KASP molecular marker linked to pumpkin flavor substance 2-acetyl-1-pyrroline and its application

Abstract

The invention discloses an application of a KASP molecular marker linked to a pumpkin flavor substance 2-acetyl-1-pyrroline in detecting or screening pumpkin germplasm resources containing 2-acetyl-1-pyrroline, wherein the KASP molecular marker is located at position 712637 of chromosome 10 of a Chinese pumpkin genome, and the base at the position is T or C. The KASP molecular marker and the amplification primer set thereof can be used to accurately detect whether the pumpkin germplasm resources contain the flavor substance 2-acetyl-1-pyrroline, effectively improve the efficiency of flavor substance judgment, and reduce the manpower, material resources, and financial resources for planting non-target breeding resources.

Description

Technical Field

[0001] The invention belongs to the technical field of crop genetic breeding, and in particular relates to a KASP molecular marker linked to a pumpkin flavor substance 2-acetyl-1-pyrroline and an application thereof. Background Art

[0002] Pumpkin (Cucurbit moschata) is one of the important melon crops in the Cucurbitaceae family. It plays an important role in the dietary structure of residents and has broad market prospects and important economic value.

[0003] The aroma of the fruit can attract the attention of consumers and stimulate their desire to consume. At the same time, the aroma is also an important indicator of the flavor quality of pumpkin. The aroma substance 2-acetyl-1-pyrroline (2-AP) exists in special pumpkin resources, giving pumpkin a special aroma quality. Previous studies have found that the substance can be detected in both fruits and leaves. In addition, 2-AP is also a characteristic contributor to special-flavor winter melons and cucumbers. To detect 2-AP substances, GC-MS technology is required, which is time-consuming and costly. Through genotype judgment, materials containing substances such as 2-AP can be quickly screened, greatly improving efficiency.

[0004] Therefore, it is very necessary to deeply explore and utilize molecular markers closely linked to the pumpkin flavor substance 2-acetyl-1-pyrroline to promote the creation of new pumpkin germplasm resources and the breeding of new varieties containing 2-AP substances, and accelerate the process of pumpkin molecular breeding. Summary of the invention

[0005] Based on this, the purpose of the present invention is to provide a KASP molecular marker linked to the pumpkin flavor substance 2-acetyl-1-pyrroline and its application; the KASP molecular marker of the present invention can be used to well type pumpkin plants containing 2-AP and those not containing 2-AP.

[0006] The specific technical solutions for achieving the above-mentioned invention objectives include the following.

[0007] The first aspect of the present invention provides an application of a KASP molecular marker linked to a pumpkin flavor substance 2-acetyl-1-pyrroline in detecting or screening pumpkin germplasm resources containing 2-acetyl-1-pyrroline, wherein the KASP molecular marker is located at position 712637 of chromosome 10 of the Chinese pumpkin genome, where the base is T or C.

[0008] In a second aspect of the present invention, a primer for amplifying a KASP molecular marker linked to the pumpkin flavor substance 2-acetyl-1-pyrroline is provided, comprising an upstream primer F having a sequence as shown in SEQ ID NO:1, a downstream primer Ra having a sequence as shown in SEQ ID NO:2, and a downstream primer Rg having a sequence as shown in SEQ ID NO:3.

[0009] The third aspect of the present invention provides the use of amplification primers of KASP molecular markers linked to the pumpkin flavor substance 2-acetyl-1-pyrroline in detecting or screening pumpkin germplasm resources containing 2-acetyl-1-pyrroline, assisting breeding of pumpkin varieties containing 2-acetyl-1-pyrroline, or preparing a kit for detecting or screening pumpkin germplasm resources containing 2-acetyl-1-pyrroline.

[0010] The fourth aspect of the present invention provides a kit for detecting or screening pumpkin germplasm resources containing 2-acetyl-1-pyrroline, comprising amplification primers of the KASP molecular marker linked to the pumpkin flavor substance 2-acetyl-1-pyrroline.

[0011] The fifth aspect of the present invention provides a method for detecting pumpkin germplasm resources containing 2-acetyl-1-pyrroline, characterized in that it includes the following steps: using the DNA of the pumpkin to be tested as a template, performing PCR amplification with the above-mentioned amplification primers, and then analyzing the genotyping data.

