A TaSMT-5B gene that enhances wheat resistance to Fusarium head blight and its application

By providing the TaSMT-5B gene and its recombinant vector, along with inorganic selenium treatment, the resistance of wheat to Fusarium head blight was significantly improved, solving the problem of the lack of effective resistance genes in existing technologies and achieving a significant reduction in the incidence of diseased spikelets.

CN119082151BActive Publication Date: 2026-05-26YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-28
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

There is limited research on the resistance effects and mechanisms of wheat scab in existing technologies, and there is a lack of effective genes and methods to improve wheat resistance to scab.

Method used

The TaSMT-5B gene and its encoded protein were provided. By constructing a recombinant vector and introducing it into host cells, combined with inorganic selenium-based fertilization, wheat resistance to Fusarium head blight was improved.

Benefits of technology

It significantly improved wheat's resistance to Fusarium head blight, reduced the incidence of diseased spikelets by 20% to 50%, and inhibited the growth and infection of Fusarium graminearum through the accumulation of MeSeCys.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119082151B_ABST
    Figure CN119082151B_ABST
Patent Text Reader

Abstract

This invention discloses a TaSMT-5B gene for enhancing wheat resistance to Fusarium head blight and its applications. The TaSMT-5B gene belongs to the selenocysteine ​​methyltransferase family, catalyzing the methylation of SeCys to MeSeCys. It is stably and highly expressed in the high-MeSeCys-rich and Fusarium head blight-resistant variety Zheng 9023, and a "GTCGCCG" insertion site exists in the promoter region of this gene in the Zheng 9023 variety. The TaSMT-5B gene was overexpressed using a constructed overexpression vector and introduced into the popular variety Fielder via Agrobacterium infection, resulting in five stable transgenic lines. After basal application of inorganic selenium, the severity of Fusarium head blight in the transgenic plants was alleviated. This invention has significant production implications for achieving selenium biofortification in wheat and enhancing its resistance to Fusarium head blight, providing a new gene resource for breeding stable-yielding and high-quality wheat varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method for improving wheat resistance to Fusarium head blight. TaSMT-5B Genes and their applications. Background Technology

[0002] Wheat scab is mainly caused by the Fusarium graminearum complex. The pathogenic fungus reproduces and spreads through both ascospores and conidia. During the wheat flowering period, it infects the anthers and glumes, colonizing the spikelets and using the vascular bundles to spread from the spikelet axis to other spikelets, ultimately leading to shriveled and weakened wheat grains, and the accumulation of various mycotoxins such as deoxynivalenol (DON), seriously threatening grain production and food safety. Selenocysteine ​​methyltransferase (SMT) is a key enzyme in plant selenium metabolism that catalyzes the methylation of selenocysteine ​​(SeCys) to methylselenocysteine ​​(MeSeCys). MeSeCys is an important precursor of methylselenocysteine, possessing antioxidant and heavy metal detoxification functions. Studies have shown that selenium forms such as MeSeCys can significantly inhibit the growth of Fusarium graminearum; the accumulation and volatilization of MeSeCys can also help wheat prevent and resist Fusarium graminearum invasion. To date, there are few reports on the effects and mechanisms of wheat SMT on resistance to Fusarium head blight. Summary of the Invention

[0003] The purpose of this section is to outline some aspects of embodiments of the present invention and to briefly describe some preferred embodiments. Simplifications or omissions may be made in this section, as well as in the abstract and title of this application, to avoid obscuring the purpose of these documents; however, such simplifications or omissions should not be construed as limiting the scope of the invention.

[0004] In view of the problems existing in the above and / or prior art, the present invention is proposed.

[0005] Another object of the present invention is to overcome the shortcomings of the prior art and provide a gene TaSMT-5B .

[0006] To solve the above-mentioned technical problems, the present invention provides the following technical solution: the nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0007] Another object of the present invention is to overcome the shortcomings of the prior art and provide a gene TaSMT-5B The encoded TaSMT-5B protein.

