Application of Zm00001d014471 gene in improving resistance of corn to northern leaf blight

Abstract

The invention belongs to the field of biotechnology, and specifically discloses an application of the Zm00001d014471 gene in improving resistance to corn leaf blight. The Zm00001d014471 gene sequence is shown in SEQ ID No.1, and the specific application is to improve resistance of corn to corn leaf blight or corn disease resistance breeding. The invention verifies through research that a corn inbred line has the highest Zm00001d014471 gene expression level and the strongest resistance to corn leaf blight. Resistance to corn leaf blight is a quantitative trait regulated by multiple genes. The technical scheme provided by the invention provides a new method for breeding new corn varieties resistant to corn leaf blight by using modern molecular breeding technology.

Description

[0001] Claims 1 to 3 of this application claim the priority of a prior patent application, the application number of the prior patent application is: CN202410004776.4, and the application date is: 2024.01.03. Technical Field

[0002] The invention belongs to the field of biotechnology, and particularly relates to application of Zm00001d014471 gene in improving resistance to corn leaf blight. Background Art

[0003] Corn is the most widely planted crop in the world and an important source of food, feed and industrial raw materials. Corn leaf blight (big leaf blight) is a major leaf disease caused by the fungal pathogen Exserhilum turcicum, which causes serious yield losses worldwide. Big leaf blight often occurs in areas with high temperature and humidity. Big leaf blight resistance is a quantitative trait regulated by multiple genes. Using modern molecular marker-assisted breeding technology to gather as many fragments with big leaf blight resistance as possible from excellent materials is an important means of current breeding. Summary of the invention

[0004] The main purpose of the present invention is to provide an application of a Zm00001d014471 gene in improving resistance to northern leaf blight in corn, thereby providing a new method for improving resistance of corn germplasm.

[0005] To achieve the above objectives, the present invention provides the following technical solutions:

[0006] Application of Zm00001d014471 gene in breeding for resistance to corn leaf blight. The nucleotide sequence of the Zm00001d014471 gene is shown in SEQ ID No.1.

[0007] Preferably, the Zm00001d014471 gene is an overexpressed Zm00001d014471 gene.

[0008] Preferably, the method for breeding corn for resistance to northern leaf blight comprises increasing the content and / or activity of the protein encoded by the sequence shown in SEQ ID No. 1 in the recipient corn, so that the transgenic corn has higher resistance to northern leaf blight than the recipient corn.

[0009] Preferably, the method for breeding corn leaf blight resistance is to inoculate corn leaf blight immune inducer during the corn flare stage.

[0010] Preferably, water is used as the solvent, and each 1 kg of the corn leaf blight immune inducer includes: 400-600 mL of Helicoverpa turcica liquid, 40-60 mL of fermentation supernatant of Bacillus megaterium, 0.5-0.8 g of sodium secondary alkyl sulfonate, 0.1-0.3 g of Tween 80, 20-40 g of potassium humate, and 5-9 g of brassinolide.

[0011] Preferably, the OD600 of the Helicospora macrophyte liquid is 0.3-0.5; the deposit number of the Bacillus megaterium is CGMCC No.17573 (a strain in the prior art).

[0012] Preferably, the method for preparing the fermentation supernatant of Bacillus megaterium is: inoculating Bacillus megaterium into a culture medium for cultivation, and taking the supernatant after centrifugation to obtain the fermentation supernatant of Bacillus megaterium.

[0013] Preferably, the inoculation amount of Bacillus megaterium is 1-2%; the culture medium is beef extract peptone agar medium (Nanjing Dulai Biotechnology Co., Ltd.); the culture temperature is 26-28° C., and the culture time is 5-7 days.

[0014] Preferably, the centrifugal speed is 5000-6000 rpm and the time is 5-7 min.

[0015] Preferably, the preparation method of the corn leaf blight immune inducer is: mix the bacterial liquid of Helicospora turcica and the fermentation supernatant of Bacillus megaterium and let it stand for 30 to 50 minutes, and then add sodium secondary alkyl sulfonate, Tween 80, potassium humate and brassinolide and mix.

