Use of LOC_Os12g07640 gene and its encoded protein in improving plant resistance to drought stress

Abstract

The present invention discloses LOC_Os12g07640 The invention relates to the use of genes and their encoded proteins in improving plant resistance to drought stress. The inventors investigated the drought resistance of rice germplasm resources and screened out the gene shown in SEQ ID No.1 by genome-wide association analysis combined with drought treatment expression level analysis results, which may have the ability to enhance rice tolerance to drought stress. By simulating drought stress conditions and direct seeding in dry land to observe the phenotypic changes of overexpressed and CRISPR knockout rice plants, it was found that overexpressed PLACE_ Os12g07640 The gene plants have enhanced tolerance to drought stress, and rice plants with knocked-out mutations of the gene are more sensitive to drought stress, reducing the ability of rice to resist drought stress. The present invention has application prospects in improving and enhancing rice stress resistance, accelerating the process of stress resistance molecular breeding, improving plant resistance to drought stress, or cultivating plant varieties with drought stress resistance.

Description

Technical Field

[0001] The present invention relates to LOC_Os12g07640 New uses of genes and their encoded proteins, especially in rice LOC_ Os12g07640 New use of genes and their encoded proteins in improving plant resistance to drought stress, belonging to LOC_Os12g07640 New areas of use for genes and their encoded proteins. Background Art

[0002] As the global climate warms, soil drier and desertification are becoming increasingly serious. Water used for rice cultivation irrigation accounts for more than 60% of the total agricultural water consumption. Rice is very sensitive to drought stress. Severe drought can lead to large-scale rice yield reduction or even total crop failure (Luo L. (2010). Breeding for water-saving and drought-resistance rice (WDR) in China. J Exp Bot. 61 , 3509-3517.). Therefore, exploring drought-resistant gene resources, cloning rice drought-resistant genes, analyzing molecular regulatory networks and mechanisms, and cultivating water-saving and drought-resistant rice have very important scientific significance and application value for ensuring national food production security and sustainable development.

[0003] Drought resistance physiological responses are all regulated by complex and sophisticated gene networks. The mining and functional analysis of rice drought resistance genes are still important topics in current adversity research. Recently, a series of progress has been made in the study of rice drought resistance functional genomics. As of March 2024, 379 functional genes related to rice drought resistance have been successfully cloned (National Rice Data Center data https: / / www.ricedata.cn).

[0004] In recent years, remarkable achievements have been made in rice agronomic trait gene discovery and functional genomics research at home and abroad. Using linkage analysis, genome-wide association studies (GWAS), haplotype analysis, expression profile analysis and other technical means, several drought-resistant genes with important breeding value have been cloned. qRT9, OsLG3, OsDROT1, OsAL, OsRINGzf1 and OsRRS1 Among them, OsDROT1The natural variation site of is located in the promoter region and mainly exists in upland rice. This achievement provides excellent gene resources for molecular breeding of rice drought resistance. The gene has been identified by the Ministry of Agriculture and Rural Affairs as a gene with great breeding value (Sun, X., Xiong, H., Jiang, C., Zhang, D., Yang, Z., Huang, Y., Zhu, W., Ma, S., Duan, J., Wang, X., et al. (2022). DROT1 confers drought adaptation in upland rice. NatCommun. 13 , 4265.). Overexpression OsRINGzf1 The rice yield was more than 10% higher than the control, reducing the yield loss caused by drought. The gene has breeding application potential (Chen, S., Xu, K., Kong, D., Wu, L., Chen, Q., Ma, X., Ma, S., Li, T., Xie, Q., Liu, H., et al. (2022). UbiquitinligaseOsRINGzf1 regulates drought resistance by controlling the turnover of OsPIP2;1. Plant Biotechnol J. 20 , 1743–1755.). Therefore, GWAS and haplotype analysis can effectively mine excellent alleles associated with drought resistance phenotypes to facilitate research and application. Summary of the invention

[0005] One of the purposes of the present invention is to provide a method for separating and obtaining a LOC_Os12g07640 Genes and their encoded proteins;

[0006] The second object of the present invention is to provide a LOC_Os12g07640 An expression cassette of a gene, a recombinant expression vector or a recombinant host cell containing the recombinant expression vector;

[0007] The third object of the present invention is to separate the LOC_Os12g07640 Gene and its encoded protein, containing said LOC_Os12g07640 The gene expression cassette, recombinant expression vector or recombinant host cell containing the recombinant expression vector is used to regulate the drought stress resistance of plants.

