An engineered Shewanella recombinant bacterium tolerant to low pH and a construction method thereof

Abstract

The invention discloses an engineered Shewanella recombinant bacterium tolerant to low pH value and a construction method thereof, and relates to the technical field of genetic engineering. The engineered Shewanella recombinant bacterium is based on Shewanella ( Shewanella oneidensis )MR-1 is the starting strain, into which the exogenous gene encoding the proton transporter is introduced. The construction method is as follows: S1: obtain the linearized vector pYYDT; S2: connect the exogenous gene fragment with the linearized vector pYYDT using T4 ligase, transfer it into the competent state of Escherichia coli DH5α, select the positive clones for colony PCR and sequencing, and obtain the recombinant plasmid; S3: introduce the recombinant plasmid into the DAP nutritional deficiency strain of Escherichia coli for screening; S4: use the conjugation transfer technology to transfer the recombinant plasmid carried by Escherichia coli to Shewanella ( Shewanella oneidensis )MR-1, and the Shewanella recombinant bacteria are obtained. The modified strain of the present invention is not only suitable for microbial fuel cells, but also can be used to treat highly acidic industrial wastewater, expanding the application field of Shewanella.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to an engineered Shewanella recombinant bacterium tolerant to low pH value and a construction method thereof. Background Art

[0002] Genetic engineering is a technology that modifies biological genetic material to give it new functions or optimize its characteristics. This technology relies on molecular biology tools, such as gene editing, gene insertion and gene knockout techniques, to construct recombinant DNA molecules in vitro, and then transfer the exogenous genes into host cells for replication, transcription and translation to achieve precise regulation of target gene expression. In the field of synthetic biology, this technology is widely used to increase the metabolic product yield of strains and enhance environmental adaptability.

[0003] Shewanella Shewanella oneidensis ) is a facultative anaerobic bacterium with a clear genetic background and is easy to operate. Model electrogenic microorganism-Shewanella odani ( Shewanella oneidensis MR-1 (abbreviated as MR-1, ATCC number: 700550) is the most widely studied strain in the genus Shewanella in terms of genome sequence annotation and genetic characteristics. It has important application value in bioelectrochemical systems (BES) due to its unique transmembrane electron transfer ability. The bacterium can use a variety of terminal electron acceptors for anaerobic respiration, especially in microbial fuel cells (MFC) and pollutant bioreduction. It has shown significant electrochemical activity and has become one of the model organisms for studying how microorganisms generate current in MFC.

[0004] Proton transport proteins are an important class of transmembrane protein complexes that maintain the pH gradient and balance inside and outside the cell by transporting protons. In organisms, proton transport proteins are widely present on cell membranes, using energy (usually from ATP hydrolysis or the electron transport chain) to actively transport protons (H⁺) across the membrane to establish and maintain the proton motive force (PMF). The proton motive force is the core power source that drives a series of key physiological processes such as ATP synthesis, transmembrane transport of substances, and signal transduction.

[0005] With the continuous development of industrialization, the acidity problem of a large number of industrial wastewaters has become increasingly prominent, especially in industrial production processes such as cellulose hydrolysis and organic acid production, where production strains often face acid stress environments. As a bacterium with strong electroactivity, Shewanella is widely used in fields such as biobatteries and wastewater treatment. However, under acid stress conditions, the growth of Shewanella is severely inhibited. The main reason is that the high concentration of protons in the acidic environment can cause an imbalance in the intracellular pH, destroy the cell membrane structure, and ultimately affect its metabolic activity and electrochemical properties. Therefore, improving the acid tolerance of Shewanella has become a key technical challenge to achieve its widespread industrial application.

[0006] Existing strategies to improve microbial acid resistance mainly include modifying cell membrane morphology through genetic engineering, upregulating unsaturated fatty acid genes ( fabA, fabB ) expression level to increase the proportion of unsaturated fatty acids in the cell membrane, thereby reducing the cell membrane fluidity to reduce the influx of protons into the cell. However, these engineering strategies are mainly focused on the study of model organisms such as Escherichia coli, and there are relatively few studies on Shewanella. Moreover, engineering modifications targeting cell membrane fluidity alone cannot enable the strain to tolerate more extreme acid stress environments (pH < 5.5). Considering the potential of Shewanella in industrial applications, there is an urgent need to develop acid resistance modification strategies for Shewanella to improve its survival and functional performance in low pH environments. Summary of the invention

[0007] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an engineered Shewanella recombinant bacterium tolerant to low pH values ​​and a construction method thereof, so as to improve the tolerance of the engineered Shewanella under low pH conditions and enhance its industrial application potential.