[0012] The sixth aspect of the present invention provides a method for screening pumpkin germplasm resources containing 2-acetyl-1-pyrroline, comprising the following steps: using the DNA of the pumpkin to be tested as a template, performing PCR amplification with the above-mentioned amplification primers, and then screening pumpkin germplasm resources with a genotype of TT.

[0013] The invention creates an F2 segregation population through pumpkin resources containing a fragrance substance 2-acetyl-1-pyrroline and pumpkin resources not containing the fragrance substance 2-acetyl-1-pyrroline, constructs a high-density linkage genetic map, and finds a SNP site at 712637 of chromosome 10. The site is T in pumpkin germplasm resources containing the fragrance substance 2-acetyl-1-pyrroline and is C in pumpkin germplasm resources not containing the fragrance substance 2-acetyl-1-pyrroline. Therefore, the site is a KASP molecular marker linked to the pumpkin fragrance substance 2-acetyl-1-pyrroline. The KASP molecular marker and an amplification primer set thereof can accurately detect whether the pumpkin germplasm resources contain the fragrance substance 2-acetyl-1-pyrroline, can effectively improve the fragrance substance judgment efficiency, and reduce the planting manpower, material resources and financial resources of non-target breeding resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1This is the total ion current diagram of volatile substances in the fruits of the two parents in Example 1 of the present invention; wherein the red area is the detection result of the 2-AP compound.

[0015] Figure 2 This is the location of the 2-AP-controlled gene in Example 1 of the present invention; wherein the plus sign and minus sign in the figure represent the detection of 2-AP and the non-detection of 2-AP, respectively.

[0016] Figure 3 This is the genotyping result of the F2 individual plant in Example 1 of the present invention.

[0017] Figure 4 F in Example 1 of the present invention 2：3 Genotyping results of individual plants.

[0018] Figure 5 This is the genotyping result of the breeding individual plants in Example 2 of the present invention. DETAILED DESCRIPTION

[0019] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0020] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0021] Unless otherwise specified, the examples are based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2013), or the conditions recommended by the manufacturer's instructions.

[0022] In the present invention, F2 segregating populations were created from pumpkin resources containing 2-acetyl-1-pyrroline (2-AP) and pumpkin resources not containing 2-AP, and a high-density linkage genetic map was constructed. 2:3The genotype and phenotype of the individual plants located the 2-AP control gene in the 53.87 kb (700951-754816) segment on chromosome 10 of Chinese pumpkin. The two parents were resequenced to find SNP sites in the 2-AP control gene location interval. There was a SNP at 712637 on chromosome 10. This site was T in pumpkin resources containing 2-AP substances and C in pumpkin resources without 2-AP substances. It can be used as a KASP molecular marker. Furthermore, amplification primers were designed at this site. Through this SNP site and primers, the 2-AP control gene was expressed in the parents, F2, and F 2:3 The results of the validation of the KASP molecular marker and primer set in the isolated population showed that the genotype and phenotype 2-AP were 100% consistent. Therefore, the KASP molecular marker and primer set can be applied to the detection of pumpkin containing / not containing 2-AP substances, and can well type the parents and genetic isolated population plants, effectively improve the efficiency of aroma substance judgment, and reduce the manpower, material and financial resources of non-target breeding resources.

[0023] In some embodiments of the present invention, a KASP molecular marker linked to the pumpkin flavor substance 2-acetyl-1-pyrroline is used in detecting or screening pumpkin germplasm resources containing 2-acetyl-1-pyrroline. The KASP molecular marker is located at position 712637 of chromosome 10 of the Chinese pumpkin genome, where the base is T or C.

[0024] In other embodiments of the present invention, a kind of amplification primers of KASP molecular marker linked to pumpkin flavor substance 2-acetyl-1-pyrroline are disclosed, including upstream primer F as shown in SEQ ID NO:1, downstream primer Ra as shown in SEQ ID NO:2, and downstream primer Rg as shown in SEQ ID NO:3.

[0025] In other embodiments of the present invention, the use of the amplification primers of the KASP molecular marker linked to the pumpkin flavor substance 2-acetyl-1-pyrroline in detecting or screening pumpkin germplasm resources containing 2-acetyl-1-pyrroline is disclosed.