[0008] To achieve the above purpose, the main technical solutions adopted by the present invention include:

[0009] One aspect of the present invention provides a method for separating and obtaining a LOC_Os12g07640 A gene, the polynucleotide sequence of which is shown as (a), (b), (c), (d) or (e):

[0010] (a), the polynucleotide sequence shown in SEQ ID No.1; or

[0011] (b) a polynucleotide sequence encoding the amino acid sequence shown in SEQ ID No. 2; or

[0012] (c) a polynucleotide sequence that can hybridize with the complementary sequence of the polynucleotide sequence of SEQ ID NO.1 under stringent hybridization conditions, and the protein encoded by the polynucleotide sequence still has the function or activity of regulating plant resistance to drought stress; or

[0013] (d) a polynucleotide sequence having at least 90% homology with the polynucleotide sequence shown in SEQ ID No. 1; or

[0014] (e) A polynucleotide variant in which one or more bases are deleted, substituted or inserted based on the polynucleotide sequence shown in SEQ ID NO.1, and the protein encoded by the polynucleotide variant still has the function or activity of regulating plant resistance to drought stress.

[0015] Another aspect of the present invention provides a method for separating and obtaining the LOC_Os12g07640 The amino acid sequence of the protein encoded by the gene is shown in (a) or (b):

[0016] (a), the amino acids shown in SEQ ID No. 2; or

[0017] (b) A protein variant derived from the amino acid shown in SEQ ID No. 2 by replacing, deleting or / and inserting one or more amino acid residues, which still has the function or activity of regulating plant resistance to drought stress.

[0018] The protein variants of the present invention may be produced by genetic polymorphism or artificial manipulation, and these manipulation methods are generally known in the art. For example, amino acid sequence variants or fragments may be prepared by mutation of DNA, where methods of mutagenesis or alteration of polynucleotides are known in the art. Among them, conservative substitutions are replacements of one amino acid residue with another amino acid having similar properties.

[0019] The chimeric gene or expression cassette obtained by chimerizing or connecting the gene shown in SEQ ID No. 1 of the present invention with other genes belongs to the protection scope of the present invention; the recombinant expression vector containing the chimeric gene or expression cassette also belongs to the protection scope of the present invention.

[0020] The present invention also provides a LOC_Os12g07640 The invention relates to a recombinant plant expression vector of a gene and a host cell containing the recombinant plant expression vector.

[0021] The LOC_Os12g07640 The gene is operably connected to the expression control element to obtain a recombinant plant expression vector that can express the gene in plants; the recombinant plant expression vector can be composed of a 5' non-coding region, a polynucleotide sequence shown in SEQ ID No.1, and a 3' non-coding region, wherein the 5' non-coding region can include a promoter sequence, an enhancer sequence, and / or a translation enhancement sequence; the promoter can be a constitutive promoter, an inducible promoter, a tissue or organ specific promoter; the 3' non-coding region can include a terminator sequence, an mRNA cleavage sequence, etc. Suitable terminator sequences can be taken from the Ti-plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase terminator regions.

[0022] In addition, those skilled in the art can optimize the polynucleotide shown in SEQ ID No. 1 to enhance the expression efficiency in plants; for example, the preferred codons of the target plant can be used for optimization to synthesize the polynucleotide to enhance the expression efficiency in the target plant.

[0023] The recombinant plant expression vector of the present invention may also contain a selective marker gene for selecting transformed cells. The selective marker gene is used to select transformed cells or tissues. The marker gene includes: genes encoding antibiotic resistance and genes conferring resistance to herbicidal compounds. In addition, the marker gene also includes phenotypic markers, such as β-galactosidase and fluorescent protein.

[0024] Another aspect of the present invention is to provide the LOC_Os12g07640 Gene and its encoded protein, containing said LOC_Os12g07640 Application of a gene expression cassette, a recombinant expression vector or a recombinant host cell containing the recombinant expression vector in regulating plant resistance to drought stress.

[0025] As a preferred embodiment, the regulation of plant drought stress resistance in the present invention is to improve the plant's drought stress resistance, comprising: LOC_Os12g07640 Genes are overexpressed in plants to obtain transgenic plants; the resulting transgenic plants have enhanced resistance to drought stress; for example: LOC_Os12g07640 The gene is operably linked to an expression control element to obtain a recombinant plant expression vector that expresses the encoding gene in plants.

[0026] As a preferred embodiment of the present invention, the present invention provides a method for breeding plant varieties resistant to drought stress, comprising: (1) constructing a rice LOC_Os12g07640 (2) transforming the constructed recombinant plant expression vector into recipient plant tissues or plant cells; and (3) cultivating and screening transgenic plants with improved drought stress resistance.