[0016] The technical effects achieved by the present invention are:

[0017] Northern leaf blight (Northern leaf blight) is a common corn leaf disease. Studies have shown that breeding disease-resistant varieties is the most effective way to prevent and control Northern leaf blight. The present invention uses an associated population consisting of 797 families, and the gene Zm00001d014471 associated with the molecular marker 5-49193921 with the maximum effect value identified for Northern leaf blight has resistance to Northern leaf blight. Expression analysis was performed on leaves 0 to 20 days after inoculation with Northern leaf blight bacteria, and it was found that the expression level of Zm00001d014471 was positively correlated with resistance to Northern leaf blight. Resistance to Northern leaf blight is a quantitative trait regulated by multiple genes. The technical solution provided by the present invention lays a foundation for breeding new varieties of corn resistant to Northern leaf blight using modern molecular breeding technology.

[0018] The corn leaf blight immune inducer prepared by the present invention uses the bacterial liquid of the corn leaf blight helminth as the antigen base liquid, and the added Bacillus megaterium bacterial liquid has a good passivation effect. Potassium humate and brassinolide have a good promoting effect on the growth of corn. The stress resistance of corn is further improved, and the negative impact of the helminth is alleviated. Sodium secondary alkyl sulfonate and Tween 80 are used as emulsifiers.

[0019] The corn leaf blight immune inducer provided by the invention is a kind of plant vaccine. After being inoculated during the growth period of corn, it can effectively prevent the corn leaf blight, and its prevention and control effect is equivalent to that of the existing technology drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 (a) is the phenotype of resistance to corn leaf blight; (b) is the resistance level of corn leaf blight of each parent; (c) is the distribution diagram of corn leaf blight level of sub-populations;

[0021] Figure 2 This is the FarmCPU model correlation analysis result diagram;

[0022] Figure 3 The results of association analysis of corn leaf blight resistance and the positioning intervals of quantitative trait loci (QTL) of corn leaf blight resistance in four recombinant inbred lines (RIL) populations. The green boxes represent the overlapping intervals of association analysis and linkage analysis positioning; (a) Association analysis showed that single nucleotide polymorphisms (SNPs) were significantly associated with corn leaf blight resistance in multi-parent populations; purple boxes represent positive effect SNPs, and blue circles represent negative effect SNPs; (b) Linkage analysis positioning results of four sub-populations and the effects of QTL intervals on corn leaf blight resistance, RIL_YML1218, RIL_Chang7-2, RIL_Q11 and RIL_YML226 are arranged from outside to inside; (c) SNPs with epistatic effects in the RIL_YML226 sub-population, and red lines represent SNPs with significant epistatic effects;

[0023] Figure 4 The SNP distribution and effect value diagram obtained from the association analysis of 4 RIL sub-populations; a: the number of SNPs for resistance to northern leaf spot disease in 4 RIL sub-populations; b: box plot of the SNP effect value of resistance to northern leaf spot disease in 4 RIL sub-populations; c: comparison of the SNP distribution and effect value of resistance to northern leaf spot disease in the multi-parent population and 4 RIL sub-populations; d: correlation analysis between the haplotype of marker 5-49193921 and resistance to northern leaf spot disease;

[0024] Figure 5a: Relative expression level of Zm00001d014471 gene in leaves of different parents 0d to 20d after artificial inoculation with turcica; b: Expression level of Zm00001d014471 gene in corn leaves on the day of pollination and 12d, 18d, 24d, and 30d after pollination; c: Expression abundance data of Zm00001d014471 gene in corn eFP Stress Browser, red indicates the highest absolute expression level of the gene. DETAILED DESCRIPTION

[0025] To make the purpose, technical scheme and advantages of the present invention clearer, the technical scheme in the present invention is described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work premise belong to the scope of protection of the present invention. Reagents used in the present invention, unless otherwise specified, can all be purchased from the market.