[0026] In other embodiments of the present invention, the use of the amplification primers of the KASP molecular marker linked to the pumpkin flavor substance 2-acetyl-1-pyrroline in assisted breeding of pumpkin varieties containing 2-acetyl-1-pyrroline is disclosed.

[0027] In other embodiments of the present invention, the use of the amplification primers of the KASP molecular marker linked to the pumpkin flavor substance 2-acetyl-1-pyrroline in the preparation of a kit for detecting or screening pumpkin germplasm resources containing 2-acetyl-1-pyrroline is disclosed.

[0028] In other embodiments of the present invention, a kit for detecting or screening pumpkin germplasm resources containing 2-acetyl-1-pyrroline is disclosed, comprising amplification primers of the KASP molecular marker linked to the pumpkin flavor substance 2-acetyl-1-pyrroline.

[0029] In other embodiments of the present invention, a method for detecting pumpkin germplasm resources containing 2-acetyl-1-pyrroline is disclosed, comprising the following steps: using the DNA of the pumpkin to be tested as a template, performing PCR amplification with the above-mentioned amplification primers, and analyzing the genotyping data.

[0030] In some embodiments, the analyzing genotyping data comprises the following steps: when the genotype is TT, the pumpkin to be tested contains 2-acetyl-1-pyrroline; when the genotype is CC, the pumpkin to be tested does not contain 2-acetyl-1-pyrroline; when the genotype is CT, the pumpkin to be tested does not contain 2-acetyl-1-pyrroline.

[0031] In other embodiments of the present invention, a method for screening pumpkin germplasm resources containing 2-acetyl-1-pyrroline is disclosed, comprising the following steps: using the DNA of the pumpkin to be tested as a template, performing PCR amplification with the above-mentioned amplification primers, and then screening pumpkin germplasm resources with a genotype of TT.

[0032] In some embodiments, the PCR amplification reaction system includes: 2x PARMS master mix 5.0±0.1μL, 9μM~11μM upstream primer F 0.4μL±0.01μL, 9μM~11μM downstream primer Ra 0.15μL±0.01μL, 9μM~11μM downstream primer Rg 0.15μL±0.01μL, DNA template 10ng~100ng, and ddH2O added to 10μL.

[0033] In some of the embodiments, the reaction procedure of the PCR amplification is: 94°C, 15 min; 94°C, 20 s, 65-57°C, 1 min, 10 cycles; 94°C, 20 s, 57°C, 1 min, 30 cycles.

[0034] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0035] Example 1 Localization of 2-AP Controlled Genes in Pumpkin Fruit and Development of KASP Molecular Markers

[0036] The following steps are involved:

[0037] 1. Test materials

[0038] The taro pumpkin (female parent) containing 2-AP substances and the honey early pumpkin (male parent) without 2-AP substances selected and preserved by the Vegetable Research Institute of Guangdong Academy of Agricultural Sciences were used as parents (the total ion current of volatile substances in the fruit is as follows Figure 1 As shown in Figure 2, the two parents are crossed to obtain F1, and F1 is self-pollinated to obtain F2 segregating population. F2 recombinant plants are self-pollinated to obtain F 2:3 group.

[0039] 2. Localization of genes controlled by pumpkin 2-AP

[0040] In the spring of 2019, the F2 segregating population was planted, the 2-AP content of F2 plants was determined, and extreme phenotype pools containing 2-AP and not containing 2-AP were constructed. Each pool included 25 F2 plants. The 2-AP control gene was initially located on chromosome 10 using BSA-seq technology combined with the Euclidean distance (ED) algorithm. The segment size was 3.20Mb, between 0Mb and 3.20Mb on the chromosome. Subsequently, in order to further narrow the location segment, KASP molecular markers were developed at both ends and inside of the location segment (3.20Mb), encrypted markers, and combined with F2 and F 2:3 The results of the genotypes of individual plants in the segregation population and the 2-AP phenotype narrowed the control gene location segment generated by 2-AP to a range of 53.87 kb (700951-754816) ( Figure 2 ).