[0027] Another aspect of the present invention provides a method for reducing plant resistance to drought stress, comprising: LOC_Os12g07640 Gene knockout or mutation LOC_Os12g07640 The normal function of the protein encoded by the gene is defective or lost, and the resulting transgenic plants have reduced resistance or sensitivity to drought stress.

[0028] Those skilled in the art can use conventional methods such as conventional gene knockout or gene editing technology to modify the gene in plants. LOC_Os12g07640 Gene loss-of-function mutations, such as those created using gene editing techniques LOC_Os12g07640 CRISPR / Cas9 gene editing vectors, etc., can be used to edit genes in plants LOC_Os12g07640 The methods for performing loss-of-function mutation on genes are well known to those skilled in the art.

[0029] Those skilled in the art know that the main principle of the CRISPR / Cas gene editing system or gene editing method is to find the location of gene editing in the host genome through a nucleic acid fragment called guide RNA (gRNA), that is, to target the DNA sequence, and then cut the DNA through the Cas protein. In this application, the Cas protein includes but is not limited to Cas9, Cas12, Cas12a, Cas12j, Cas12e, Cas13 and / or Cas14.

[0030] The transformation protocols and protocols for introducing the genes (or polynucleotides) into plants of the present invention may vary depending on the type of plant (monocot or dicot) or plant cell used for transformation. Suitable methods for introducing the genes (or polynucleotides) into plant cells include: microinjection, electroporation, Agrobacterium-mediated transformation, direct gene transfer, and high-speed ballistic bombardment. In specific embodiments, the genes (or polynucleotides) may be provided to plants using a variety of transient transformation methods. Transformed cells may be regenerated into stably transformed plants using conventional methods.

[0031] The present invention can be used to transform any plant species, including but not limited to monocotyledonous plants or dicotyledonous plants; more preferably, the plants include crops, vegetables or ornamental plants, fruit trees, etc., for example, they can be rice, cotton, corn, sorghum, wheat, soybean, potato, barley, tomato, kidney bean, peanut or sugarcane, etc., preferably rice.

[0032] The inventors conducted a survey on the drought resistance of 408 rice germplasm resources and conducted genome-wide association analysis, combined with the results of drought treatment expression level analysis, and screened out LOC_Os12g07640 The present invention further simulates drought stress conditions and direct seeding in dry land by PEG, observes the phenotypic changes of overexpressed and CRISPR knockout rice plants, clones and analyzes the function of the gene, and analyzes the relationship between the candidate gene and the drought stress response of rice. The results show that overexpression in rice LOC_Os12g07640 Gene plants have enhanced tolerance to drought stress, knockout mutations LOC_Os12g07640 Rice plants with the gene are more sensitive to drought stress, which reduces the ability of rice to resist drought stress. The present invention has application prospects in improving and enhancing rice stress resistance, accelerating the process of stress-resistant molecular breeding, improving plant resistance to drought stress or cultivating plant varieties with drought stress resistance.

[0033] Definitions of terms used in this invention

[0034] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0035] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioate, phosphoramidate, etc.). Unless otherwise specified, a specific nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including but not limited to degenerate codon substitutions) and complementary sequences as well as explicitly specified sequences. In particular, degenerate codon substitutions can be achieved by generating a sequence in which the 3rd position of one or more selected (or all) codons is substituted with mixed bases and / or deoxyinosine residues.

[0036] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acid residues. That is, descriptions directed to polypeptides apply equally to describing peptides and describing proteins, and vice versa. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the terms encompass amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0037] The term "recombinant host cell strain" or "host cell" means a cell comprising a polynucleotide of the present invention, regardless of the method used for insertion to produce a recombinant host cell, such as direct uptake, transduction, mating, or other methods known in the art. The exogenous polynucleotide may be maintained as a non-integrating vector such as a plasmid or may be integrated into the host genome. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.

[0038] The term "operably linked" refers to a functional connection between two or more elements. The operably linked elements may be contiguous or non-contiguous.

[0039] The term "recombinant plant expression vector" means one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, together with vectors with helper plasmids, are most commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: cis-acting sequences required for T-DNA transfer, selection markers engineered to be expressed in plant cells, heterologous DNA sequences to be transcribed, etc.

[0040] The term "transformation" as used herein refers to genetic transformation of polynucleotides or polypeptides into plants by introducing the coding gene of rice LOC_Os12g07640 protein into plant cells. Methods for introducing the polynucleotides or polypeptides into plants are well known in the art, including but not limited to stable transformation, transient transformation, and virus-mediated methods. "Stable transformation" means that the introduced polynucleotide construct is integrated into the genome of the plant cell and can be inherited by its progeny; "transient transformation" means that the polynucleotide is introduced into the plant but can only be temporarily expressed or present in the plant. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 for LOC_Os12g07640 Gene expression level detection results after 20% PEG simulated drought stress treatment.