[0008] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0009] A recombinant Shewanella bacterium engineered to tolerate low pH is based on Shewanella ( Shewanella oneidensis ) MR-1 is the starting strain, into which an exogenous gene encoding a proton transporter is introduced.

[0010] Furthermore, the exogenous gene is a sequence as shown in SEQ ID NO.1 atpA The gene or sequence is shown in SEQ ID NO.4 MFS Gene;

[0011] The atpA Gene introduction into the starting strain Shewanella ( Shewanella oneidensis ) The recombinant bacteria S1 was obtained from MR-1 and named as ( Shewanella oneidensis)MR-1-atpA, and deposited in Guangdong Microbiological Culture Collection Center on September 23, 2024, with the deposit number GDMCC NO: 65185, and the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou;

[0012] The MFS Gene introduction into the starting strain Shewanella ( Shewanella oneidensis ) The recombinant bacteria S2 was obtained from MR-1 and named as ( Shewanella oneidensis )MR-1-MFS, and was deposited in Guangdong Provincial Microbiological Culture Collection Center on September 23, 2024, with the deposit number GDMCC NO: 65186, and the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0013] The method for constructing the above-mentioned low pH-tolerant engineered Shewanella recombinant bacteria comprises:

[0014] S1: Obtain the linearized vector pYYDT;

[0015] S2: The exogenous gene fragment was connected to the linearized vector pYYDT using T4 ligase, and then transformed into the competent E. coli DH5α. The positive clones were selected for colony PCR and sequencing to obtain the recombinant plasmid.

[0016] S3: Introduce the recombinant plasmid into the DAP auxotrophic strain of Escherichia coli for screening;

[0017] S4: Using conjugation transfer technology, the recombinant plasmid carried by Escherichia coli was transferred to Shewanella ( Shewanella oneidensis )MR-1 to obtain the recombinant Shewanella bacteria.

[0018] Furthermore, in step S3, LB+DAP+Kan plate culture medium is used for screening; the components of the LB+DAP+Kan plate culture medium include: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L NaCl, 50 μg / L Kan, 15 g / L agar powder, and 0.059 g / L DAP.

[0019] Furthermore, in step S1, the pYYDT plasmid is used as a template, primers XhoI linearization-F and XhoI linearization-R are used, and a linearized vector containing XhoI restriction sites at both upstream and downstream ends is obtained by polymerase chain reaction, and the linearized vector is digested with XhoI restriction endonuclease to obtain a linearized vector pYYDT with XhoI site sticky ends.

[0020] Furthermore, codon optimization is required before the exogenous gene fragment is connected to the linearized vector pYYDT.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The present invention can overcome the limitation that the wild-type MR-1 cannot maintain normal growth metabolism and produce electricity in a low pH environment by successfully constructing a recombinant Shewanella engineered bacterium. Through the proton efflux function of the proton transporter, the modified strain is not only suitable for microbial fuel cells, but also can be used to treat highly acidic industrial wastewater, thus expanding the application field of Shewanella. The modified Shewanella exhibits stronger acid resistance and electrochemical performance in industrial applications such as acidic industrial wastewater treatment and microbial fuel cells, significantly improving its adaptability and efficiency under actual industrial conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the pYYDT plasmid map;

[0024] Figure 2 is the plasmid map of the recombinant plasmid P1;

[0025] Figure 3 is the plasmid map of the recombinant plasmid P2;

[0026] Figure 4 The pH gradient of the recombinant bacteria was 4.0, 5.0, 6.0, and 7.0. 600 ;

[0027] Figure 5 D is the recombinant bacteria at pH 5.0-6.0 600 ;

[0028] Figure 6 This is the electrogenic diagram of the recombinant bacteria at pH 5.5;

[0029] Figure 7 This is the electrogenic diagram of the recombinant bacteria at pH 6.0. DETAILED DESCRIPTION

[0030] The present invention is further described below in conjunction with the accompanying drawings and embodiments. The embodiments of the present invention include but are not limited to the following embodiments.

[0031] The present invention aims to introduce exogenous genes encoding proton transporters (F0F1-ATPase, Major Facilitator Superfamily) into Shewanella MR-1 by using heterologous expression technology combined with genetic engineering and other means. atpA, MFS , to construct two transporters, enabling Shewanella to efflux protons through proton transporters in a low pH environment, thereby enhancing the tolerance of the engineered Shewanella under extreme acid stress conditions (pH < 5.5).

