial agent also includes other bactericidal active ingredients used in combination (such as other biocontrol bacteria with complementary effects in the bactericidal spectrum, antibacterial active substances, etc.) or existing growth-promoting active ingredients, etc.

[0016] Preferably, in the microbial agent, the active ingredient is the bacterial solution or spores of Trichoderma aspergillus TAZ61. The bacterial solution and spores may also be used in combination.

[0017] In a third aspect, the present application also provides the use of the above-mentioned Trichoderma aspergillus TAZ61 and the aforementioned microbial agent in preventing and controlling plant diseases.

[0018] Optionally, the plant diseases include: pine trunk rot, apple rot, apple ring rot, apple anthracnose, wheat stem base rot, tomato wilt, cucumber wilt, tobacco root rot, tobacco black shank, Solanaceae crop verticillium wilt, crop white rot, crop sheath blight, tobacco black shank, tobacco brown spot, grape root rot, etc.

[0019] In a fourth aspect, the present application also provides the use of the above-mentioned Trichoderma aculeatus TAZ61 and the above-mentioned microbial agent in the inhibition of pathogens, wherein the pathogens include: Fusarium oxysporum of tobacco (FON), Fusarium oxysporum of tomato (FOL), Fusarium solani ( F. solani ), Fusarium spp. F.proliferatum )、Nicotiana tabacum brown spot pathogen ( A. alternate) , Pseudomonas graminearum ( F. pseudograminearum ), Sclerotium uniformum ( S. rolfsii )、Phytophthora nicotianae( P. nicothianae ), Verticillium dahliae ( V. dahliae ) and Diplosporus piniformis ( D. sapinea ).

[0020] Experiments have shown that Trichoderma aspergillus TAZ61 has a good antibacterial effect on the above-mentioned pathogens. This result also shows that Trichoderma aspergillus TAZ61 has a wide lysis spectrum and has a wide range of applications in actual field disease prevention and control.

[0021] In a fifth aspect, the present application also provides the use of the above-mentioned Trichoderma aspergillus TAZ61 and the above-mentioned microbial agent in a saline-alkali environment, which can improve the tolerance of crops to the saline-alkali environment.

[0022] Experiments have shown that Trichoderma aculeatus TAZ61 can grow normally in a culture environment of pH 5-10 and has good alkali resistance. Experiments have also shown that Trichoderma aculeatus TAZ61 grows fast on PDA with 1-2% NaCl, exceeding the growth rate of most soil-borne pathogens. Therefore, this strain has good adaptability to saline-alkali environments and can be used in saline-alkali environments to improve the tolerance of crops to saline-alkali environments.

[0023] In a sixth aspect, the present application also provides the use of the above-mentioned Trichoderma aspergillus TAZ61 and the above-mentioned microbial agent in promoting plant growth.

[0024] The experiment showed that after two weeks of treatment with the conidia of Trichoderma aspergillus TAZ61, the plant height, stem diameter, fresh weight, and dry weight of the cucumber seedlings were significantly higher than those of the control group. Obviously, Trichoderma aspergillus TAZ61 has a significant growth-promoting effect on cucumber seedlings.

[0025] Optionally, the application method is: watering the plant roots with the conidia liquid of Trichoderma aspergillus TAZ61 or making TAZ61 into a biological fertilizer for application.

[0026] Preferably, the spore concentration of the conidia solution is 1-9×10 5 More than pcs / mL.

[0027] The present invention has the following beneficial effects: BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The morphological photos of the TAZ61 strain; A is the colony formed by the strain on the PDA medium, B is the electron microscope image of the spore-forming cells of the strain; C is the conidia of the strain;

[0029] Figure 2 For the multi-gene phylogenetic relationship analysis of TAZ61 strains;

[0030] Figure 3 is the tolerance of the TAZ61 strain to acid, alkali and salt; A is the tolerance of the TAZ61 strain to different pH values, and B is the tolerance of the TAZ61 strain to salt;