[0042] Figure 2It is the PCR positive identification of transgenic plants with overexpression materials; among them, lanes 1-2 are the fragments amplified by primers for identifying positive overexpression OE1 materials, lanes 3-4 are the fragments amplified by primers for identifying positive overexpression OE2 materials, lane 5 is the positive control of transformation vector, lane 6 is marked with DNA Marker Ⅰ, lane 7 is the negative control for wild-type material identification primers, and lane 8 is the negative control with the addition of double distilled water.

[0043] Figure 3 It is the PCR positive identification of the knockout material transgenic plants; among them, lanes 1-2 are the fragments amplified by the knockout mutation identification primers of the knockout material KO1, lane 3 is the negative control of the added double distilled water, lanes 4-5 are the fragments amplified by the knockout mutation identification primers of the knockout material KO2, lane 6 is the gene fragment amplified by the wild-type material identification primers, and lane 7 is marked with DNAMarker Ⅰ.

[0044] Figure 4 For rice LOC_Os12g07640 Gene knockout material detection results.

[0045] Figure 5 for LOC_Os12g07640 Phenotypes of transgenic plants and wild-type plants after PEG-simulated drought stress treatment.

[0046] Figure 6 for LOC_Os12g07640 Phenotypes of gene knockout transgenic plants and wild-type plants after soil drought stress treatment. DETAILED DESCRIPTION

[0047] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, it should be understood that the embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the protection scope of the present invention.

[0048] Experimental Example 1 Detection of expression level of LOC_Os12g07640 gene after 20% PEG simulated drought stress treatment

[0049] 1. Processing methods and sample collection

[0050] Select plump and uniform seeds of wild-type material of Zhonghua 11, and place them in a 50°C oven for three days to break dormancy, then sterilize them in 0.5% sodium hypochlorite solution for 30 minutes. Rinse them with tap water three times again, and then place them in tap water (pH 5.5-5.8) in an artificial climate room at 30°C for germination for about 3 days. When the seeds sprout 2-3cm in hydroponics, transfer them to the PCR plate with the cut bottom to float on tap water (pH 5.5-5.8) for growth. After one week, transfer them to Yoshida culture medium and adjust the pH to 5.5-5.8. The culture medium is changed every Monday. 20% PEG was added to the culture medium of 21-day-old seedlings, and the aerial parts and roots were sampled after 0 h, 2 h, 4 h, 6 h, 8 h, 12 h, 24 h, 36 h and 48 h of simulated drought stress treatment. Five plants were taken each time, and the materials were quick-frozen in liquid nitrogen and stored in a -80°C refrigerator for later use.

[0051] 2. Extraction of total RNA from rice and RT-PCR detection

[0052] (1) Extraction of total RNA from plant tissues

[0053] 1) Grind the plant tissue samples frozen with liquid nitrogen into powder and dispense them into RNase-free tubes according to the weight of about 150 mg per tube. Add 1 mL of TRIzol to each tube of experimental samples, shake and mix thoroughly for 5 min, and place in an ice bath for 5 min; 2) Add 200 μL of chloroform to each tube for extraction, shake and mix thoroughly for 1 min, and place in an ice bath for 2 min; 3) Centrifuge at 12,000 g, 4°C for 15 min, and transfer 500 μL of supernatant to a new RNase-free tube; 4) Add 500 μL of isopropanol to each tube, mix thoroughly, and place in an ice bath for 10 min; 5) Centrifuge at 12,000 g, 4°C for 15 min, discard the supernatant, and add 1 mL of pre-cooled 70% ethanol to suspend the precipitate; 6) Centrifuge at 12,000 g, 4°C for 3 min, discard the supernatant, and place the tube on ice in a clean bench to dry for 5 min; 7) Use 50 μL of Dissolve the precipitate with DEPC water; 8) Digest DNA with DNase I at 37°C for 30 min. Each 100 μL system contains 50 μL total RNA, 10 μL 10×DNase Buffer, 10 μL DNase I, 0.5 μL RNaseinhibitor and 29.5 μL DEPC water; 9) Add 300 μL DEPC water, 200 μL chloroform and 200 μL water-saturated phenol to each tube and mix thoroughly; 10) Centrifuge at 12,000 g, 4°C for 15 min, take 350 μL supernatant and put it in a new RNase-free centrifuge tube; 11) Add 700 μL of pre-cooled anhydrous ethanol and 0.1 times the volume of 3 M NaAc, mix thoroughly, and precipitate RNA at -80°C overnight or for more than 2 h; 12) Centrifuge at 12, 000 g, 4°C for 15 min, discard the supernatant, and add 1 mL of pre-cooled 70% 13) Centrifuge at 12,000 g, 4°C for 2 min, discard the supernatant, and place the tube on ice in a clean bench to dry for 5 min; 14) Dissolve the precipitate in 50 μL DEPC water per tube, which can be used for RNA reverse transcription or stored in a -80°C refrigerator for later use.

