Application of NbPGL protein in prevention and treatment of tomato chlorotic virus disease

Abstract

The invention relates to the technical field of biotechnology and crop disease prevention and treatment, in particular to application of NbPGL protein in prevention and treatment of tomato chlorotic virus diseases. It is found that the NbPGL protein and the coding gene thereof play an important role in ToCV infection and proliferation, are dominant anti-ToCV antiviral genes coded by host plants, can be used for preventing and treating tomato chlorotic virus diseases caused by ToCV, and can be used for ToCV-resistant / ToCV-resistant molecular breeding and other work. According to the invention, a basis can be provided for researching the effect of plant protein in virus infection and the fields of antiviral breeding and the like, the antiviral research level of solanaceous vegetables is improved, and the production safety of solanaceous vegetables is ensured and promoted.

Description

Technical Field

[0001] The present invention relates to the technical field of biotechnology and crop disease prevention and control, and in particular to application of NbPGL protein in the prevention and control of tomato chlorosis virus disease. Background Art

[0002] Tomatoes, peppers and other crops are important solanaceous vegetable crops. In recent years, the occurrence of tomato chlorosis virus (ToCV) has been increasing year by year. ToCV infection causes plant leaves to turn green and fruit yields to decrease, posing a serious threat to the high and stable yields of crops such as tomatoes. Since there are no resistant / disease-tolerant varieties and no effective control agents, it is urgent to identify disease-resistant genes and develop resistant materials in order to sustainably and more effectively control ToCV and its hazards and ensure the production safety of tomatoes and other solanaceous vegetables.

[0003] As an intracellular obligate parasite, plant viruses must rely on and assist host factors to complete life processes such as virus uncoating, genome replication, protein expression, virus particle assembly, and movement to neighboring cells during infection and proliferation. Therefore, identifying host factors involved in plant virus infection and proliferation can help us gain a deeper understanding of the virus's infection and pathogenicity mechanisms, thereby providing new materials and theoretical basis for the prevention and control of viral diseases. Summary of the invention

[0004] In a first aspect, the present invention provides the use of NbPGL protein, or its encoding gene, or biological materials containing its encoding gene in regulating the expression of tomato chlorosis virus;

[0005] The amino acid sequence of the NbPGL protein is shown in SEQ ID No.1.

[0006] In a second aspect, the present invention provides an application of NbPGL protein, or a gene encoding it, or a biomaterial containing a gene encoding it in at least one of the following aspects:

[0007] (1) Regulate plant resistance to tomato chlorosis virus;

[0008] (2) regulating crop yields;

[0009] (3) Prevent and control tomato chlorosis virus disease;

[0010] The amino acid sequence of the NbPGL protein is shown in SEQ ID No.1.

[0011] The tomato chlorosis virus disease described in the present invention refers to a viral disease caused by ToCV infection and occurring in plants such as tobacco and tomatoes.

[0012] The plant or crop in the present invention is a plant of the Solanaceae family, preferably a plant of the genus Nicotiana or Solanum, more preferably tobacco or tomato.

[0013] In a third aspect, the present invention provides the use of NbPGL protein, or its encoding gene, or biological materials containing its encoding gene in plant germplasm resource improvement;

[0014] The amino acid sequence of the NbPGL protein is shown in SEQ ID No.1.

[0015] Preferably, the coding gene of the NbPGL protein is the sequence shown in SEQ ID No.2;

[0016] or the nucleotide sequence shown in positions 207-1169 of SEQ ID NO.2;

[0017] Or the nucleotide sequence shown in positions 207-1172 of SEQ ID NO.2.

[0018] The above gene is derived from Nicotiana benthamiana.

[0019] Since the NbPGL gene of Nicotiana benthamiana is highly conserved with PGL in economic crops of Solanaceae such as tomato, the present invention can also be used in dicotyledonous host plants of Solanaceae such as tomato.

[0020] Preferably, the plant's disease resistance to tomato chlorosis virus disease is regulated, crop yield is controlled, tomato chlorosis virus disease is prevented or controlled, or germplasm resources are improved by regulating the content or activity of NbPGL protein.

[0021] Preferably, the content or activity of NbPGL protein is regulated by genetic engineering technology.

[0022] In the specific implementation process, the content or activity of NbPGL protein can be regulated by regulating cDNA, RNA and other substances. For example, it can be RNA encoded by the nucleotide sequence shown in positions 207-1169 of SEQ ID NO.2 (overexpression of NbPGL gene), or RNA encoded by the nucleotide sequence shown in positions 362-661 of SEQ ID NO.2 (inhibition of NbPGL gene expression).

[0023] In the specific implementation process, the content or activity of NbPGL protein in plant cells is regulated by biotechnology methods including but not limited to using Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc.

[0024] Preferably, the replication and proliferation of tomato chlorotic virus are inhibited by increasing the content or activity of NbPGL protein, so as to improve the plant's disease resistance to tomato chlorotic virus disease, or increase crop yield, or improve germplasm resources.

[0025] Preferably, the biological material is an expression cassette, a vector, a host cell, a transgenic cell line or a recombinant microorganism.

[0026] In a fourth aspect, the present invention provides a product, which is a pesticide, a fertilizer or a fertilizer additive; the product achieves at least one of the following purposes by regulating the content or activity of NbPGL protein:

[0027] (1) Regulate plant resistance to tomato chlorosis virus;

[0028] (2) regulating crop yields;

[0029] (3) Prevent and control tomato chlorosis virus disease.