[0008] As the gene described in this invention TaSMT-5BA preferred embodiment of the encoded TaSMT-5B protein includes: the TaSMT-5B protein being one of the following proteins (i) to (iv):

[0009] (i) A protein with the amino acid sequence shown in SEQ ID NO.2;

[0010] (ii) Proteins derived from SEQ ID NO.2 with the same function having one or more amino acid residues substituted and / or deleted and / or added;

[0011] (iii) Proteins that have 99%, 95%, 90%, 85%, or 80% homology with the amino acid sequence shown in SEQ ID NO. 2 and its derived proteins and have the same function;

[0012] (iv) Fusion proteins obtained by attaching tags to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO.2 and its derived proteins and homologous proteins.

[0013] Another object of the present invention is to overcome the shortcomings of the prior art and provide a gene-containing... TaSMT-5B Recombinant carriers.

[0014] As described in this invention, it contains genes. TaSMT-5B A preferred embodiment of the recombinant vector includes: the nucleotide sequence of the recombinant vector as shown in SEQ ID NO.3, and a restriction endonuclease at the multiple cloning site of the pCambia3300 backbone vector. Hin dIII and Bam Insert between HI TaSMT-5B The sequence of amino acids encoded by the gene was obtained.

[0015] Another object of the present invention is to overcome the shortcomings of the prior art and provide a transformant. The transformant is obtained by introducing the recombinant vector into host cells, preferably *Escherichia coli* cells or *Agrobacterium* cells.

[0016] Another object of the present invention is to overcome the shortcomings of the prior art and provide a gene TaSMT-5B Application of TaSMT-5B protein, recombinant vectors or transformants in improving wheat scab resistance.

[0017] Another object of the present invention is to overcome the shortcomings of the prior art and provide a gene TaSMT-5B Application of TaSMT-5B protein, recombinant vectors, or transformants in wheat breeding. Wheat varieties with significant disease resistance were obtained after introduction into plants.

[0018] As a preferred embodiment of the application described in this invention, it includes: TaSMT-5B Gene overexpression combined with inorganic selenium application. Attached Figure Description

[0019] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. Wherein:

[0020] Figure 1 In Embodiment 1 of this invention, Chinese Spring (CS), Zhengmai 9023, and Ximai 1376 are... TaSMT-5B CDS ( Figure 1 A) and promoter ( Figure 1 B) Sequence alignment diagram.

[0021] Figure 2 In Embodiment 1 of the present invention TaSMT-5B A diagram illustrating the spatiotemporal expression patterns of genes.

[0022] Figure 3 This is a map showing the carrier construction in Embodiment 1 of the present invention.

[0023] Figure 4 This is a diagram showing a positive transgenic identification in Example 1 of the present invention.

[0024] Figure 5 This is an expression detection diagram of the positive strain in Example 1 of the present invention.

[0025] Figure 6 In Embodiment 1 of the present invention TaSMT-5B Phenotypic diagram of Fusarium head blight in overexpressing transgenic materials.

[0026] Figure 7 In Embodiment 1 of the present invention TaSMT-5B Statistical results of the incidence of Fusarium head blight phenotype in overexpressing transgenic materials. Detailed Implementation

[0027] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the examples in the specification.

[0028] Many specific details are set forth in the following description in order to provide a full understanding of the invention. However, the invention may also be practiced in other ways different from those described herein, and those skilled in the art can make similar extensions without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below.

[0029] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in different places in this specification does not necessarily refer to the same embodiment, nor is it a single or selective embodiment that is mutually exclusive with other embodiments.

[0030] Unless otherwise specified, all raw materials used in the embodiments of this invention are commercially available.