[0032] The present invention discloses an engineered Shewanella recombinant bacterium tolerant to low pH value, which is based on the basic plasmid pYYDT, and is connected by enzyme cutting and utilizing the sticky ends left after the XhoI enzyme is treated, and the target gene is connected under the action of T4 ligase. atpA or MFS By connecting to the basic plasmid pYYDT, the recombinant plasmid can be obtained.

[0033] The basic plasmid pYYDT includes the promoter P tac , T7 terminator, and corresponding RBS sequence. Target gene atpA From Escherichia coli Escherichia coli Gene encoding F0F1-ATPase in; target gene MFS Yarrowia lipolytica Yarrowia lipolytica Genes encoding Major Facilitator Superfamily in . atpA or MFS The invention starts the expression of foreign genes through the tac promoter and terminates the transcription of genes through the T7 terminator, thereby ensuring the effective expression of genes in host cells.

[0034] The engineering bacteria for recombinant plasmid amplification is the commonly used Escherichia coli DH5α ( Escherichia coli DH5α is abbreviated as DH5α, ATCC No.: 68273), and the host engineering bacteria is Shewanella MR-1 ( Shewanella oneidensis MR-1 is referred to as MR-1, ATCC No.: 700550). The transformation method of DH5α competent cells can be carried out by conventional methods in the art, such as chemical transformation. The target plasmid in E. coli DH5α is extracted by culturing, and the plasmid is transformed into E. coli In the WM3064 strain, E. coli WM3064 was conjugated with Shewanella MR-1 to obtain an engineered strain, namely a recombinant bacterium.

[0035] Example 1

[0036] (1) Construction of recombinant plasmid P1:

[0037] P1 plasmid atpA The (1605bp) gene fragment was synthesized by the company after codon optimization. atpA -F / atpA -R, synthetic gene atpA As a template, the gene fragment was obtained by polymerase chain reaction atpA , where primer atpA -F contains the XhoI restriction site, and atpAThere is a natural XhoI restriction site downstream of the . Using pYYDT plasmid as a template (pYYDT plasmid map as shown in Figure 1 As shown in the figure), using primers XhoI linearization-F / XhoI linearization-R, polymerase chain reaction was used to obtain a linearized vector containing XhoI restriction sites at both ends, and the linearized vector was digested with XhoI restriction endonuclease to obtain a linearized vector pYYDT with XhoI site sticky ends. atpA The linearized vector pYYDT was connected with T4 ligase and transformed into competent E. coli DH5α. The positive clones were selected for colony PCR and sequencing to obtain the recombinant plasmid P1: pYYDT- atpA The plasmid map of the recombinant plasmid P1 is as follows Figure 2 As shown;

[0038] PCR reaction system configuration: 0.5 μL of upstream and downstream primers, 7.5 μL of 2× Rapid Taq Master Mix, Template, and ddH2O added to 15 μL.

[0039] PCR conditions were as follows: pre-denaturation at 95°C for 10 min, denaturation at 96°C for 15 s, annealing at 56-66°C for 15 s, extension at 72°C for X s (1 kb requires 15-30 s, so time must be sufficient), 30 cycles, and finally extension at 72°C for another 5 min, followed by insulation at 16°C.

[0040] DNA electrophoresis: Large gel (100 mL): 100 mL 1×TAE buffer, 1.0 g agarose, add 10 μL nucleic acid dye after appropriate cooling, shake well and pour into the tank with transparent pad and comb. 60 mL medium gel, 30 mL small gel, add according to the proportion.

[0041] In this embodiment atpA The sequence is shown in SEQ ID NO.1, atpA -F sequence is shown in SEQ ID NO.2, atpA The sequence of -R is shown in SEQ ID NO.3.