[0054] (2) Reverse transcription into cDNA

[0055] 1) Nanodrop was used to measure RNA concentration, and 5 μg RNA was added to the reverse transcription system according to the concentration; 2) 5 μg RNA and 2 μL 50 μM Oligo (dT) were added to each reverse transcription system, and DEPC water was added to 37.5 μL. The system was denatured at 70°C for 5 min and then placed in an ice bath for 2 min; 3) 10 μL 5×M-MLV buffer, 1 μL M-MLV Reverse Transcriptase (Promega, USA), 1 μL dNTP Mix (each 10 mM), and 0.5 μL RNase inhibitor were added to each 50 μL reverse transcription system, and the reaction was carried out in a metal bath at 42°C for 1 h, and then at 70°C for 15 min; 4) cDNA concentration was measured by Nanodrop and stored at -20°C for later use.

[0056] (3) Real-time quantitative PCR (RT-qPCR)

[0057] The primer sequences used are:

[0058] LOC_Os12g07640 -RT-F: 5'-CTACCACCACCACTACTCGG-3' (SEQ ID No. 3);

[0059] LOC_Os12g07640 -RT-R: 5'-CACTGTTGACGACGATGCAT-3' (SEQ ID No. 4);

[0060] QUR -RT-F:5'-GCTCCGTGGCGGTATCAT-3' (SEQ ID No. 5);

[0061] QUR -RT-R:5'-CGGCAGTTGACAGCCCTAG-3' (SEQ ID No. 6).

[0062] 1) The RT-qPCR reaction system is as follows:

[0063] Table 1 RT-qPCR reaction system

[0064]

[0065] 2) The RT-qPCR run procedure is as follows:

[0066] Table 2 RT-qPCR operation program

[0067]

[0068] 3) RT-PCR was performed using a real-time fluorescence PCR instrument according to the following reaction system and procedure; the ΔΔCt method (Livak, KJ, and Schmittgen, TD (2001) was used for analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2 −ΔΔCT Method.Methods. 25 , 402–408.) Calculate the relative abundance of genes to QUR By detecting the expression level of LOC_ Os12g07640 Changes in gene expression levels with increasing treatment time.

[0069] Test results such as Figure 1 ; Figure 1 Shown in above-ground parts and roots LOC_Os12g07640 Gene expression is upregulated by drought. LOC_Os12g07640 The expression of the gene in the aerial part increased significantly after 2 h of treatment. LOC_ Os12g07640 Involved in the early response of rice to drought stress.

[0070] Test Example 2 LOC_Os12g07640 Genetic transformation experiment in rice

[0071] 1. LOC_Os12g07640 Gene overexpression vector construction

[0072] Design cloning LOC_Os12g07640 Primers containing the gene CDS sequence, primer 5′ end introduced XB Ⅰ Restriction site sequence (5'- TCTAGA ATGGGGAGGTCGCCGTGCTGCGA-3') (SEQ ID No.7), Primer 3' end primer introduction Kpn I restriction site sequence (5' GGTACCCACTGTTGACGACGATGCATTG-3') (SEQ ID No.8). Rice ZH11 cDNA was used as a template for PCR amplification. The PCR amplification conditions were as follows: 95℃, pre-denaturation for 5 min; 95℃, denaturation for 10 s; 60℃, annealing for 30 s; 72℃, extension for 30 s; amplification for 32 cycles; 72℃, post-extension for 10 min; storage at 4℃. The PCR product was electrophoresed in 1% agarose gel, and the target band was recovered using Zhuangmeng small agarose gel DNA recovery kit. Take an appropriate amount of the recovered product, connect it with the pTOPO-Blunt vector and transform the competent Escherichia coli. After colony PCR identification, the positive colony plasmid pTOPO-LOC_Os12g07640 was extracted and sent to the company for sequencing.