[0041] 3. Development of KASP molecular markers tightly linked to the aroma substance 2-acetyl-1-pyrroline

[0042] According to the whole genome resequencing information of the two parents, the SNP sites within the 2-AP control gene positioning interval (700951-754816) were obtained. There was a SNP at 712637 on chromosome 10. This site was T in the pumpkin resource parent containing 2-AP substances and C in the pumpkin resource parent without 2-AP substances. For this SNP site, the upstream primer F and the downstream primers Ra and Rg (the downstream primers Ra and Rg were connected with fluorescent groups FAM and HEX, respectively) were designed for genotype detection.

[0043] Upstream primer F (SEQ ID NO: 1):

[0044] AGAAGAAGAGTAGAAGCCAGAAGTGT

[0045] Downstream primer Ra (SEQ ID NO: 2):

[0046] GAAGGTGACCAAGTTCATGCTTCTCGCTTTCTCTGACTGACACA;

[0047] Downstream primer Rg (SEQ ID NO: 3):

[0048] GAAGGTCGGAGTCAACGGATTCTCGCTTCTCTGACTGACACG;

[0049] The above primers were used for PCR amplification of two parents, 11 F2 strains, 94 F 2:3 Individual strains of the population were tested, and the PCR amplification system was as follows: 2x PARMS mastermix 5μL, upstream primer F (10μM) 0.4μL, downstream primers Ra and Rg (10μM) 0.15μL each, DNA template 10-100ng, total volume 10μL. The PCR amplification program was as follows: 94℃, 15min; 94℃, 20s, 65-57℃, 1min, 10 cycles; 94℃, 20s, 57℃, 1min, 30 cycles.

[0050] Results Figure 3 (Each plant was tested 3 times) and Figure 4 In the figure, the samples aggregated on the X-axis and with blue fluorescence signals are genotype FAM (base is T), and 2-AP is detected in the samples; the samples aggregated on the Y-axis and with green fluorescence signals are genotype HEX (base is C), and 2-AP is not detected in the samples; the samples aggregated in the middle and with red fluorescence signals are heterozygous genotypes (base is T / C), and 2-AP is not detected in the samples; the gray is the blank control (some blank controls show that the signal cannot be determined during the test, and are shown in black in the figure). The results showed that in the two parents and 11 F2 plants, the two parents and 94 F 2：3 Among the individual plants, 8 and 68 plants contained 2-AP (the relative content of 2-AP in leaves at the seedling stage was 1.84 ng / g to 11.76 ng / g, detected by GC-MS method, reference: Li Junxing et al., Analysis of aroma components and characteristics of taro pumpkin leaves based on headspace solid phase microextraction combined with gas chromatography-mass spectrometry. Journal of Zhejiang University (Agriculture and Life Sciences), 2019, 45(2): 175-180), and their genotypes at locus 712637 were all T. The male individual plant did not contain 2-AP, and its genotype at locus 712637 was C; 4 F2 individual plants did not contain 2-AP, and their genotypes at locus 712637 were T / C heterozygous; 27 F 2:3 Individual strains did not contain 2-AP, and their genotype at locus 712637 was heterozygous T / C (19 strains) or homozygous C (8 strains) ( Figure 4 ). The genotype and phenotype of 2-AP were consistent with each other 100%.

[0051] Therefore, the KASP molecular marker and primers developed using the SNP loci of the present invention can separate the individual plants containing 2-AP from those not containing 2-AP, and can well type the individual plants of the parental and genetically isolated populations. Example 2 Practical application of the KASP molecular marker of Example 1

[0052] The KASP molecular marker and primers thereof of Example 1 were applied to the screening and detection of improved breeding materials containing 2-AP substances.

[0053] In the spring of 2024, the primers in Example 1 were used to detect 48 pumpkin plants from 7 resources (all selected and preserved by the Vegetable Research Institute of Guangdong Academy of Agricultural Sciences) (the method is the same as that in Example 1). The results are as follows: Figure 5 As shown in the figure, the samples aggregated on the X-axis and with blue fluorescent signals are of the genotype FAM (base is T), and 2-AP is detected in the samples; the samples aggregated on the Y-axis and with green fluorescent signals are of the genotype HEX (base is C), and 2-AP is not detected in the samples; the samples aggregated in the middle and with red fluorescent signals are of the heterozygous genotype (base is T / C), and 2-AP is not detected in the samples; the gray ones are blank controls (some blank controls show signals that cannot be determined during detection, and are shown in black in the figure).