[0031] Figure 4 The inhibitory effect of TAZ61 strain on different pathogens; among them, A is tobacco oxysporum Fusarium, B is tomato oxysporum Fusarium, C is solanum Fusarium, D is Fusarium solani, E is tobacco red spot pathogen, F is false graminearum Fusarium, G is Sclerotium uniformis, H is tobacco phytophthora, I is Verticillium dahliae, and J is Diplosporus pinnatifida;

[0032] Figure 5 The TAZ61 strain has a hyperparasitic effect on pathogens; A is a photo of the TAZ61 strain cultured against tomato Fusarium spp. and tobacco Fusarium spp., showing the colonies formed by the three on PDA; B is the colonies of tomato Fusarium spp. and tobacco Fusarium spp. on PDA being completely hyperparasitized by the TAZ61 strain;

[0033] Figure 6 The TAZ61 strain is used to prevent and control wheat stem rot; A: wheat inoculated with Pseudomonas graminearum treated with TAZ61 strain, B: wheat inoculated with Pseudomonas graminearum. DETAILED DESCRIPTION

[0034] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention. In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. The methods in the following embodiments are conventional methods in the art unless otherwise specified.

[0035] Example 1 Isolation and identification of Trichoderma aspergillus strain TAZ61

[0036] 1. Experimental methods

[0037] (1) Isolation of strains

[0038] In August 2022, grape rhizosphere soil was dug from the internship base of Qingdao Agricultural University. 10 g of soil was added to 90 mL of sterile water and vortexed. After standing for 30 min, the supernatant was diluted 1000 times and spread on a PDA (containing streptomycin sulfate) plate and cultured at 25°C to obtain a single colony.

[0039] (2) Identification of Trichoderma aspergillus strain TAZ61

[0040] A. Morphological identification: Inoculate the isolated strain onto a PDA plate and culture at 25°C to observe the morphology and color of the colonies formed, as well as the morphology of the conidia and spore-forming cells produced by the strain.

[0041] B. Molecular identification: The genomic DNA of mycelium was extracted and used as a template to amplify the ITS of the strain by PCR using primers ITS5 and ITS4; RBP2 was amplified using primers RBP2-5F and RBP2-7cR; gene TEF was amplified using primers EF1-728F and TEF1LLErev. Finally, the amplified fragments were sequenced and compared by BLAST, followed by multi-gene phylogenetic analysis using MEGA (X).

[0042] The sequences of primers for ITS amplification are as follows:

[0043] ITS5: GGAAGTAAAAGTCGTAACAAGG (sequence as shown in SEQ ID NO.1); ITS4: TCCTCCGCTTATTGATATGC (sequence as shown in SEQ ID NO.2);

[0044] The amplification primer sequences for RBP2 are as follows:

[0045] RBP2-5F: GAYGAYMGWGATCAYTTYGG (sequence as shown in SEQ ID NO. 3);

[0046] RBP2-7cR: CCCATRGCTTGYTTRCCCAT (sequence shown in SEQ ID NO.4);

[0047] The amplification primer sequences for TEF are as follows:

[0048] EF1-728F: CATCGAGAAGTTCGAGAAGG (sequence as shown in SEQ ID NO.5);

[0049] TEF1LLErev: AACTTGCAGGCAATGTGG (the sequence is shown in SEQ ID NO.6).

[0050] 2. Experimental methods and analysis

[0051] (1) It has been observed that Figure 1 As shown in Figure 2, the isolated strain formed white circular colonies on the PDA plate. As the culture time increased, the colonies gradually turned green, indicating the production of conidia (e.g. Figure 1 A), spore-forming cells are phialoid (e.g. Figure 1 B), conidia are nearly round or oval (e.g. Figure 1 C); The morphological observation results show that the strain is a Trichoderma strain.

[0052] (2) The ITS, RBP2 and TEF gene sequences of the strain are shown in SEQ ID NOs. 7 to 9, respectively. The BLAST comparison results showed that the three gene sequences were similar to those of Trichoderma aspergillus ( Trichoderma asperellum ) were more than 99% identical. Multigene phylogenetic analysis showed that the strain Trichoderma asperellum Gathered in the same branch ( Figure 2 ). The results also proved that this strain was Trichoderma aspergillus, and the strain was named Trichoderma aspergillus TaZ61.