[0042] SEQ ID NO.1( atpA Optimized sequence):

[0043]

[0044] SEQ ID NO.2( atpA - F): TAGCATATGCCACTAGAGTACTAGAG

[0045] SEQ ID NO.3( atpA - R): TCACTCGAGATAACGGTTCTGGCAAATATTCTG

[0046] (2) Construction of recombinant Shewanella:

[0047] The recombinant plasmid P1 obtained above was introduced into Escherichia coli DAP auxotrophic strains (abbreviated as E. coli WM3064, NTCC No.: 690048) and named W1. After transformation, LB+DAP+Kan plates (5 g / L yeast extract, 10 g / L tryptone, 10 g / L NaCl, 50 μg / L kanamycin (Kan), 15 g / L agar powder, 0.059 g / LDAP (2,6-diaminopimelic acid)) were used for screening;

[0048] Select the model electrogenic microorganism - Shewanella odani Shewanella oneidensis )MR-1 is the final host bacteria, and the conjugation transfer technique is used to transfer E. coli The recombinant plasmid P1 carried by the WM3064 strain was transferred into MR-1 to obtain the target engineered bacteria. The wild-type strain introduced with the basic plasmid (PYYDT) was named WT as a blank control, and the recombinant bacteria S1 was obtained after the recombinant plasmid P1 was introduced into the engineered strain of MR-1.

[0049] The recombinant strain S1 was named Shewanella oneidensis MR-1-atpA, and was deposited in the Guangdong Provincial Microbiological Culture Collection Center on September 23, 2024, with the deposit number GDMCC NO: 65185, and the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0050] Example 2

[0051] (1) Construction of recombinant plasmid P2: MFS The (1410bp) gene fragment was synthesized by the company after codon optimization. MFS -F / MFS -R, synthetic gene MFS As a template, the gene fragment was obtained by polymerase chain reaction MFS , where primer MFS -F contains the XhoI restriction site, and MFSThere is a natural XhoI restriction site downstream of the pYYDT plasmid. Using the pYYDT plasmid as a template, primers XhoI linearization-F and XhoI linearization-R were used to obtain a linearized vector containing XhoI restriction sites at both ends of the upstream and downstream by polymerase chain reaction. The linearized vector was digested with XhoI restriction endonuclease to obtain a linearized vector pYYDT with XhoI site sticky ends. MFS The linearized vector pYYDT was connected with T4 ligase and transformed into competent E. coli DH5α. The positive clones were selected for colony PCR and sequencing to obtain the recombinant plasmid P2: pYYDT- MFS The plasmid map of the recombinant plasmid P2 is as follows Figure 3 shown.

[0052] In the embodiment MFS The sequence is shown in SEQ ID NO.4, MFS -F sequence is shown in SEQ ID NO.5, MFS The sequence of -R is shown in SEQ ID NO.6.

[0053] SEQ ID NO.4( MFS Optimized sequence):

[0054]

[0055] SEQ ID NO.5( MFS -F):TCACTCGAGATAACGGTTCTGGCAAATATTCTG

[0056] SEQ ID NO.6( MFS -R):CTTTCGTTTTATTTGATGCCTGGC

[0057] (2) Construction of recombinant Shewanella:

[0058] The recombinant plasmid P2 obtained above was introduced into Escherichia coli DAP auxotrophic strains (abbreviated as E. coli WM3064, NTCC No.: 690048) and named W2. After transformation, LB+DAP+Kan plates (5 g / L yeast extract, 10 g / L tryptone, 10 g / L NaCl, 50 μg / L kanamycin (Kan), 15 g / L agar powder, 0.059 g / LDAP (2,6-diaminopimelic acid)) were used for screening;

[0059] Select the model electrogenic microorganism - Shewanella odani Shewanella oneidensis )MR-1 is the final host bacteria, and the conjugation transfer technique is used to transfer E. coli The recombinant plasmid P2 carried by the WM3064 strain was transferred into MR-1 to obtain the target engineered bacteria. The wild-type strain into which the basic plasmid (PYYDT) was introduced was named WT as a blank control, and the recombinant bacteria obtained by introducing the recombinant plasmid P2 into the engineered strain of MR-1 was named S2.

[0060] The recombinant strain S2 was named Shewanella oneidensis MR-1-MFS, and was deposited in the Guangdong Provincial Microbiological Culture Collection Center on September 23, 2024, with the deposit number GDMCC NO: 65186, and the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0061] The following tests were performed on the recombinant bacteria constructed in Example 1 and Example 2:

[0062] 1. Determine the minimum tolerance pH of recombinant bacteria S1 and S2. The specific method is as follows:

[0063] Streak the recombinant bacteria S1 and S2 strains on LB+Kan plates and place them in a 30°C incubator for overnight culture. Pick a single clone on the plate and inoculate it into 3 mL LB+Kan liquid medium (10 mL tube). Cultivate for 16 hours at 30°C, 220 rpm in a shaker to ensure that the strain enters the stable phase. Place 100 mL of shake flask LB medium in a 250 mL shake flask, adjust the pH gradient to 4.0, 5.0, 6.0, and 7.0 with 1M HCl solution, add 100 μL of kanamycin stock solution, and incubate the bacterial solution at OD 600 =1, 1% inoculation ratio, shaker at 30℃, 220 rpm. After 4 hours, add 10 μΜ IPTG for induction. After 16 hours, take 100 μl of bacterial solution, dilute 10 times, and use UV spectrophotometer to measure the OD of the diluted bacterial solution. 600 The OD values ​​of the culture medium were measured at 2h, 4h, 6h, 8h, 10h, and 12h. 600 The test results are as follows: Figure 4 As shown in the figure, it was found that the strain did not grow significantly at pH 4.0 and 5.0, but grew well at pH 6.0, indicating that the recombinant bacteria tolerated a pH range of 5.0-6.0. Subsequently, this range was further divided into four gradients of pH 5.2, 5.4, 5.6, and 5.8 to explore the lowest pH that the recombinant bacteria could tolerate. The test results are shown in the figure. Figure 5 As shown, the growth of the strain was significantly improved at pH 5.4, which was the lowest tolerable pH of the recombinant bacteria.

[0064] Two recombinant Shewanella strains were constructed by genetic engineering, and the proton transporter-related genes were atpA , MFS Shewanella MR-1 was introduced separately, so that the engineered Shewanella could grow to a biomass (OD 600 ) S1 reached 0.42; S2 reached 0.43, which were 3.8 times and 3.9 times higher than WT respectively.

[0065] 2. The power generation capacity of recombinant bacteria S1 and S2 was verified by battery in M9 culture medium at pH 5.5 and pH 6.0:

[0066] In a sterile clean bench, three recombinant Shewanella engineered bacteria WT, S1, and S2 were selected and inoculated into 10 mL centrifuge tubes containing 3 mL LB+Kana liquid medium, and cultured in a shaking incubator at 30°C, 200 rpm, and 16 h. Take 250 mL conical flasks containing 100 mL LB liquid medium, take out 1 mL of the first-level bacterial solution of the three recombinant Shewanella engineered bacteria, and inoculate 1% into three similar conical flasks (if the bacterial solution is insufficient, two conical flasks of the same type can be prepared for each strain, and 200 mL of the second-level bacterial solution can be prepared), add 100 μl IPTG (1:2000) to each flask, add 100 μl Kana (1:1000), adjust the pH to pH6.0 with 1M HCl solution to pre-adapt the recombinant Shewanella to the weak acid stress environment, and culture in a shaking incubator at 30°C, 200 rpm, and 16 h. After the microbial battery is assembled, it is placed in the 30°C incubator of the Chenhua CHI1000C electrochemical workstation and connected to the data acquisition card for voltage data collection. Wait for the battery to start, and scan the LSV curve after the voltage stabilizes to obtain data to calculate the battery power density.

[0067] Cell setup and reagent preparation:

[0068] (1) Battery device: battery bottle, lid, gasket*2, clamp, carbon cloth, plug (these 7 items need to be sterilized at high temperature and high pressure: 121℃, 20min), proton exchange membrane (sterilized by soaking in 1M HCl solution and irradiating with UV light in a clean bench overnight, assembled in a clean bench), resistor, etc. (the battery is a typical 100mL glass dual-chamber microbial fuel cell).

[0069] (2) Reagent preparation: cathode solution, anode solution, 5*M9, ddH2O, 300mM xylose solution, etc.

[0070] 1. Carbon cloth treatment: anode 1×1cm, cathode 2.5×3cm, soak in 1M HCl for 8-12h, rinse three times with deionized water, soak in acetone overnight, rinse with ddH2O, and dry in an oven.

[0071] 2. Proton exchange membrane: soak in 1M HCl for 8-12 hours, sterilize with UV light overnight, and rinse three times with ddH2O.

[0072] 3. Anolyte (1L): 200mL 5*M9, 500mL 300mM xylose solution, 1mL 1M MgSO4•7H2O, 1mL0.1M CaCl2, Kana (1:1000), make up to 1L with ddH2O, and adjust to pH 5.5 and pH 6.0 with 1M HCl solution.

[0073] 4. Cathodic liquid (1L): 16.45g K[Fe(CN)3], 6.8g KH2PO3, 11.4g K2HPO3.

[0074] 5. 1M HCl solution (1 L): Add 83 mL of 37% HCl solution to make up to 1 L and store at room temperature (place in a fume hood).

