A method for promoting ripening of tomato fruits

Abstract

The present application relates to the field of biotechnology, and more particularly to the application of tomato SlWRKY39 and SlWRKY40 in regulating tomato fruit ripening. The present application discloses a method for promoting tomato fruit ripening, which comprises simultaneously knocking out SlWRRY39 and SlWRKY40 genes to promote the ripening of tomato fruits. The present application also simultaneously provides a gene editing vector for realizing the promotion of tomato fruit ripening, which is pCAMBIA1300-pYAO:Cas9-(SlWRKY39+SlWRKY40). It is found through fruit phenotype observation and average ripening time statistics that the simultaneous knockout of SlWRKY39 and SlWRKY40 promotes the ripening of tomato fruits.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the application of tomato SlWRKY39 and SlWRKY40 in regulating tomato fruit ripening. Background Technology

[0002] Tomatoes are one of the world's most important vegetable crops, beloved by growers and consumers alike for their wide adaptability, unique flavor, sweet and sour taste, rich nutrition, and high economic value. Fruit ripening is a crucial period for the formation and accumulation of tomato flavor and nutrients, influencing not only quality and post-harvest storage time but also market availability and commercial value. Therefore, researching the regulatory mechanisms of tomato fruit ripening is not only a prerequisite for breeding new tomato varieties with different ripening times and improving tomato quality but also fundamental for developing post-harvest storage and preservation technologies, holding significant importance for the tomato industry.

[0003] Fruit ripening is a highly programmed and complex biological process, influenced by external factors such as temperature, light, and water, as well as by internal factors such as plant hormones, transcription factors, epigenetic modifications, and microRNAs. Transcription factors, which specifically bind to specific gene sequences to ensure the expression of target genes at specific intensities, times, and spaces, play a crucial role in fruit ripening regulation (Wang et al., 2014). Bioinformatics predictions indicate at least 62 transcription factor families exist in tomatoes, among which WRKY is a plant-specific family named for its conserved sequence of seven amino acids, WRKYGQK. Studies have shown that many WRKY transcription factors are involved in the regulation of tomato fruit ripening. For example, Zhang et al. (2024) found that phosphorylation of SlWRKY6 promotes transcriptional activation of downstream genes SlSGR1 and SlSAG12, thereby promoting tomato fruit ripening; Shang et al. (2024) found that SlWRKY80 promotes tomato ripening and fruit coloring by recruiting HDA1; Yu et al. (2023) constructed tomato fruits with silenced SlWRKY53b gene using VIGS and found that the tomato fruit color-breaking period was delayed and fruit ripening was delayed. The expression levels of SlWRKY31 and SlWRKY23 genes were upregulated during the color-breaking and red-ripe stages of the fruit. After inhibiting the expression of SlWRKY16, SlWRKY17, SlWRKY53 and SlWRKY54 genes using the VIGS method, the reddening process of tomato fruit was delayed.

[0004] SlWRKY39 (Solyc03g116890.2.1) is a type IIa transcription factor in the tomato WRKY transcription factor family. It contains one WRKY domain and has a zinc finger structure of the Cys(2)-His(2) type, which is highly homologous to AtWRKY40 in Arabidopsis thaliana. Studies have shown that SlWRKY39 is involved in the resistance of tomatoes to the pathogen *Pseudomonas syringae*, salt stress, and drought stress (Sun et al., 2015).

[0005] SlWRKY40 (Solyc06g068460.2.1) is a homolog of SlWRKY39. It has been found that it can participate in the regulation of lycopene synthesis in tomato fruit (Zhejiang University, 2022) and can be induced by drought, salt, pathogens, elicitors and viruses (Huang et al., 2017).

[0006] The aforementioned functions of SlWRKY39 and SlWRKY40 are not related to the regulation of tomato fruit ripening.

[0007] It should be noted that: SlWRKY31 is a class I WRKY transcription factor; SlWRKY6(IIb), SlWRKY16(IIb), and SlWRKY17(IIb) belong to class IIb WRKY transcription factors; SlWRKY23(IIc) belongs to class IIc WRKY transcription factors; and SlWRKY80(III), SlWRKY53b(III), SlWRKY53(III), and SlWRKY54(III) belong to class III WRKY transcription factors. SlWRKY39 and SlWRKY40 belong to class IIe WRKY transcription factors, which differ from the above-mentioned WRKY transcription factors in protein structure and function.