[0026] The maize germplasm materials used in the present invention include maize inbred lines and hybrid varieties thereof, which are important breeding materials or excellent varieties planted on a large scale in my country. Some of them can be obtained from the market, and some of them can be found in the literature: Jiang F, Li WZ, YinX, et al. Impact of donor Q TL on grain yield and grayleaf spot of four recombinant inbred lines of maize [J]. Crop Science, 2020, 60(2): 841-851. or Tianhui K, Can H, Kumar RS, et al. A potenti alcandidate gene associated with the angles of the ear leaf and the second leaf above the earleaf in maize [J]. BMC Plant Biology, 2023, 23(1): 540-540.

[0027] The gene sequence of Zm00001d014471 in the present invention is shown as SEQ ID No.1.

[0028] As some embodiments, the present invention provides a sequence as shown in SEQ ID No. 1 which can be used in a) improving the resistance of corn to northern leaf blight; b) breeding of corn for disease resistance.

[0029] As other embodiments, the protein encoded by the sequence shown in SEQ ID No. 1 can be used in a) improving the resistance of corn to northern leaf blight; b) breeding of corn for disease resistance.

[0030] As some more specific implementations, the application in corn disease resistance breeding is any of the following:

[0031] S1: MAS breeding for genes resistant to northern leaf spot;

[0032] S2: Transgenic breeding for genes resistant to northern leaf spot disease;

[0033] S3: Gene editing breeding for resistance to northern leaf spot disease;

[0034] S4: Molecular marker-assisted breeding of genes for resistance to northern leaf spot disease.

[0035] As a more specific embodiment, the present invention also provides a kit, which contains a product for detecting or overexpressing the sequence shown in SEQ ID No. 1 or its encoded protein.

[0036] As another more specific embodiment, the present invention also provides a recombinant plasmid, which contains the sequence shown in SEQ ID No. 1 or its encoded protein.

[0037] As another more specific embodiment, the present invention provides a method for cultivating transgenic corn with improved resistance to northern leaf blight, the method comprising increasing the content and / or activity of the protein encoded by the sequence shown in SEQ ID No. 1 in the recipient corn, so that the transgenic corn has higher resistance to northern leaf blight than the recipient corn.

[0038] Example 1

[0039] 1 Plant materials and field design

[0040] The pedigrees and ecotypes of the common maize parent Ye107 and the four parents YML226, Q11, YML1218, and Chang7-2 are shown in Table 1. This study was conducted by crossing Ye107 with the four parents, obtaining four RIL subpopulations by single seed descent, and planting with F2:7 seeds. The associated population contained 797 families, including 199 families in RIL_YML1218 (YML1218×Ye107), 199 families in RIL_Chang7-2 (Chang7-2×Ye107), 200 families in RIL_Q11 (Q11×Ye107), and 199 families in RIL_YML226 (YML226×Ye107).

[0041] The associated population and its parents were planted in Jinghong (N27°27′, E100°25′) and Yanshan (N23°62′, E104°33′) in Yunnan in 2021 and 2022. A randomized complete block design was used at both sites, with two replicates each. The field planting spacing was 0.8 m, the row length was 3 m, and single-row planting was carried out with 16 plants per row. Field management was carried out as usual.

[0042] Table 1 Parental pedigrees, heterotic groups and ecological types of multi-parent populations

[0043]

[0044] 2. Identification of resistance to large leaf spot and phenotypic data analysis

[0045] When corn grew to the trumpet stage, artificial inoculation of Exserhilum turcicum was carried out, and the resistance phenotype of corn leaf blight was identified and data was collected 30 days after pollination. The resistance evaluation was divided according to the 9-level method, and the higher the score, the more susceptible to corn leaf blight (Tao et al. 2015).

[0046] 3 Genotype and population genetic analysis

[0047] Maize young leaves were collected from each family of the RIL population to extract DNA and perform whole genome resequencing. DNA libraries were prepared according to standard procedures. Sequencing was performed using the Illumina Hiseq TM platform and then filtered through a quality control program to obtain clean data. The filtered data were then further mapped to the maize reference genome AGPv4 (20) to obtain SNP markers, annotated using SNPeff software (21), and 18.69 million high-quality markers with allele frequency (MAF)>0.5 and missing rate<0.2 were screened.