[0031] Using the genome of the wheat variety Chinese Spring as a reference, TaSMT-5B The CDS sequence of the gene is completely identical to that of Chinese Spring, Zhengmai 9023, and Ximai 1376 (see sequence alignment). Figure 1 A), but the promoter region of this gene has a "GTCGCCG" insertion site (located 1742 bp upstream of the start codon) in Zhengmai 9023, which is highly enriched in MeSeCys and highly resistant to Fusarium head blight, while this insertion site is not found in Chinese Chunhe Ximai 1376 (see sequence alignment). Figure 1 B). Quantitative analysis of Zhengmai 9023 and Ximai 1376 at different time points and tissue sites revealed that the expression of this gene was selenium-induced and more stable in Zhengmai 9023. The highest expression level was observed in the wheat spike 24 hours after selenium treatment. Figure 2 This is a key site for Fusarium graminearum infection and spread. Therefore, we extracted RNA from Zhengmai 9023 and performed reverse transcription to obtain cDNA, which was then amplified to obtain... TaSMT-5B The CDS sequence was obtained and vectors were constructed, genetically transformed, treated with inorganic selenium, and the Fusarium head blight phenotype was identified. TaSMT-5B The nucleotide sequence of the gene is shown in SEQ ID NO:1 in the sequence listing, and its protein amino acid sequence is shown in SEQ ID NO:2. Example

[0032] (1) Wheat RNA extraction and reverse transcription:

[0033] I. RNA extraction:

[0034] Preparation: Sample, 2 mL / 1.5 mL enzyme-free centrifuge tubes, enzyme-free pipette tips, Trizol, chloroform, isopropanol, 75% ethanol, DEPC-treated H2O, centrifuge pre-cooled at 4°C.

[0035] The sample was quickly removed from liquid nitrogen and placed in a pre-cooled mortar. It was ground into powder. An appropriate amount of powder was transferred to a 2 mL enzyme-free centrifuge tube. The tube was placed on ice and 1 mL of Trizol was added. The tube was shaken for 30 seconds to allow for complete lysis. Then 400 µL of chloroform was added and the tube was shaken for 15 seconds. After standing for 3 minutes, the tube was placed in a centrifuge and centrifuged at 4°C and 12,000 rpm for 15 minutes.

[0036] Pipette 400 µL of supernatant into a 1.5 mL enzyme-free centrifuge tube, add isopropanol at a 1:1 ratio, mix by inverting the tube 5-10 times, and incubate at -20℃ for 30 min to precipitate RNA. After precipitation, place the tube in a centrifuge and centrifuge at 4℃, 12000 rpm for 15 min.

[0037] Remove the centrifuge tube, discard the supernatant, add 1 mL of 75% ethanol (prepared using DEPC-treated water) to wash the RNA precipitate, then place it in a centrifuge, set it to 4℃, 12000 rpm, and centrifuge for 5 min. Discard the supernatant, and after centrifuging for 10-20 s, use an enzyme-free pipette tip to remove the remaining ethanol.

[0038] Place the centrifuge tubes in a clean bench and air dry for 15-20 minutes until transparent. Add preheated DEPC water at 70°C and dissolve for 5 minutes.

[0039] Store the extracted RNA in a -80°C freezer.

[0040] II. Reverse transcription of cDNA using a reverse transcription kit (Novizan, Nanjing):

[0041] 1. Removal of genomic DNA:

[0042] Table 1

[0043] Components Dosage Extracted RNA 5 µL 4× gDNA wiper Mix 4 µL <![CDATA[RNase-free ddH2O]]> 7 µL Total 16 µL

[0044] PCR program: 42℃, 2 min.

[0045] 2. Reverse transcription of cDNA:

[0046] Table 2

[0047] Components Dosage The above reaction products 16µL HiScript III qRT supermix 4 µL Total 20 µL

[0048] PCR program: 50 ℃ for 15 min; 85 ℃ for 2 min. Reverse transcription products are stored at -20 ℃.

[0049] (2) Real-time quantitative PCR:

[0050] Primers designed for quantification based on the reference genome are as follows:

[0051] The forward primer is: TCTCCATTCGGAAGGTCACAG (SEQ ID NO: 4);

[0052] The reverse primer is: TATTGCCCTGATGGTGTTTGG (SEQ ID NO: 5);

[0053] Real-time quantitative PCR: Prepare a 10 µL quantitative PCR system as follows:

[0054] Table 3

[0055] Components Dosage 2×ChamQ Universal SYBR qPCR Master Mix 5 µL Forward primer (SEQ ID NO: 4) 0.25 µL Reverse primer (SEQ ID NO: 5) 0.25 µL cDNA 0.3 µL <![CDATA[ddH2O]]> 4.2 µL Total 10 µL

[0056] PCR program: Pre-denaturation: 95 ℃ for 30 s; Cyclic reaction: 95 ℃ for 5 s, 60 ℃ for 34 s, 40 cycles; Melting curve: 95 ℃ for 15 s, 60 ℃ for 60 s, 95 ℃ for 15 s.