[0008] The references mentioned above are as follows:

[0009] Huang S, Gao Y, Liu J, Peng X, Niu

[0010] Shang C,Chen G,Liu X,Zheng H,Li G,Wang J,Hu S,Li Z,Hu X.SlWRKY80recruits SlHDA1 to regulates the tomato fruit ripening and colortransformation.BioRxiv.2024.doi:https: / / doi.org / 10.1101 / 2024.01.31.578225.

[0011] Sun X, Gao Y, Li H, Yang S, Liu Y. Over-expression of SlWRKY39 leads to enhanced resistance to multiple stress factors in tomato. Journal of PlantBiology. 2015.58:52-60.

[0012] Zhang M, Hu K, Ma L, Geng M, Zhang C, Yao G, Zhang H. Persulfidation and phosphorylation of transcription factor SlWRKY6 differentially regulate tomato fruit ripening. Plant Physiology. 2024.196(1):210–227.

[0013] Wang Ying, Kong Junhua, Chen Weiwei, Zhou Ting, Lai Tongfei. Research progress on transcription factors related to tomato fruit ripening [J]. Journal of Horticulture, 2014, 41(9): 811-1820.

[0014] Yu Yue, Wang Siyue, Guo Wentong, Yao Gaifang, Zhang Hua, Hu Kangdi. VIGS silencing of the SlWRKY53b gene inhibits tomato fruit ripening [J]. Chinese Journal of Biochemistry and Molecular Biology, 2023(11): 1598-1605.

[0015] Zhejiang University. A gene that increases lycopene content in tomato fruit and its application: CN116200421B[P]. 2022-12-06. Summary of the Invention

[0016] The technical problem to be solved by this invention is to provide the use of the SlWRKY39 and SlWRKY40 genes for regulating tomato fruit ripening.

[0017] To address the above problems, this invention provides a method for promoting tomato fruit ripening: simultaneously knocking out the SlWRRY39 and SlWRKY40 genes can promote tomato fruit ripening.

[0018] The nucleotide sequence of the SlWRRY39 gene is shown in SEQ ID No:1, and the nucleotide sequence of the SlWRRY40 gene is shown in SEQ ID No:2.

[0019] That is, this invention provides the application of the SlWRKY39 and SlWRKY40 genes in regulating tomato fruit ripening.

[0020] In this invention: the protein encoded by the SlWRKY39 gene has the amino acid sequence shown in SEQ ID NO: 3, and the protein encoded by the SlWRKY40 gene has the amino acid sequence shown in SEQ ID NO: 4.

[0021] This invention also provides a gene editing vector for promoting tomato fruit ripening: pCAMBIA1300-pYAO:Cas9-(SlWRKY39+SlWRKY40).

[0022] This invention also provides a method for constructing the above-mentioned gene editing vector, comprising the following steps:

[0023] (1) Target design:

[0024] The target sequence of SlWRKY39 is 5'AATTCATCGGAAACTCGAAG 3'.

[0025] The target sequence of SlWRKY40 is 5'TGGTGGTGAAAAATGAGGCA 3';

[0026] (2) Construction of double gRNA cassette:

[0027] First, we obtained the recombinant vector AtU6-26-sgRNA-SK-SlWRKY39 containing the target SlWRKY39 and the recombinant vector AtU6-26-sgRNA-SK-SlWRKY40 containing the target SlWRKY40.

[0028] Then, the recombinant vector AtU6-26-sgRNA-SK-(SlWRKY39+SlWRKY40) containing both SlWRKY39 and SlWRKY40 gRNA cassettes was obtained.

[0029] The recombinant vector AtU6-26-sgRNA-SK-(SlWRKY39+SlWRKY40) was then digested with Nhe I and Spe I to obtain a double gRNA cassette containing both SlWRKY39 and SlWRKY40 gRNA cassettes.

[0030] (3) Construction of binary carrier:

[0031] The pCAMBIA1300-pYAO:Cas9 plasmid was digested with SpeI and ligated into a double gRNA cassette to obtain pCAMBIA1300-pYAO:Cas9-(SlWRKY39+SlWRKY40).