[0075] 6. 1M sodium lactate solution (100 mL): 18.68 g of 60% sodium lactate solution, dilute to 100 mL with ddH20, cool to room temperature after sterilization, and store in a refrigerator at 4°C.

[0076] 7. 1M MgSO4 solution (100mL): 24.65g MgSO4•7H2O, dilute to 100mL with ddH20, cool to room temperature after sterilization, and store in a refrigerator at 4℃.

[0077] 8. 0.1M CaCl2 solution (100mL): 1.109g CaCl2, dilute to 100mL with ddH20, cool to room temperature after sterilization, and store in a refrigerator at 4℃.

[0078] 9. 5*M9 mother solution (1L): 2.5 g NaCl, 5 g NH4Cl, 15 g KH2PO4, 30 g Na2HPO4, sterilize.

[0079] 10. 4M NaOH solution (100 mL): Dissolve 16 g of NaOH solid and make up to 100 mL. Sterilize with a 0.22 μm filter membrane.

[0080] 11. Kanamycin stock solution (50 mg / mL): 0.5 g Kana powder, dilute to 10 mL with ddH2O, sterilize with 0.22 μm filter membrane, aliquot into 1 mL / tube, and store at -20℃.

[0081] 12. IPTG mother solution (1M): 1.9064 g IPTG, dilute to 8 mL with ddH2O, sterilize with 0.22 μm filter membrane, divide into 100 μL / tube and 200 μL / tube, and store at -20℃.

[0082] The above solutions were sterilized in a high-temperature and high-pressure sterilizer at 115°C for 15 min and stored at 4°C for later use; a sufficient amount of 5*M9 solution was prepared, sterilized by high-pressure steam (121°C, 20 min), cooled and stored at 4°C for later use.

[0083] Test results such as Figure 6 and Figure 7The results show that the strain has good power generation performance. Under laboratory conditions, it can achieve a power density S1 of 287mW / m at pH 5.5 when inoculated into the anode chamber of MFC. 2 , reaching 351mW / m at pH 6.0 2 ; S2 reached 193mW / m at pH 5.5 2 , reaching 336mW / m at pH 6.0 2 The power generation capacity of S1 at pH 5.5 was about 3.5 times that of the control group WT (80 mW / m 2 ), the power generation capacity at pH 6.0 was about 3.6 times that of the control group WT (97 mW / m 2 The power generation capacity of S2 at pH 5.5 was about 2.4 times that of the control group WT (80 mW / m 2 ), the power generation capacity at pH 6.0 was about 3.4 times that of the control group WT (97 mW / m 2 ).

[0084] The present invention can overcome the limitation that the wild-type MR-1 cannot maintain normal growth metabolism and produce electricity in a low pH environment by successfully constructing a recombinant Shewanella engineered bacterium. Through the proton efflux function of the proton transporter, the modified strain is not only suitable for microbial fuel cells, but also can be used to treat highly acidic industrial wastewater, thus expanding the application field of Shewanella. The modified Shewanella exhibits stronger acid resistance and electrochemical performance in industrial applications such as acidic industrial wastewater treatment and microbial fuel cells, significantly improving its adaptability and efficiency under actual industrial conditions.

[0085] The above embodiment is only one of the preferred implementation modes of the present invention and should not be used to limit the protection scope of the present invention. Any changes or modifications that are made to the main design concept and spirit of the present invention and have no substantive significance, and the technical problems they solve are still consistent with the present invention, should be included in the protection scope of the present invention.

Claims

1. An engineered recombinant Shewanella bacterium tolerant to low pH, characterized in that: Shewanella Shewanella oneidensis ) MR-1 is the starting strain, into which an exogenous gene encoding a proton transporter is introduced; the exogenous gene is a sequence shown in SEQ ID NO.1 atpA The gene or sequence is shown in SEQ ID NO.4 MFS Gene; The atpA Gene introduction into the starting strain Shewanella ( Shewanella oneidensis ) The recombinant bacteria S1 was obtained from MR-1 and named Shewanella ( Shewanella oneidensis )MR-1-atpA, and deposited in Guangdong Microbiological Culture Collection Center on September 23, 2024, with the deposit number GDMCC NO: 65185, and the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou; The MFS Gene introduction into the starting strain Shewanella ( Shewanella oneidensis ) The recombinant bacteria S2 was obtained from MR-1 and named Shewanella ( Shewanella oneidensis )MR-1-MFS, and was deposited in Guangdong Provincial Microbiological Culture Collection Center on September 23, 2024, with the deposit number GDMCC NO: 65186, and the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

Images