[0073] Target gene in overexpression vector LOC_Os12g07640 The expression of Super Promoter and nopaline biosynthesis gene Nos The 3′ terminator region of Hpt Gene, encoding HYG protein. XB Ⅰ and Kpn I digested plasmid pTOPO-LOC_Os12g07640 and pSuper1300-Myc vector backbone to obtain LOC_Os12g07640 The target fragment and the linearized pSuper1300-Myc with the same sticky ends were ligated to the linearized pSuper1300 vector backbone using T4 DNA ligase to form the recombinant plasmid pSuper1300-LOC_Os12g07640 - Myc.

[0074] 2. LOC_Os12g07640 Gene CRISPR knockout vector construction

[0075] according to LOC_Os12g07640 The target site for knockout was designed by using the gene cDNA sequence. The website used was: http: / / skl.scau.edu.cn / dsdecode / ;

[0076] Target site sequence: 5′-ATCGCCCACATCAACCAGCACGG-3′ (SEQ ID No. 9),

[0077] The experimental methods and vectors are from the laboratory of Academician Yaoguang Liu (Ma, X., Zhang, Q., Zhu, Q., Liu, W., Chen, Y., Qiu, R., Wang, B., Yang, Z., Li, H., Lin, Y., et al. (2015). ARobust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex GenomeEditing in Monocot and Dicot Plants. Molecular Plant, 8 , 1274–1284. ) and the recombinant vector was named pYLCRISPR / Cas9Pubi-LOC_Os12g07 640.

[0078] 3. Agrobacterium transformation

[0079] The overexpression vector pSuper1300-LOC_Os12g07640-Myc and the knockout vector pYLCRISPR / Cas9Pubi-LOC_Os12g07640 were transformed into Agrobacterium EHA105 competent cells by freeze-thaw method (the public can obtain it from the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. The non-patent literature that records this material is: Yang, R., Tang, Q., Wang, H., Zhang, X., Pan, G., Wang, H., and Tu, J. (2011). Analyses of tworice (Oryza sativa) cyclin-dependent kinase inhibitors and effects of transgenicexpression of OsiICK6 on plant growth and development. Annals of Botany, 107 , 1087–1101.), the method refers to the Molecular Cloning Experiment Guide.

[0080] 4. Genetic transformation

[0081] Genetic transformation was carried out using Agrobacterium-mediated genetic transformation method with Zhonghua 11 as the recipient material. The culture medium formula is shown in Table 3.

[0082] Table 3 Culture medium and its formula used for genetic transformation

[0083]

[0084] The specific method is as follows:

[0085] 1) Callus induction

[0086] Take an appropriate amount of mature rice seeds, remove the shells, wash and disinfect with 70% alcohol for 1 minute, shake continuously during the process, and then disinfect with 15% sodium hypochlorite for 30 minutes (can be placed on a shaker); finally rinse with sterile distilled water 4 to 5 times, use sterile filter paper to absorb the moisture on the surface of the seeds and then inoculate. Inoculate the disinfected seeds in an induction medium containing 2.0 mg / L 2,4-D and culture in the dark at 28°C for 30 to 40 days. The callus obtained by culture is expanded on the subculture medium and subcultured every 2 weeks until embryonic callus is formed.

[0087] 2) Agrobacterium infection

[0088] a) Streak the Agrobacterium carrying the expression plasmid vector onto the surface of LB solid medium containing antibiotics (50 mg / L kanamycin or spectinomycin, 25 mg / L rifampicin) and culture overnight at 28°C and 200 rpm.

[0089] b) Pick a single clone with a sterilized toothpick and inoculate it into 5 mL of YEB liquid medium containing the corresponding antibiotics. Cultivate at 28°C with shaking until the OD 600 =0.5.

[0090] c) Take the activated fresh bacterial solution and inoculate it into 25 mL of the same YEB liquid medium at a ratio of 1:100, and culture it under the same conditions until the OD 600 =0.5.

[0091] d) Centrifuge the bacterial solution at 5000 g, 4°C for 10 min to collect the cells and discard the supernatant; add 25 mL of 10 mM MgSO4 to suspend the cells and gently pipette to fully suspend them; centrifuge at 5000 g, 4°C for 10 min to re-collect the cells and discard the supernatant.

[0092] e) Resuspend in 25 mL of AA-AS staining medium containing 200 μM acetosyringone (AS).

[0093] f) Transfer embryonic calli with good growth status from the subculture medium to a culture dish covered with sterile filter paper (cut the callus into 0.3-0.4 mm size) and air-dry on a clean bench for 10-20 minutes.

[0094] g) Immerse the dried embryogenic callus in a 50 mL centrifuge tube containing the above bacterial solution for 20 min, shaking it every 5 min. Then, pour out the bacterial solution, take out the callus, place it on sterile filter paper and air-dry it for 10-20 min, and then transfer it to CC medium containing 200 μM acetosyringone (AS) covered with sterile filter paper, and co-cultivate it at 25 ℃ in the dark for 3 days.