[0054] from Figure 5 The results showed that there were 46 plants with homozygous T genotype, 1 plant with homozygous C genotype and 1 plant with heterozygous T / C genotype. According to the detection of 2-AP content, the plants with homozygous T genotype contained 2-AP (the relative content of 2-AP in the fruit was 20.1ng / g~219ng / g), while no 2-AP was detected in the plants with homozygous C genotype and heterozygous T / C genotype.

[0055] Therefore, the KASP molecular marker of the present invention can efficiently and accurately screen individual plants containing 2-AP, thereby improving the efficiency of screening varieties with aroma traits.

[0056] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0057] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A primer for amplifying a KASP molecular marker linked to the pumpkin flavor substance 2-acetyl-1-pyrroline, characterized in that: It includes an upstream primer F whose sequence is shown in SEQ ID NO:1, a downstream primer Ra whose sequence is shown in SEQ ID NO:2, and a downstream primer Rg whose sequence is shown in SEQ ID NO:

3.

2. Use of the amplification primers of the KASP molecular marker linked to the pumpkin flavor substance 2-acetyl-1-pyrroline as claimed in claim 1 in detecting or screening pumpkin germplasm resources containing 2-acetyl-1-pyrroline; when the genotype is TT, the pumpkin germplasm resources contain 2-acetyl-1-pyrroline, and when the genotype is CC or CT, the pumpkin germplasm resources do not contain 2-acetyl-1-pyrroline.

3. Use of the amplification primers of the KASP molecular marker linked to the pumpkin flavor substance 2-acetyl-1-pyrroline as claimed in claim 1 in assisted breeding of pumpkin varieties containing 2-acetyl-1-pyrroline; when the genotype is TT, the pumpkin variety contains 2-acetyl-1-pyrroline, and when the genotype is CC or CT, the pumpkin variety does not contain 2-acetyl-1-pyrroline.

4. Use of the amplification primers of the KASP molecular marker linked to the pumpkin flavor substance 2-acetyl-1-pyrroline according to claim 1 in the preparation of a kit for detecting or screening pumpkin germplasm resources containing 2-acetyl-1-pyrroline; when the genotype is TT, the pumpkin variety contains 2-acetyl-1-pyrroline, and when the genotype is CC or CT, the pumpkin variety does not contain 2-acetyl-1-pyrroline.

5. A kit for detecting or screening pumpkin germplasm resources containing 2-acetyl-1-pyrroline, characterized in that: The invention comprises the amplification primers of the KASP molecular marker linked to the pumpkin flavor substance 2-acetyl-1-pyrroline as claimed in claim 1.

6. A method for detecting pumpkin germplasm resources containing 2-acetyl-1-pyrroline, characterized in that: The following steps are involved: The DNA of the pumpkin to be tested is used as a template, and PCR amplification is performed with the amplification primers described in claim 1, and then the genotyping data is analyzed; when the genotype is TT, the pumpkin to be tested contains 2-acetyl-1-pyrroline; when the genotype is CC or CT, the pumpkin to be tested does not contain 2-acetyl-1-pyrroline.

7. A method for screening pumpkin germplasm resources containing 2-acetyl-1-pyrroline, characterized in that: The following steps are involved: The DNA of the pumpkin to be tested is used as a template, and PCR amplification is performed using the amplification primers described in claim 1 to screen pumpkin germplasm resources with a genotype of TT.

8. The method according to claim 6 or 7, characterized in that: The PCR amplification reaction system includes: 2 xPARMS master mix 5.0±0.1μL, 9 μM~11 μM upstream primer F 0.4 μL ± 0.01 μL, 9 μM~11 μM downstream primer Ra 0.15 μL ± 0.01 μL, 9 μM~11 μM downstream primer Rg 0.15 μL ± 0.01 μL, DNA template 10ng~100ng, ddH2O added to 10 μL; and / or, The reaction program of the PCR amplification is: 94°C, 15 min; 94°C, 20 s, 65-57°C, 1 min, 10 cycles; 94°C, 20 s, 57°C, 1 min, 30 cycles.

Images