[0053] Example 2 Salt and alkali tolerance test of strain TaZ61

[0054] 1. Experimental methods

[0055] The strain TaZ61 was inoculated on PDA plates with pH 5, pH 6, pH 7, pH 8, pH 9 and pH 10 for culture; in addition, the strain TaZ61 was inoculated on PDA plates with NaCl concentrations of 1%, 2%, 5%, 7.5% and 10%, respectively, cultured at 25°C, and the growth of the colonies was observed.

[0056] 2. Experimental results and analysis

[0057] Figure 3 The results of A showed that the TaZ61 strain grew normally on PDA medium with a pH of 5-10, with almost no difference in growth rate.

[0058] The growth results of the colonies on PDA plates containing NaCl showed that high concentrations of NaCl had an inhibitory effect on the growth of TaZ61, but on PDA containing 2% NaCl, the growth rate of TaZ61 still exceeded that of most soil-borne pathogens (see Table 1 below). On PDA containing 1% NaCl, the growth rate of TaZ61 was even faster (see Table 1 below). Figure 3 B). The above experimental results show that the TaZ61 strain has strong salt and acid-base resistance.

[0059] Table 1 Colony radius of different strains cultured at 25℃ for 60h (2% NaCl)

[0060]

[0061] Example 3 Antibacterial activity of strain TaZ61

[0062] 1. Experimental methods

[0063] Select Fusarium oxysporum of tobacco (FON), Fusarium oxysporum of tomato (FOL), Fusarium solani ( F. solani ), Fusarium spp. F.proliferatum )、Nicotiana tabacum brown spot pathogen ( A. alternate) , Pseudomonas graminearum ( F. pseudograminearum ), Sclerotium uniformum ( S. rolfsii )、Phytophthora nicotianae( P. nicothianae ), Verticillium dahliae ( V. dahliae ) and Diplosporus piniformis ( D. sapinea ) These ten strains were used as pathogens to be tested.

[0064] The above-mentioned pathogens were cultured in confrontation with the TaZ61 strain on PDA culture medium, and the pathogens cultured alone were used as controls. The antibacterial rate of TaZ61 against different pathogen strains was detected by measuring the size of the formed colonies.

[0065] 2. Experimental results and analysis

[0066] The results are as follows Figure 4 As shown in the results, TaZ61 has a strong inhibitory effect on the growth of pathogens such as tobacco oxysporum, tomato oxysporum, solanum fusarium, grape root rot Fusarium, tobacco red star pathogen, false graminearum Fusarium, uniform sclerotium, tobacco phytophthora, dahliae, and pinyon spore. The specific inhibition rate on the growth of different pathogen colonies is shown in Table 2 below.

[0067] Table 2 Inhibitory efficiency of TAZ61 strain on the growth of different pathogens

[0068]

[0069] Example 4: Re-hosting activity of strains

[0070] 1. Experimental methods

[0071] The tobacco oxysporum Fusarium spp. and tomato oxysporum Fusarium spp. were cultured opposite to the TaZ61 strain on PDA medium, and the growth of TaZ61 on the pathogen colonies and the growth and decline of the pathogen colonies were observed.

[0072] 2. Experimental results and analysis

[0073] The results are as follows Figure 5 As shown, the colonies formed by the pathogen have been completely parasitized by TaZ61. This result indicates that Trichoderma aspergillus TaZ61 has a strong parasitic effect on the hyphae of the pathogen.

[0074] Example 5 Growth-promoting effect of Trichoderma aspergillus TaZ61

[0075] 1. Experimental methods

[0076] The cucumber seeds were disinfected and germinated, then potted with sterile soil. When the first true leaf was fully expanded, cucumber seedlings with exactly the same growth trend were selected for the experiment.