[0095] h) Collect callus tissue with no obvious Agrobacterium on the surface, rinse it three times with sterile water containing 600 mg / L cephalosporin, and absorb excess water.

[0096] i) The callus tissue was transferred to a screening medium (N6 medium containing 500 mg / L cephalosporin and 50 mg / L hygromycin) and screened for 2-3 times, each time for two weeks. Finally, well-growing bright yellow hygromycin-resistant callus tissue was obtained.

[0097] 3) Regeneration of transformant plants

[0098] Take fresh hygromycin-resistant callus, cut the callus into 2 mm small pieces, inoculate it in pre-differentiation medium, culture it in the dark at 28 ℃ for 7 days, then place it in a light culture room (12 h light / 12 h dark) for another 8-9 days, then transfer the callus that has differentiated adventitious buds into regeneration medium (250 mL tissue culture bottle) and continue to culture it in the light. After the adventitious buds grow into seedlings 4 to 6 cm high, they are transferred to rooting medium and cultured in a 28°C light culture room (12 h light / 12 h dark) for about 15 days to obtain transformant plants, which are moved to a greenhouse for planting (T0 generation). One month later, leaves are taken for PCR positive identification (F: 5'-TGTAGTGTATTGACCGATTCCTTGC-3' (SEQ ID No.10), R: 5'-GTTCGACAGCGTCTCCGACCTGAT-3' (SEQ ID No.11)), and the positive transgenic plants identified as positive are harvested and their positive plant seeds (T1 generation).

[0099] Experimental Example 3: Extraction of Rice Genomic DNA and PCR Detection of Positive Transgenic Materials

[0100] 1. Extraction of rice genomic DNA by CTAB method

[0101] (1) Place plant leaves in 2 mL centrifuge tubes, add 5 mm diameter steel balls to each tube, freeze quickly in liquid nitrogen, and grind the samples at 1500 rpm using a tissue grinder for about 90 s; (2) Add 600 μL CTAB extraction buffer to each tube, mix thoroughly, and place in a 65°C water bath for 30 min, inverting and mixing twice in the middle; (3) Wait for it to cool to room temperature, add 500 μL chloroform:isoamyl alcohol (24:1), mix thoroughly, and place on a shaker for extraction for 20 min; (3) Centrifuge at 12,000 g for 15 min at room temperature, and pipette about 550 μL of supernatant into a new 1.5 mL centrifuge tube; (5) Add 0.8 times the volume of isopropanol and mix gently, then place at room temperature for 10 min; (6) Centrifuge at 12,000 g for 10 min at room temperature, discard the supernatant, and add 1 mL 70% ethanol to suspend the precipitate; discard the supernatant, and add 1 mL 70% ethanol to suspend the precipitate; (7) Centrifuge at 12,000 rpm for 2 min at room temperature, discard the supernatant, and suspend the precipitate with 1 mL 70% ethanol; 8) Centrifuge at 12,000 rpm for 2 min at room temperature, discard the supernatant, blow dry in a clean bench, add 50 μL ddH2O to dissolve the DNA, and store at 4°C for later use.

[0102] 2. LOC_Os12g07640 Detection of positive materials of gene overexpression rice

[0103] Extraction of T2 generation LOC_Os12g07640 The gene-overexpressing rice genomic DNA was amplified using PCR positive identification primers (F: 5'-TGTAGTGTATTGACCGATTCCTTGC-3' (SEQ ID No. 12), R: 5'-GTTCGACAGCGTCTCCGACCTGAT-3' (SEQ ID No. 13)).

[0104] 1) The reaction system is as follows:

[0105] Table 4 PCR reaction system

[0106]

[0107] 2) The amplification procedure is as follows:

[0108] Table 5 PCR amplification program

[0109]

[0110] 3) Take 10 μL of PCR product and run it on 1% agarose gel electrophoresis to amplify the fragment containing 385 bp on the overexpression vector. The result is as follows: Figure 2 As shown, the insertion of exogenous fragments was detected in two OE lines, but not in wild-type plants. LOC_Os12g07640-OE The strains can be used for subsequent phenotypic observation experiments.