[0048] 4 Genotype and association analysis and QTL mapping in RIL subpopulations

[0049] A genome-wide association analysis was performed using the above 18.69 million markers combined with the large leaf spot resistance phenotypic data of 797 families in the association population.

[0050] Linkage analysis was performed on the four RIL subpopulations. In this study, genotyping was performed according to the heterozygosity of the parents, and five segregation types were obtained. Markers with no polymorphism or p-value <0.01 between the parents of each RIL population were filtered out, and the JoinMap software (Van Ooijen, 2006) and smooth Algorithm (Van Os et al., 2005) software were used to construct a two-step linkage map for the population for the markers with heterozygous parents. All markers were grouped according to independent LOD values ​​and corrected for genomic location. The maximum likelihood mapping method was used to determine the order of markers in each linkage map. The smoothing algorithm was used to detect low-quality genotypes and assign values ​​to missing values. Repeat the above steps 4 to 5 times to obtain a high-quality genetic map. The Kosambi mapping function was used to convert the recombination frequency into mapping distance. The CIM method in the R / QTL software was used to detect QTLs for resistance to corn leaf blight, and the LOD significance threshold (P<0.05) was determined by 1000 random permutations (Broman et al. 2003).

[0051] 5qPCR reaction system and procedure

[0052] The expression of candidate genes in different resistant materials of northern leaf spot disease was subjected to fluorescence quantitative PCR reaction using Tiangen SuperReal PreMix Plus (SYBR Green) kit (Tiangen, Beijing), and the total reaction system was 20 μL. The expression of candidate gene Zm00001d014471 was identified by the following primer sequences: F-5'TGAGCAGTGTCCGCAACA (as shown in SEQ ID NO.2) and R-5'CCTCTTCAACCATCCCAGTA (as shown in SEQ ID NO.3), and the reaction program was set as follows: 95℃ pre-denaturation for 3min, 95℃ denaturation for 20s, 58℃ annealing and extension for 30s, for a total of 40 cycles; the fluorescence signal was collected during the second stage of annealing and extension (60℃).

[0053] 6 Research Results

[0054] 6.1 Phenotypic identification and distribution of large spot disease

[0055] In 2019, four maize RIL populations (including 797 F2:7 families) were identified for resistance to northern leaf blight in Jinghong City and Yanshan County, Yunnan Province, China, according to the method of Tian et al. (2015), with level 1 being highly resistant, level 3 being resistant, level 5 being moderately resistant, level 7 being susceptible, and level 9 being highly susceptible (Tao et al. 2015) ( Figure 1a). The results showed that the resistance of the parents of the association population to northern leaf spot disease varied greatly. The common parent Ye107 was resistant, YML1218 and Chang7-2 were susceptible, Q11 was highly susceptible, and YML226 was moderately resistant ( Figure 1 b) The four female parents were hybridized with the common male parent Ye107 to obtain an associated population containing 797 families. The resistance distribution of the four subpopulations is shown in the figure. Figure 1 As shown in Figure c, it can be seen that the distribution of the resistance phenotypes of the four sub-populations to big spot disease is similar to the resistance of the parents, that is, the RIL_YML226 (YML226×Ye107) group has the strongest resistance to big spot disease (big spot disease score=3.27), while RIL_Q11 (Q11×Ye107) is the most susceptible (big spot disease score=6.06). In addition, RIL_YML1218 (YML1218×Ye107) and RIL_Chang7-2 (Chang7-2×Ye107) have similar resistance to big spot disease (big spot disease score=4.21 and 4.46), indicating that the resistance of the parents has a great influence on the resistance of the combined population. The distribution of the resistance phenotypes of big spot disease of the four RILs sub-populations used in this study is close to the normal distribution ( Figure 1 c).

[0056] 6.2 Genomic diversity

[0057] After filtering the association population sequencing data, 18,189,449 markers were obtained. These markers are relatively evenly distributed on the 10 chromosomes of maize and can be used for subsequent association analysis and QTL positioning analysis.