[0077] The TaZ61 strain was inoculated on PDA medium and cultured at 25°C for 8 days. The colonies were then washed with YEPD, conidia were collected, and the concentration was adjusted to 10 5 After the concentration of conidia / mL was reached, the cucumber seedlings were irrigated with 50 mL of the conidia solution once as the treatment, and the cucumber seedlings were irrigated with the same amount of YEPD as the control. Twelve cucumber seedlings were one treatment, and each treatment was repeated 3 times. After 2 weeks, the plant height, stem diameter, fresh weight, dry weight and other indicators of the cucumber seedlings were measured.

[0078] 2. Experimental results and analysis

[0079] The results are shown in Table 2. Compared with the control group, the plant height, stem diameter, fresh weight and dry weight of the experimental group treated with TaZ61 conidia liquid irrigation were improved, especially the fresh weight increased by 36.78% and the dry weight increased by 48%. The results proved that the TaZ61 strain has a significant growth-promoting effect on cucumber.

[0080] Table 2 Growth-promoting effect of strain TaZ61 on cucumber

[0081]

[0082] Example 6 Control effect of strains on wheat stem rot

[0083] 1. Experimental methods

[0084] The pot experiment was used to test the control effect of TaZ61 strain on wheat stem rot. 5 Pseudofusomyces graminearum ( F. pseudograminearum ) and then irrigated with 20 mL of liquid YEPD medium as an inoculation control; F. pseudograminearum ) After conidia, the wheat seedlings were watered for 10 5 20 mL of conidia suspension of TaZ61 strain with a concentration of 100 / mL was used as treatment. F. pseudograminearum ) and TaZ61 conidia were made into spore suspensions using YEPD.

[0085] After treatment, the wheat seedlings were cultured at RH95% and 25°C, and the disease status of the wheat seedlings was investigated after 2 weeks.

[0086] 2. Experimental results and analysis

[0087] The experimental results show that TaZ61 has a control effect of up to 88.87% on wheat stem rot. Figure 6 This strain has great application potential in the prevention and treatment of wheat stem rot.

[0088] It is understandable that those skilled in the art can make equivalent substitutions or changes based on the technical solution and concept of the present invention, and all these changes or substitutions should fall within the protection scope of the claims attached to the present invention.

Claims

1. A strain of Trichoderma spinulosum ( Trichoderma asperellum )TAZ61, characterized by: Its accession number is CCTCC M20242342.

2. A microbial agent, characterized in that: It includes the Trichoderma aspergillus TAZ61 described in claim 1.

3. The microbial agent according to claim 2, characterized in that: The active ingredient of the microbial agent is the bacterial liquid or spores of Trichoderma aspergillus TAZ61.

4. Use of the Trichoderma asparagus TAZ61 as claimed in claim 1 and the microbial agent as claimed in claim 2 in preventing and treating wheat stem base rot.

5. Use of Trichoderma aspergillus TAZ61 as claimed in claim 1 and the microbial agent as claimed in claim 2 in inhibiting plant disease pathogens, wherein the pathogens are selected from: Fusarium oxysporum of tobacco ( Fosarium oxysporum f. sp. nicotianae ), Fusarium oxysporum ( Fosarium oxysporum f. sp.lycopersici) and Fusarium solani ( Fusarium solani ), Fusarium spp. Fusariumproliferatum )、Nicotiana tabacum brown spot pathogen ( Alternaria alternate) , Pseudomonas graminearum ( Fusarium pseudograminearum ), Sclerotium uniformum ( Sclerotium rolfsii )、Phytophthora nicotianae( Phytophthora nicothianae ), Verticillium dahliae ( Verticillium dahliae ) and Diplosporus piniformis ( Diplodia sapinea ).

6. Use of the Trichoderma aspergillus TAZ61 as claimed in claim 1 and the microbial agent as claimed in claim 2 in promoting the growth of cucumber.

7. The use according to claim 4 or 6, characterized in that: The application method is: watering the conidia liquid of Trichoderma aspergillus TAZ61 on the roots of plants or making the TAZ61 strain into a biological fertilizer for application.

Images