[0032] As an improvement to the method for constructing the gene editing vector of the present invention, in step (1):

[0033] SlWRKY39 target primer: 5' ATTG AATTCATCG GAAACTCGAAG 3' (ATTG is the connector sequence) and 5' AAAC CTTCGAGTTTCCGATGAATT 3' (AAAC is the connector sequence);

[0034] SlWRKY40 target primer: 5' ATTG TGGTGGTGAAAAATGAGGCA 3' (ATTG is the connector sequence) and 5' AAAC TGCCTCATT TTTCACCACCA 3' (AAAC is the connector sequence).

[0035] The present invention also provides double gene knockout mutants of SlWRRY39 and SlWRKY40: slwrky39slwrky40-1 and slwrky39slwrky40-2, respectively.

[0036] The CDS sequence of the SlWRKY39 gene in slwrky39slwrky40-1 is shown in SEQ ID No:5, and the CDS sequence of the SlWRKY40 gene is shown in SEQ ID No:6.

[0037] The CDS sequence of the SlWRKY39 gene in slwrky39slwrky40-2 is shown in SEQ ID No:5, and the CDS sequence of the SlWRKY40 gene is shown in SEQ ID No:7.

[0038] This invention also provides the application of tomato SlWRKY39 and SlWRKY40 in regulating tomato fruit ripening.

[0039] As an improvement to the application of this invention: simultaneously knocking out the SlWRRY39 and SlWRKY40 genes promotes the ripening of tomato fruits;

[0040] The nucleotide sequence of the SlWRRY39 gene is shown in SEQ ID No:1, and the nucleotide sequence of the SlWRRY40 gene is shown in SEQ ID No:2.

[0041] The present invention also provides a host cell containing the above-mentioned genes, wherein the host cell is an Escherichia coli cell or an Agrobacterium cell.

[0042] This invention is the first to construct a tomato with both SlWRKY39 and SlWRKY40 knockout genes and conduct functional studies. Through fruit phenotypic observation and average ripening time statistics, it was found that simultaneous knockout of SlWRKY39 and SlWRKY40 promotes tomato fruit ripening. Attached Figure Description

[0043] The specific embodiments of the present invention will be further described in detail below with reference to the figures.

[0044] Figure 1 This is the vector map of AtU6-26-sgRNA-SK.

[0045] Figure 2 This is the spectrum of the pCAMBIA1300-pYAO:Cas9 vector.

[0046] Figure 3 This is the spectrum of the pCAMBIA1300-pYAO:Cas9-(SlWRKY39+SlWRKY40) vector.

[0047] Figure 4 It is a double mutant genotype of slwrky39slwrky40;

[0048] Figure 4 middle:

[0049] The top image shows the genotypes of SlWRKY40 in the wild-type material, slwrky39slwrky40-1, and slwrky39slwrky40-2. The bottom image shows the genotypes of SlWRKY39 in the wild-type material, slwrky39slwrky40-1, and slwrky39slwrky40-2.

[0050] Figure 5 The ripening process of the fruits of the slwrky39slwrky40 double mutant and the control is shown.

[0051] Figure 6 The average ripening time of the slwrky39slwrky40 double mutant and the control is the time from flowering to fruit color breaking. **** indicates that there is a significant difference between the transgenic lines and the control (p<0.0001).

[0052] Figure 7 It is the CDS sequence of the SlWRKY39 gene.

[0053] Figure 8 It is the CDS sequence of the SlWRKY40 gene in slwrky39slwrky40-1.

[0054] Figure 9 It is the CDS sequence of the SlWRKY40 gene of slwrky39slwrky40-2. Detailed Implementation

[0055] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto. I. Construction of gene editing vector pCAMBIA1300-pYAO:Cas9-(SlWRKY39+SlWRKY40) 1. Target design

[0056] Target sites were searched in the CDS region of SlWRKY40 and SlWRKY39 using the online search software http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR. Based on criteria such as high software score, good specificity, and proximity to the transcription start site (ATG), the most suitable target primers were determined, and primer adapters were added to their 5' ends. Specific information is as follows: The target sequence for SlWRKY39 is 5'AATTCATCGGAAACTCGAAG 3', and the target primers for SlWRKY39 are 5'... ATTG AATTCATCGGAAACTCGAAG 3' (ATTG is the connector sequence) and 5' AAAC CTTCGAGTT TCCGATGAATT 3' (AAAC is the linker sequence). The target sequence of SlWRKY40 is 5'TGGTGGTG AAAAATGAGGCA 3', and the target primers for SlWRKY40 are 5'... ATTG TGGTGGTGAAAAATGAGGCA 3' (ATTG is the connector sequence) and 5' AAAC TGCCTCATTTTTCACCACCA3' (AAAC is the connector sequence).