[0111] 3. LOC_Os12g07640 Analysis of sgRNA target editing in gene knockout rice

[0112] Extraction of T2 generation LOC_Os12g07640 The rice genomic DNA was knocked out, and primers LOC_Os12g07640-F / R (F: 5'-AGTGGGACCCACTCCCTTTCTTT-3' (SEQ ID No.14), R: 5'-ACCCTATTACCATGTCAGTCAAA-3' (SEQ ID No.15)) were designed based on the target site to amplify LOC_Os12g07640 Genomic DNA sequence. Figure 3 The PCR positive identification result of the knockout material transgenic plant; the PCR amplification product was sent to the company for sequencing, and two different gene knockout materials were obtained through sequence comparison analysis of the sequencing results. The nucleotide sequence at the wild-type target site (sgRNA:ATCGCCCACATCAACCAGCACGG) (SEQ ID No.16), LOC_Os12g07640-KO1 The strain lacks 2 bases at the target site, and the nucleotide sequence (ATCGCCCACATCAAC--GCACGG) is as follows Figure 4 As shown; LOC_Os12g07640-KO2 The strain lacks one base at the target site, and the nucleotide sequence (ATCGCCCACATCAACC-GCACGG) is as follows Figure 4 The deletion or insertion of bases in the above two strains will cause frameshift mutations, resulting in protein sequences without conserved domains. The LOC_Os12g07640 protein function is lost, and the two LOC_Os12g07640-KO The strains can be used for subsequent phenotypic observation experiments.

[0113] Test Example 4 LOC_Os12g07640 Phenotypic identification test of gene knockout materials after drought treatment

[0114] 1. Phenotypic identification of 20% PEG simulated drought stress treatment

[0115] To make it clear LOC_Os12g07640Genes positively regulate rice drought resistance. Select plump and uniform wild-type, gene overexpression and knockout material seeds and place them in a 50°C oven for three days to break dormancy. Then sterilize them in 0.5% sodium hypochlorite solution for 30 minutes. Rinse with tap water three times again, then place in tap water (pH 5.5-5.8) in an artificial climate chamber at 30°C for germination for about 3 days. When the seeds germinate 2-3 cm in hydroponics, transfer to the PCR plate with the cut bottom to float on tap water (pH 5.5-5.8) for growth. After one week, transfer to Yoshida culture medium and adjust the pH to 5.5-5.8. The culture medium is changed every Monday. 20% PEG is applied to the culture medium of 21-day-old seedlings. Three replicates are set for the treatment, with 30 seeds of wild type and knockout materials in each replicate. The phenotype is observed after 9 days of drought stress treatment.

[0116] according to Figure 5 The experimental results show that the knockout mutant plants in rice are more sensitive to drought stress, indicating that the knockout mutant plants in rice are more sensitive to drought stress. LOC_Os12g07640 The gene can significantly affect the ability of rice to tolerate drought stress. After 14 days of drought stress treatment, the wilting degree of OE-overexpressing plants was lower than that of the wild type, and the growth state was better than that of the wild type.

[0117] 2. Phenotypic identification of dryland direct seeding

[0118] To confirm LOC_Os12g07640 The tolerance of gene knockout materials to drought stress is reduced. Plump and uniform seeds of wild type and knockout mutant materials were selected and sown in the dryland experimental station of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Sanya, Hainan. After sowing, sprinkler irrigation was used for watering (soil moisture content 50%). After 20 days, the second watering was carried out (soil moisture content 30%). After that, water was cut off and drought treatment was started. The phenotype was investigated after about 2 months of growth in dryland.

[0119] according to Figure 6 The results showed that the knockout mutant plants wilted and withered more than the wild type. LOC_Os12g07640 Plants with the gene are more sensitive to drought stress. LOC_Os12g07640 Gene positively regulates rice drought resistance, so rice LOC_Os12g07640 Genes and their encoded proteins can be used to enhance the ability of crops to resist drought stress.

Claims

1. LOC_Os12g07640 Gene, LOC_Os12g07640 Genes encoding proteins containing LOC_Os12g07640 Chimeric genes or expression cassettes containing LOC_Os12g07640 The application of the recombinant plant expression vector or recombinant host cell of the gene in improving the resistance of rice to drought stress includes: Will LOC_Os12g07640 The gene is overexpressed in rice to obtain transgenic rice, and the resulting transgenic rice has enhanced resistance to drought stress; LOC_Os12g07640 The nucleotide sequence of the gene is a nucleotide sequence encoding the amino acid sequence shown in SEQ ID No.2, and the LOC_Os12g07640 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No.

2.

2. A method for breeding rice varieties resistant to drought stress, characterized in that: including: (1) Construct PLACE_ Os12g07640 (2) transforming the constructed recombinant plant expression vector into rice tissues or cells; (3) cultivating and screening transgenic rice with improved resistance to drought stress; LOC_Os12g07640 The nucleotide sequence of the gene is a nucleotide sequence encoding the amino acid sequence shown in SEQ ID No.2.

Images