[0057] (3) Construction of transgenic vectors:

[0058] Primers for constructing transgenic overexpression vectors were designed using Primer Premier 5 primer design software. The primer sequences are as follows: forward primer: CCCAAGCTTATGGTGGTGAAGAGCGGAG (SEQ ID NO: 6) and reverse primer: CCCAAGCTTTGCTGCTGGGTAGTATTGGTT (SEQ ID NO: 7). The primers were synthesized by Nanjing GenScript Biotech Co., Ltd.

[0059] amplification using cDNA from Zhengmai 9023 as a template TaSMT-5B The CDS sequence is given, and the reaction system is as follows:

[0060] Table 4

[0061] Components Dosage <![CDATA[2×Gflex PCR Buffer (Mg 2+ , dNTP plus)]]> 25 µL TKS Gflex DNA Polymerase 1 µL Forward primer (SEQ ID NO: 6) 1.5 µL Reverse primer (SEQ ID NO: 7) 1.5 µL template Approximately 500 ng <![CDATA[ddH2O]]> Add to 50 µL

[0062] PCR program: 94℃ for 3 min; 98℃ for 30 s, 56℃ for 30 s, 68℃ for 1.5 min, 30 cycles; 68℃ for 10 min; product stored at 4℃.

[0063] Agarose gel purification of PCR products:

[0064] 1. Prepare a 2% agarose gel using TAE electrophoresis buffer, adding 1% (v / v) of 0.5 mg / mL EB during gel preparation;

[0065] 2. Add 5 µL of 10× loading buffer to the PCR product, load all samples into the gel wells, spot Trans2k DNA Marker in the empty wells, and electrophoresis at 130 V for 15 min.

[0066] 3. Under ultraviolet light (Bio-RAD), use a clean blade to cut off the gel block (the size of the band should match the size of the target fragment) and place it into a 2.0 mL centrifuge tube;

[0067] 4. Perform the recovery of the target fragment according to the instructions of the gel recovery kit (Sangon Biotech, China).

[0068] Ligation cloning vector pEASY-Blunt3:

[0069] Preparation system:

[0070] Table 5

[0071] Components Dosage Recycle fragments 4µL pEasy-Blunt3 1µL Total 5µL

[0072] PCR program: 25℃ for 30 min.

[0073] The ligation product was transformed into competent E. coli cells:

[0074] 1. Take out the Fast-T1 competent cell suspension and thaw it on ice. Then, take 50 µL of competent cells and mix them with all the products from the previous step. Mix well by pipetting and place on ice for 30 min.

[0075] 2. Place it in a metal bath for heat shock at 42℃ for 1 min 30 s. After heat shock, immediately place it in an ice bath for 3-5 min. Then add 1 mL of LB liquid culture medium, mix well by pipetting, place it in a shaker, set it to 37℃ and 150 rpm, and incubate for 1 h.

[0076] 3. After the culture is completed, centrifuge at 5000 rpm for 5 min, discard the supernatant, and then use a pipette to gently mix the precipitate with the remaining liquid culture medium in the tube. Spread the mixture onto LB solid medium with ampicillin (Amp) resistance, seal the plate with sealing film, and invert it in an incubator at 37°C overnight.

[0077] 4. After obvious E. coli bacteria have grown, select 10 bacterial spots and perform PCR testing to detect positive strains;

[0078] The PCR reaction system is as follows:

[0079] Table 6

[0080] Components Dosage Monoclonal spots 2×Taq Master Mix 5 µL Forward primer (SEQ ID NO: 4) 0.25 µL Reverse primer (SEQ ID NO: 5) 0.25 µL <![CDATA[ddH2O]]> 4 µL

[0081] PCR program: 95℃, 3 min; 95℃, 30 s, 56℃, 30 s, 72℃, 1.5 min, 28 cycles; 72℃, 5 min;

[0082] 5. Identification using 2% agarose gel. Observe under UV light using a gel imaging system (Bio-RAD), select positive clones, place them in LB liquid medium (containing Amp), and incubate overnight at 37°C with a shaker at 180 rpm.