[0057] 2. Construction of binary carriers

[0058] 2.1 Target primer annealing

[0059] Dissolve the target primers to a final concentration of 1 μM, heat them in a PCR instrument at 98 °C for 3 min, remove them immediately, and allow them to cool naturally to room temperature to obtain annealed target primers, which are then used for ligation.

[0060] 2.2 Construction of double gRNA cassette

[0061] First, take 1 μg of AtU6-26-sgRNA-SK plasmid (see...) Figure 1 The AtU6-26-sgRNA-SK vector was digested with BsaI-HF at 37°C for 60 min in a 50 μL system and purified using a DNA purification kit. The 50 μL system consisted of: 1 μg plasmid, 2 μL restriction enzyme, 5 μL 10× buffer, and ddH2O to a final volume of 50 μL. Next, the annealed target primer and the digested AtU6-26-sgRNA-SK vector were ligated in a 10 μL reaction system: 1 μL 10×T4 DNA Ligase buffer, 40 ng digested vector, 1 μL annealing primer, 40 U T4 DNA ligase, and ddH2O to a final volume of 10 μL. The reaction system was incubated at room temperature for 30 min to obtain the ligation product.

[0062] Subsequently, 10 μL of the ligation product was transformed into *E. coli*, plated on LB agar containing ampicillin (50 mg / mL), and incubated at 37°C for 10–12 h. Single colonies were picked for colony PCR and sequencing to confirm whether the target site was ligated into the vector. The primer sequence for colony PCR was 5'CTCACTATAGGGCGAATTGG 3', and the primer for the target site was used. The PCR fragment length was 499 bp.

[0063] When the target primer is the SlWRKY39 target primer, a recombinant vector containing the SlWRKY39 target is obtained and named AtU6-26-sgRNA-SK-SlWRKY39.

[0064] When the target primer is SlWRKY40, a recombinant vector containing the SlWRKY40 target is obtained and named AtU6-26-sgRNA-SK-SlWRKY40.

[0065] AtU6-26-sgRNA-SK-SlWRKY39 was digested with Spe I to form a vector. AtU6-26-sgRNA-SK-SlWRKY40 was double-digested with Nhe I and Spe I. The recovered fragments were ligated with the Spe I-digested vector using T4 DNA ligase to form a recombinant vector containing both SlWRKY39 and SlWRKY40 gRNA cassettes, named AtU6-26-sgRNA-SK-(SlWRKY39+SlWRKY40). The recombinant vector was double-digested with Nhe I and Spe I. After electrophoresis, a fragment of approximately 1280 bp was excised and recovered from the gel. The recovered fragment is the double gRNA cassette containing both SlWRKY39 and SlWRKY40 gRNA cassettes.

[0066] 2.3 Construction of binary carrier

[0067] First, in a 50 μL system, the pCAMBIA1300-pYAO:Cas9 plasmid (see [link to product]) was added using Spe I at 37℃. Figure 2 The vector was digested with enzymes for 30 min and then inactivated at 80℃ for 20 min. 0.2 μL of alkaline phosphatase was added to the system and reacted at 37℃ for 10 min to dephosphorylate the vector to prevent self-ligation, thus obtaining the digested vector.

[0068] Next, the digested vector was ligated with the double gRNA cassette obtained in step 2.2. The reaction mixture (10 μL) was as follows: 1 μL of 10×T4 DNA Ligase buffer, 40 ng of the digested vector, 20 ng of the double gRNA cassette, 40 U of T4 DNA ligase, and ddH2O to a final volume of 10 μL. The reaction mixture was incubated at room temperature for 30 min to obtain the ligation product.