[0058] 6.3 Association analysis and QTL mapping for resistance to northern leaf spot

[0059] FarmCPU model was used to perform association analysis on big spot disease, and SNPs with P.value (-log10)>8 and close association with big spot disease were screened out ( Figure 2 ).

[0060] The association analysis found that 18 SNP markers were significantly associated with the resistance to northern leaf spot in the associated population, and the P.value (-log10) of these SNP markers was between 8.50 and 19.38. In order to further confirm the candidate genes screened by the association analysis, we constructed genetic linkage maps and located QTLs for the four RIL subpopulations ( Figure 3). The results showed that 2, 4, 2 and 2 QTLs were located in RIL_YML1218, RIL_Chang7-2, RIL_Q11 and RIL_YML226 populations, respectively (Table 2). Specifically, one QTL was detected on chromosomes 3 and 4 in RIL_YML1218 population, with additive effects of 1.15 and 0.88, respectively, explaining 4.19% of the phenotypic effect; four QTLs were detected on chromosomes 1, 6, 8 and 9 in RIL_Chang7-2 population, explaining 2.85-8.80% of the phenotypic variation; two QTLs were detected on chromosomes 8 and 10 in RIL_Q11 population, explaining 7.83% of the phenotypic variation; QTLs were detected on chromosomes 5 and 9 in RIL_YML226 population, of which the QTL on chromosome 5 explained 9.28% of the phenotypic variation. Comparing the results of linkage analysis with those of association analysis, it was found that markers 1-43673103, 9-11183458, and 9-121083890 were included in qtl-RIL_YML1218-1, respectively, and the physical distance between the QTL interval of 5-49193921 and qtl-RIL_YML226-1 was <1 Mb. These markers for resistance to northern leaf blight and the QTL interval for resistance to northern leaf blight can be regarded as the same candidate functional locus ( Figure 3 ).

[0061] SNP markers 1-43673103, 5-49193921, 9-11183458 and 9-121083890 were associated with 6 candidate genes for resistance to northern leaf blight, which may be functional genes highly correlated with resistance to corn leaf blight (Table 3).

[0062] Table 2 Results of linkage analysis of 4 RIL groups

[0063]

[0064] Table 3 Candidate genes for corn leaf blight identified within the QTL interval

[0065]

[0066] 6.4 Genetic effects on resistance to corn leaf blight

[0067] In view of the above results, this study further conducted association analysis on each RIL population to better clarify the distribution of candidate SNP markers in each population and their resistance effects to northern leaf spot disease. The results showed that a total of 24 SNPs associated with northern leaf spot disease were detected by association analysis of the four subpopulations, of which 11 were detected in the RIL_YML226 population, accounting for 45.9% of all SNPs, while RIL_Chang7-2 and RIL_Q11 had 5 each, and RIL_YML1218 could only be associated with 3 ( Figure 4 a). The study found that the RIL_YML226 subpopulation had the strongest resistance to northern leaf spot disease. Association analysis showed that the RIL_YML226 subpopulation had the largest number of positive effect SNPs among the four subpopulations, and the cumulative positive effect was the highest; while the RIL_Chang7-2 and RIL_Q11 subpopulations had the worst resistance to northern leaf spot disease. Most of the SNPs associated with northern leaf spot disease resistance from these two subpopulations were negative effect SNPs ( Figure 4 b, 4c). Compared with the results of the overall association analysis of the association population, it can be found that the number of SNPs with positive effects on northern leaf spot disease obtained by association analysis using 797 families in the association population is the same as the number of SNPs detected by association analysis using the RIL_YML226 subpopulation alone (both are 9), and the number of positive effect SNPs detected in the RIL_YML226 subpopulation accounts for 81.9% of the total number of all northern leaf spot disease resistance SNPs ( Figure 4 a), indicating that the RIL_YML226 subpopulation has the strongest resistance to northern leaf spot disease in the associated population and contributes the most effect values ​​to the detection of northern leaf spot disease resistance loci in the associated population.