[0083] 6. After the identified positive strains were cultured, the bacterial culture was sent to Genewiz for sequencing (Suzhou, China).

[0084] 7. Use DNAMAN software to compare and verify the sequencing results with the target sequence.

[0085] Select strains with correct sequencing results and extract plasmids according to the instructions of the plasmid DNA mini-extraction kit (China, Sangon Biotech) for enzyme digestion.

[0086] Prepare a 50µL enzyme digestion reaction system with the following components:

[0087] Table 7

[0088] Components Dosage III 2 µL HI 2 µL 10×KCut Buffer 5 µL vector plasmid 1-1.5 µg <![CDATA[ddH2O]]> Add to 50 µL

[0089] PCR program: 37℃ for 2 hours.

[0090] The PCR products were purified by agarose gel extraction and the target fragment was recovered according to the instructions of the gel extraction kit (Sangon Biotech, China).

[0091] Connecting to the pCambia3300 vector:

[0092] Prepare a 10 µL connection system with the following components:

[0093] Table 8

[0094] Components Dosage 10×T4 DNA Ligase Buffer 1 µL T4 Ligase 1 µL Target gene 6 µL Target carrier 2 µL Total 10 µL

[0095] PCR program: 25℃ for 2 h.

[0096] The ligation product was transformed into *E. coli* Fast-T1 competent cells. After overnight plating, 20 single-clone spots from each plate were selected for PCR to detect positive strains. Plasmids were extracted from the positive strains and transformed into *Agrobacterium* EHA105 for the creation of transgenic materials. A simplified diagram of the constructed vector is shown below. Figure 3 As shown in SEQ ID NO:3, the nucleotide sequence of the recombinant vector is shown in SEQ ID NO:3, where CaMV 35S Promoter (enhanced) represents the strong 35S promoter of tobacco mosaic virus; the BlpR gene, i.e. the Bar gene, can confer herbicide resistance to plants.

[0097] (4) Genetic transformation: The creation of transgenic materials was completed by Tianjin Genov Biotechnology Co., Ltd.

[0098] (5) Positive identification of transgenic organisms:

[0099] DNA level identification:

[0100] Extraction of DNA from genetically modified wheat:

[0101] 1. Grind wheat leaves in a mortar with liquid nitrogen, and transfer the thoroughly ground powder to a 2.0 mL centrifuge tube; add 1 mL of 1.5×CTAB extraction solution (1M Tris-HCl (pH 8.0), 0.5M EDTA-Na2 (pH 8.0), 5M NaCl), and shake to mix well;

[0102] 2. Let stand at 70℃ for 1 hour, shaking once every 20 minutes;

[0103] 3. After cooling to room temperature, add 500 μL of chloroform and mix by inverting the container.

[0104] 4. Let stand for 2 minutes, then centrifuge at 12000 rpm for 5 minutes;

[0105] 5. Transfer 600 μL of the supernatant to a 1.5 mL centrifuge tube, add an equal volume of isopropanol, invert to mix, and let stand at -20℃ for 30 min.

[0106] 6. Centrifuge at 12000 rpm for 5 min and discard the supernatant;

[0107] 7. Add 1 mL of 75% ethanol to wash the DNA precipitate, centrifuge at 12000 rpm for 5 min, and discard the supernatant;

[0108] 8. After drying, add 100 μL of ddH2O to dissolve and set aside.