[0069] The ligation product was then transformed into *E. coli* and plated on LB agar containing 50 mg / mL kanamycin sulfate. Colony PCR was performed using the primer sequences (primers 1300-gRNA-F and 1300-gRNA-R) on the binary vector. Correctly identified single clones (PCR length approximately 1400 bp) were selected and amplified. Plasmids were extracted and verified by restriction enzyme digestion with Sal I and Kpn I. The digested fragment was approximately 1300 bp. The final expression vector was named pCAMBIA1300-pYAO:Cas9-(SlWRKY39+SlWRKY40) (see...). Figure 3 ).

[0070] The correctly identified plasmid was transformed into Agrobacterium and used to infect plants. The primers for colony PCR identification were located at both ends of the Spe I restriction site, and the primer sequences are as follows: 1300-gRNA-F: 5'CCAGTCACGACGTTGTAAAAC 3'; 1300-gRNA-R: 5'CAATGAATTTCC CATCGTCGAG 3'. The PCR fragment length is approximately 1400 bp.

[0071] II. Creation of the slwrky39slwrky40 double mutant

[0072] The gene-editing vector pCAMBIA1300-pYAO:Cas9-(SlWRKY39+SlWRKY40) containing the targets SlWRKY39 and SlWRKY40 was transformed into Agrobacterium LBA4404 strain. Wild-type tomato Alisa Craig was used as explants for genetic transformation, following the procedure described by Shao et al. (2020). Hygromycin was used for resistance selection to obtain positive seedlings. Genomic DNA was extracted from the T0 generation plants using the CTAB method. The constructed plasmid was used as a positive control, and wild-type tomato DNA was used as a negative control. PCR amplification was performed using 1300-gRNA-F and 1300-gRNA-R primers to determine the amplification status of the exogenous gene. Subsequently, specific amplification primers were designed upstream and downstream of the target sites of SlWRKY39 and SlWRKY40, respectively. Using the genome as a template, DNA fragments covering the target regions were obtained by PCR amplification and sent to the company for sequencing. The gene editing status at the target sites was determined by analyzing sequencing results using http: / / shinyapps.datacurators.nl / tide / and DSDecodeM (http: / / skl.scau.edu.cn / dsdecode / ) (Xie et al., 2017). Through self-pollination purification, PCR detection, and target site sequencing analysis, homozygous lines without exogenous DNA insertion and with both target sites edited were screened; these were designated as the slwrky39slwrky40 double mutants (see [link to original text]). Figure 4 ).

[0073] The specific amplification primer sequences for SlWRKY39 are as follows:

[0074] SlWRKY39-CRISPR-F: 5'TCAAAGCAAAATGGAGTTCACA 3'

[0075] SlWRKY39-CRISPR-R: 5'TCGATCCATCGCTGTTCTGA 3'

[0076] The specific amplification primers for SlWRKY40 are as follows:

[0077] SlWRKY40-CRISPR-F:5'TGAGCTTTAGGCCTCGTCAA3'

[0078] SlWRKY40-CRISPR-R:5'TGCAACAGGACTCTTCGTCA3'.

[0079] The double gene knockout mutants slwrky39slwrky40-1 and slwrky39slwrky40-2 were obtained, respectively.

[0080] The CDS sequence of the SlWRKY39 gene in slwrky39slwrky40-1 is shown in SEQ ID No:5, and the CDS sequence of the SlWRKY40 gene is shown in SEQ ID No:6; the CDS sequence of the SlWRKY39 gene in slwrky39slwrky40-2 is shown in SEQ ID No:5, and the CDS sequence of the SlWRKY40 gene is shown in SEQ ID No:7.

[0081] Shao Z, Zhao Y, Liu L, Chen S, Li C, Meng F, Liu H, Hu S, Wang J, WangQ. Overexpression of FBR41 enhances resistance to sphinganine analogmycotoxin-induced cell death and Alternaria stem canker in tomato. PlantBiotechnol J. 2020.18(1):141-154.

[0082] Xie X,Ma

[0083] III. Observation of Fruit Maturation Traits in Double-Gene Knockout Tomatoes

[0084] In the spring of 2024, the slwrky39slwrky40 double mutants (slwrky39slwrky40-1 and slwrky39slwrky40-2) and wild-type tomatoes were planted in individual plastic greenhouses at the Zhijiang Base of the Hangzhou Academy of Agricultural Sciences. All materials underwent uniform field management. Flowering dates were marked and recorded uniformly at the tomato flowering stage (when petals were fully open). Observation and photography began after the tomato fruits had fully swelled and continued until the fruits were fully ripe. During this process, the average time required for the fruit to reach the color-breaking stage (when the fruit tip just begins to change color) was calculated.