[0068] The results of the association analysis of the four RIL populations were further compared with the results of the linkage analysis. It was found that three SNPs were located in the QTL positioning interval, including 10-40362913 detected by RIL_Q11 and 5-49193921 and 9-11706790 detected by RIL_YML226 (Table 4). Among them, marker 5-49193921 was the only consistent site in the association analysis of the association population and the four RIL subpopulations, and it was also detected in the QTL positioning analysis. It is speculated that this site is a candidate hotspot site for resistance to northern leaf spot disease. The three haplotypes (CC, AA and CA) present at this site are closely related to resistance to northern leaf spot disease, among which haplotype CC can significantly increase resistance to northern leaf spot disease ( Figure 4 d). The gene Zm00001d014471 associated with this marker encodes a PPR protein that is related to the post-transcriptional regulation of organelle genes and is a key candidate gene in this study.

[0069] Table 4 Comparison of association and linkage analysis results among 4 RIL groups

[0070]

[0071]

[0072] 6.5 Expression of candidate genes in different materials

[0073] In order to verify the resistance of candidate gene Zm00001d014471 to northern leaf spot disease in the candidate hotspot area, this study used fluorescent quantitative PCR to analyze the expression of Zm00001d014471 gene on leaves of five parents from 0d to 20d after artificial inoculation with northern leaf spot pathogen. The results showed that on the day of artificial inoculation with northern leaf spot pathogen (0d), the expression level of this gene in corn ear leaves was low, and it increased significantly on the 5th day. From the 10th day on, the expression level of Zm00001d014471 gene fell again. However, on the 20th day, the expression level of this gene increased significantly ( Figure 5 a). Stelpflug et al. (2016) showed that the expression level of Zm00001d014471 gene in leaves was low at 0 days after pollination, but the expression level increased significantly from 12 days after pollination ( Figure 5 b). In this study, the inoculation of the ground blight pathogen occurred at the flaring stage of corn, and the corn entered the pollination stage about 20 days after inoculation. Therefore, the increase in the expression of the gene 20 days after inoculation is presumably related to the pollination of the plant. The Zm00001d014471 gene encodes a PPR protein, which regulates plant growth and development by participating in RNA processing in terrestrial plants (Barkan, 2014). In corn, PPR proteins have been shown to be related to the stress resistance mechanism of corn. Data from corn eFP Stress showed that the Zm00001d014471 gene was highly expressed in corn roots, stems, and leaves when facing abiotic and biotic stresses. In particular, when infected by cercospora zeina, the Zm00001d014471 gene was expressed most highly in corn leaves. When infected by Colletotrichum graminicola, its expression also increased significantly ( Figure 5 c), indicating that the Zm00001d014471 gene has a resistance response to a variety of corn leaf diseases. This study proves that the Zm00001d014471 gene also has a significant effect on improving resistance to corn leaf blight.

[0074] This study combines association analysis with linkage analysis, which is a more reliable method for candidate gene mining. These two methods can not only verify each other to a certain extent, but also complement resistance sites. Using this method, it was discovered from multiple angles that marker 5-49193921 on chromosome 5 of maize is closely related to resistance to corn leaf blight.

[0075] This study suggests that the PPR protein encoded by the Zm00001d014471 gene associated with marker 5-49193921 detected in the RIL_YML226 subpopulation is related to resistance to corn leaf blight, and its increased expression in leaves can help increase resistance to corn leaf blight. YML226 is an inbred line selected from tropical CATETO germplasm. Because tropical corn faces complex and changeable natural environments and disease stress during its growth, it has retained more favorable disease resistance genes in the long-term evolution process. The corn hybrids bred with YML226 also retain the excellent resistance of YML226.