[0109] BAR gene detection: The primers for BAR gene detection are as follows:

[0110] Forward primer: CTACATCGAGACAAGCACGGTCAA (SEQ ID NO: 8)

[0111] Reverse primer: AGAAAACCCACGTCATGCCAGTTC (SEQ ID NO: 9)

[0112] The following PCR procedure was used for detection. The PCR reaction system is as follows:

[0113] Table 9

[0114] Components Dosage 2×Taq Master Mix 5 µL Forward primer (SEQ ID NO: 8) 0.25 µL Reverse primer (SEQ ID NO: 9) 0.25 µL template Approximately 500 ng <![CDATA[ddH2O]]> Add to 10 µL

[0115] PCR program: 95℃, 3 min; 95℃, 30 s, 58℃, 30 s, 72℃, 30 s, 28 cycles; 72℃, 5 min;

[0116] The PCR products were identified using a 2% agarose gel electrophoresis, and the results are shown in Figure 4. The gene detected was the BAR gene. 1#, 2#, 3#, 4#, and 5# represent five transformant lines.

[0117] The results of the expression level assessment are shown in Figure 5.

[0118] Phenotypic analysis of Fusarium head blight:

[0119] Experimental strains and preparation of bacterial culture:

[0120] The Fusarium graminearum strain used in this experiment was the highly pathogenic Fg0865 (15-ADON chemotype), provided by Professor Chen Huaigu of the Jiangsu Academy of Agricultural Sciences. The preparation steps for the inoculum solution are as follows:

[0121] 1. Inoculate the preserved Fusarium graminearum strain onto potato dextrose agar (PDA) solid medium and place it in a 25°C incubator for activation culture for 4-5 days.

[0122] 2. Using a sterilized punch (7 mm in diameter), remove the mycelial blocks from the PDA medium and place them into mung bean soup, one mycelial block per 10 mL of mung bean soup. Place the mixture in a shaker at 25℃ and 150 r / min for 3-5 days to induce sporulation.

[0123] 3. Count the spores under a microscope using a hemocytometer. The spore concentration used for inoculation should be at least 1 × 10⁻⁶. 5 / µL.

[0124] Fusarium head blight inoculation and phenotypic identification:

[0125] In the early flowering stage of wheat, the bacterial solution was injected into the space between the inner and outer glumes of the bilateral florets in the middle of the wheat plant using the double-floret drip method. Fusarium head blight identification was performed 12 days after inoculation. The percentage of symptom spikelets (PSS) was calculated as: symptom-infected spikelets / total number of spikelets. Phenotypic identification and statistical results are as follows: Figure 6 , 7 As shown.

[0126] Figure 1 For China Spring (CS), Zhengmai 9023 and Ximai 1376 TaSMT-5B CDS ( Figure 1 A) and promoter ( Figure 1 B) Sequence alignment diagram, the orange arrow indicates a "GTCGCCG" insertion site in the promoter region of Zhengmai 9023. Figure 2 for TaSMT-5B The spatiotemporal expression patterns in Zhengmai 9023 and Ximai 1376, with TaActin 2 were used as internal reference genes -ΔΔCq The relative expression level is calculated using this method. Figure 5The expression detection of positive lines is shown, where wild type (WT) is the transgenic recipient variety Fielder, and 1#, 2#, 3#, 4# and 5# represent 5 transgenic lines. Figure 6 The wild-type (WT) is the transgenic recipient variety Fielder, and #1, #2, #3, #4, and #5 represent five transgenic lines. The upper part of the figure shows the Fusarium head blight phenotype under the control treatment; the lower part shows the Fusarium head blight phenotype under the inorganic selenium Na₂SeO₄ treatment, with a total root application of 35 mg / L. The scale bar is 2 cm. Figure 7 In this context, "PSS" represents the percentage of symptom spikelets. Each transgenic line was inoculated with at least 10 spikelets for identification. Statistical analysis was performed using the Student-t test. "*" indicates... p < 0.05, "**" indicates p < 0.01. Combining inorganic selenium treatment and overexpression TaSMT-5B The gene can reduce the incidence of diseased spikelets by 20% to 50%.

[0127] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the present invention.

Claims

1. Genes TaSMT-5B Its application in improving wheat scab resistance is characterized by: The TaSMT-5B Wheat varieties with significant resistance to Fusarium head blight were obtained after the gene was introduced into plants; TaSMT-5B Gene overexpression combined with inorganic selenium application; The gene TaSMT-5B The amino acid sequence of the encoded TaSMT-5B protein is shown in SEQ ID NO.2.