[0085] Research results: such as Figure 5 As shown, compared to wild-type tomato fruits, the color-breaking time of the slwrky39slwrky40 double mutant fruits was significantly earlier. Specifically, the slwrky39slwrky40-1 double mutant fruits began to break color around 36 days after flowering, while the slwrky39slwrky40-2 double mutant fruits began to break color around 37 days after flowering. Figure 6 As shown, the average time required for the fruits of the slwrky39slwrky40-1 and slwrky39slwrky40-2 double mutants to reach the color-breaking stage was 36.6 days and 37.2 days, respectively, significantly shorter than the 39.8 days for wild-type fruits. These results indicate that the simultaneous loss of function of both SlWRKY39 and SlWRKY40 promotes tomato fruit ripening.

[0086] During the invention process, it was discovered that the average time required for the color-breaking period of the SlWRKY39 single-gene knockout mutant, when tested according to the above method, was approximately 39.6 days. The average time required for the color-breaking period of the SlWRKY40 single-gene knockout mutant, when tested according to the above method, was approximately 39.4 days. There was no significant difference between these two values ​​and the 39.8 days corresponding to the wild-type fruit.

[0087] Finally, it should be noted that the above examples are merely a few specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of this invention should be considered within the scope of protection of this invention.

Claims

1. A method for promoting the ripening of tomato fruits, characterized in that: Simultaneously knock out SlWRRY39 and SlWRKY40 Genes that promote the ripening of tomato fruits; SlWRRY39 The nucleotide sequence of the gene is shown in SEQ ID No:

1. SlWRRY40 The nucleotide sequence of the gene is shown in SEQ ID No:

2.

2. A gene-editing vector for promoting tomato fruit ripening, characterized in that: pCAMBIA1300- pYAO :Cas9-( SlWRKY39 + SlWRKY40 ); SlWRKY39 The target sequence is 5' AATTCATCGGAAACTCGAAG 3'. SlWRKY40 The target sequence is 5' TGGTGGTGAAAAATGAGGCA 3'; pCAMBIA1300- pYAO :Cas9-( SlWRKY39 + SlWRKY40 () is used to knock out SlWRKY39 and SlWRKY40.

3. The method for constructing the gene editing vector as described in claim 2, characterized in that... Includes the following steps: (1) Design the target as described in claim 2: (2) Construction of double gRNA cassette: First obtain the one containing SlWRKY39 The recombinant vector AtU6-26-sgRNA-SK- targeting the target SlWRKY39 ,contain SlWRKY40 The recombinant vector AtU6-26-sgRNA-SK- targeting the target SlWRKY40 ; Then, obtain simultaneously containing SlWRKY39 and SlWRKY40 gRNA cassette The recombinant vector AtU6-26-sgRNA-SK- ( SlWRKY39+SlWRKY40 ); Then the recombinant vector AtU6-26-sgRNA-SK-( SlWRKY39+SlWRKY40 )use Nhe I and Spe I double digestion, obtaining [product containing] SlWRKY39 and SlWRKY40 double gRNA cassette of gRNA cassette; (3) Construction of binary carriers: pCAMBIA1300- pYAO The Cas9 plasmid was digested with SpeI and ligated into a double gRNA cassette to obtain pCAMBIA1300- pYAO :Cas9-( SlWRKY39 + SlWRKY40 ).

4. The method for constructing a gene editing vector according to claim 3, characterized in that... In step (1): SlWRKY39 Target primer: 5' ATTG AATTCATCG GAAACTCGAAG 3' and 5' AAAC CTTCGAGTTTCCGATGAATT 3'; SlWRKY40 Target primer: 5' ATTG TGGTGGTGAAAAATGAGGCA 3' and 5' AAAC TGCCTCATTTTTCACCACCA 3'.

5. Tomato SlWRKY39 and SlWRKY40 Its application in regulating tomato fruit ripening is characterized by: Simultaneously knock out SlWRRY39 and SlWRKY40 Genes that promote the ripening of tomato fruits; SlWRRY39 The nucleotide sequence of the gene is shown in SEQ ID No:

1. SlWRRY40 The nucleotide sequence of the gene is shown in SEQ ID No:2.

Images