[0076] Example 2

[0077] A corn leaf blight immune inducer, using water as a solvent, wherein 1 kg of the corn leaf blight immune inducer comprises: 400 mL of a bacterial liquid of Helicospora euphorbiae, 40 mL of a fermentation supernatant of Bacillus megaterium, 0.5 g of sodium secondary alkyl sulfonate, 0.1 g of Tween 80, 20 g of potassium humate, and 5 g of brassinolide;

[0078] The concentration of the Helicospora macrophyte solution is 100,000 spores / mL;

[0079] The preparation method of the fermentation supernatant of Bacillus megaterium is as follows: Bacillus megaterium (CGMCC No. 17573) is inoculated into beef extract peptone agar medium at a 1% inoculation amount, cultured at 26° C. for 7 days, and centrifuged at 5000 rpm for 5 minutes to obtain the fermentation supernatant of Bacillus megaterium.

[0080] The preparation method of the corn leaf blight immune inducer is as follows: mixing the bacterial liquid of Helicospora euphorbiae and the fermentation supernatant of Bacillus megaterium and standing for 30 minutes, and then adding water, sodium secondary alkyl sulfonate, Tween 80, potassium humate and brassinolide and mixing.

[0081] Example 3

[0082] A corn leaf blight immune inducer, using water as a solvent, wherein 1 kg of the corn leaf blight immune inducer comprises: 600 mL of a bacterial liquid of Helicospora euphorbiae, 60 mL of a fermentation supernatant of Bacillus megaterium, 0.8 g of sodium secondary alkyl sulfonate, 0.3 g of Tween 80, 40 g of potassium humate, and 9 g of brassinolide;

[0083] The concentration of the Helicospora macrophyte solution is 800,000 spores / mL;

[0084] The preparation method of the fermentation supernatant of Bacillus megaterium is as follows: Bacillus megaterium (CGMCC No. 17573) is inoculated into beef extract peptone agar medium at a 2% inoculation amount, cultured at 28° C. for 7 days, and centrifuged at 6000 rpm for 7 minutes to obtain the fermentation supernatant of Bacillus megaterium.

[0085] The preparation method of the corn leaf blight immune inducer is as follows: mixing the bacterial liquid of Helicospora euphorbiae and the fermentation supernatant of Bacillus megaterium and standing for 50 minutes, and then adding water, sodium secondary alkyl sulfonate, Tween 80, potassium humate and brassinolide and mixing.

[0086] Example 4

[0087] A corn leaf blight immune inducer, using water as a solvent, wherein 1 kg of the corn leaf blight immune inducer comprises: 500 mL of a bacterial solution of Helicospora euphorbiae, 50 mL of a fermentation supernatant of Bacillus megaterium, 0.7 g of sodium secondary alkyl sulfonate, 0.2 g of Tween 80, 30 g of potassium humate, and 8 g of brassinolide;

[0088] The concentration of the Helicospora macrophyte solution is 400,000 spores / mL;

[0089] The preparation method of the fermentation supernatant of Bacillus megaterium is as follows: Bacillus megaterium (Bacillus megaterium Sneb85, CGMCC No.17573) is inoculated into beef extract peptone agar medium at 2% in an inoculation amount, cultured at 27°C for 6 days, and centrifuged at 5500rpm for 6 minutes to obtain the fermentation supernatant of Bacillus megaterium.

[0090] The preparation method of the corn leaf blight immune inducer is as follows: mixing the bacterial liquid of Helicospora caudatus and the fermentation supernatant of Bacillus megaterium and standing for 40 minutes, and then adding water, sodium secondary alkyl sulfonate, Tween 80, potassium humate and brassinolide and mixing.

[0091] Example 5

[0092] In order to verify the effect of the corn leaf blight immune inducer prepared in Example 4 on the expression level of the Zm00001d014471 gene, the present invention designed the following experiment:

[0093] At the flaring stage of corn, the immune inducer was sprayed for inoculation (sprayed until water just dripped on the leaf surface) as the experimental group. The expression of Zm00001d014471 gene was analyzed by fluorescence quantitative PCR on the leaves of Ye107 parent 0 to 20 days after artificial inoculation with the immune inducer of corn leaf blight. The results were measured three times and the average value was taken. Spraying with clear water was used as the control. The results are shown in Table 5.

[0094] Table 5 Gene expression

[0095] Group Experimental Group Control group No. 0d 0.9 1.0 1d 3.9 1.1 No. 3d 5.8 1.3 No. 5d 5.6 1.4 10d 5.2 1.2 15d 6.9 2.1 20th day 5.2 1.8

[0096] The results showed that on the day of artificial inoculation of the large leaf spot pathogen (0d), the expression level of the gene in the corn ear was low, and after inoculation of the immune inducer, the expression level of the gene increased significantly. This shows that the immune inducer provided by the present invention has the technical effect of significantly increasing the expression level of the Zm00001d014471 gene. And the gene expression level does not change significantly over time.

[0097] Example 6

[0098] In order to verify the use effect of the corn leaf blight immune inducer prepared in Example 4, the present invention designed the following experiment:

[0099] A corn planting experiment was conducted in a planting area with a high incidence of corn leaf blight. The planting variety was the susceptible variety Chang7-2. Three plots were planted in each treatment group, and each plot did not affect each other.

[0100] At the tassel stage of corn, the Chang7-2 parent was artificially inoculated with corn leaf blight immune inducer (sprayed until water just dripped on the leaf surface), and inoculated again every 10 days, for a total of three times, as the experimental group.

[0101] At the corn flare stage, the same method as in Example 1 was used to inoculate the northern blight pathogen (the concentration of the northern blight pathogen Helminthosporium spores was 400,000 spores / mL) as control group 1; and the control group 2 was sprayed with clean water.

[0102] Prior art group: During the corn flaring period, 70% mancozeb was used for foliar spraying (spraying until water just dripped from the leaf surface).

[0103] In the later stage of the occurrence of corn leaf blight, the disease level of corn leaf blight in each plot was investigated (level 1 is highly resistant, level 3 is resistant, level 5 is moderately resistant, level 7 is susceptible, and level 9 is highly susceptible), and the average disease level was calculated. The results are shown in Table 6.

[0104] Table 6 Average big spot disease grade

[0105] Group Average disease grade Experimental Group 3.55 Control group 1 7.83 Control group 2 3.16 Existing Technology Group 3.85

[0106] It can be seen from the contents recorded in Table 6 that the drug provided by the present invention can effectively prevent and treat corn leaf blight, and its use effect is equivalent to that of the drugs in the prior art.

[0107] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Overexpression Zm00001d014471 The application of the gene in breeding for resistance to corn leaf blight is characterized in that: Said Zm00001d014471 The nucleotide sequence of the gene is shown in SEQ ID No. 1; The overexpression Zm00001d014471 The genetic method is to inoculate corn leaf blight immune inducer at the corn flaring stage; Taking water as solvent, each 1kg of the corn leaf blight immune inducer comprises: 400-600mL of Helicospora euphorbiae liquid, 40-60mL of fermentation supernatant of Bacillus megaterium, 0.5-0.8g of sodium secondary alkyl sulfonate, 0.1-0.3g of Tween 80, 20-40g of potassium humate, and 5-9g of brassinolide; The concentration of the bacterial solution of the Bacillus megaterium is 100,000 to 800,000 spores / mL; the preservation number of the Bacillus megaterium is CGMCC No.17573.

2. The application according to claim 1, characterized in that: The method for preparing the fermentation supernatant of Bacillus megaterium is as follows: Bacillus megaterium is inoculated into a culture medium for cultivation, and the supernatant is taken after centrifugation to obtain the fermentation supernatant of Bacillus megaterium.

3. The application according to claim 2, characterized in that: The inoculation amount of Bacillus megaterium is 1-2%; the culture medium is beef extract peptone agar culture medium; the culture temperature is 26-28° C., and the culture time is 5-7 days.

4. The application according to claim 2, characterized in that: The centrifugal speed is 5000-6000 rpm and the time is 5-7 min.

5. The use according to claim 1, characterized in that: The preparation method of the corn leaf blight immune inducer is as follows: mixing the bacterial liquid of Helicospora turcica and the fermentation supernatant of Bacillus megaterium and standing for 30 to 50 minutes, and then adding sodium secondary alkyl sulfonate, Tween 80, potassium humate and brassinolide and mixing.

Images