[0030] In a fifth aspect, the present invention provides a method for inhibiting the replication and proliferation of tomato chlorosis virus in plants, comprising: increasing the content or activity of NbPGL protein by genetic engineering technology.

[0031] Preferably, the replication and proliferation of tomato chlorosis virus in the plant are inhibited by introducing a substance for overexpressing the NbPGL gene into the plant.

[0032] Preferably, the replication and proliferation of tomato chlorosis virus in the plant are promoted by introducing a substance for inhibiting the expression of the NbPGL gene into the plant.

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] The present invention finds that NbPGL protein and its encoding gene play an important role in ToCV infection and proliferation, and is a dominant antiviral gene encoded by the host plant to resist ToCV, which can be used to prevent and treat the tomato chlorotic virus disease caused by ToCV, and can be used for molecular breeding of resistance / tolerance to ToCV. The present invention can provide a basis for studying the role of plant proteins in virus infection, antiviral breeding and other fields, improve the level of antiviral research on Solanaceae vegetables, and ensure and promote the production safety of Solanaceae vegetables. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The figures are the results of overexpressing NbPGL to inhibit ToCV infection; A is a photo of the infection phenotype; B is a graph showing the expression of the NbPGL gene; C is a graph showing the accumulation of ToCV RNA; and D is a graph showing the accumulation of ToCV CP protein.

[0036] Figure 2The results of inhibiting NbPGL gene expression and promoting ToCV infection are shown in the figure; A is a photo of the infection phenotype; B is a graph showing the NbPGL gene expression; C is a graph showing the ToCV RNA accumulation; and D is a graph showing the ToCV CP protein accumulation. DETAILED DESCRIPTION

[0037] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0038] Unless otherwise specified, the examples are based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended by the manufacturer's instructions.

[0039] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0040] The biological materials used in the following examples are as follows:

[0041] Nicotiana benthamiana: see Goodin MM, Zaitlin D, Naidu RA, Lommel SA. 2008. Nicotianabenthamiana: its history and future as a model for plant-pathogeninteractions. Molecular Plant-Microbe Interactions 21:1015-1026.

[0042] Vector ToCV-BJ: See Zhao, R., Wang, N., Liu, S., Ling, K., Fan, Z., and Zhou, T. 2016. P22 of tomato chlorosis virus, an RNA silencing suppressor, is naturally expressed in the infected plant. Acta Virologica 60, 423-425.

[0043] Vector pCambia1305 See: Lin, H., Yang, Y., Quan, R., Mendoza, I., Wu, Y., Du, W., Zhao, S., Schumaker, KS, Pardo, JM, and Guo, Y. 2009. Phosphorylation of SOS3-LIKECALCIUM BINDING PROTEIN8 by SOS2 protein kinase stabilizes their protein complex and regulates salt tolerance in Arabidopsis.Plant Cell 21,1607-1619.

[0044] Vector pFGC5941 see: Deng, XJ, Zhang, HQ, Wang, Y., He, F., Liu, JL, Xiao, 9,e99564.

[0045] Tomato chlorosis virus (ToCV) See: Zhao, R., Wang, N., Wang, R., Chen, H., Shi, Y., Fan, Z., and Zhou, T. 2014. Characterization and full genome sequence analysis of a Chinese isolate of tomato chlorosis virus. Actavirologica 58, 92-94.

[0046] The NbPGL protein sequence in the following examples is shown in SEQ ID NO.1, and the gene encoding the NbPGL protein is named NbPGL gene, and the sequence is shown in SEQ ID NO.2.

[0047] Example 1 Construction of recombinant plasmid pCambia1305-NbPGL

[0048] 1. Extract total RNA from Nicotiana benthamiana and reverse transcribe it into cDNA.

[0049] 2. Using the cDNA obtained in step 1 as a template, perform PCR amplification using a primer pair consisting of pCambia1305::NbPGL-F and pCambia1305::NbPGL-R to obtain a PCR amplification product of the NbPGL coding region gene fragment; recover the PCR product of the NbPGL gene fragment.

[0050] pCambia1305::NbPGL-F(SEQ ID NO.3)

[0051] 5′-GAGCTCGGTACCCGGGGATTCCTATGGCTTCCATCTCTTCTCTA-3'

[0052] pCambia1305::NbPGL-R(SEQ ID NO.4)

[0053] 5'-CAGGTCGACTCTAGAGGATCCAAGATCCTCCTCAGAAATCAA-3'

[0054] 3. Digest the PCR amplification product of step 2 with restriction endonuclease BamH I and recover the digestion product.

[0055] 4. Digest the vector pCambia1305 with restriction endonuclease BamH I and recover the vector backbone.

[0056] 5. Connect the enzyme digestion product of step 3 and the vector backbone of step 4 to obtain the recombinant vector pCambia1305-NbPGL.

[0057] 6. Based on the sequencing results, the structure of the recombinant vector pCambia1305-NbPGL was described as follows: the double-stranded DNA molecule shown in positions 207-1169 of SEQ ID NO.2 was inserted into the BamH I restriction site of the vector pCambia1305.

[0058] Example 2 Overexpression experiment of NbPGL gene

[0059] 1. Cultivation of transgenic N. benthamiana plants overexpressing NbPGL gene using leaf disc method

[0060] (1) The cultured sterile Nicotiana benthamiana leaves were cut into 1 cm × 1 cm leaf discs and cultured at 25°C in the dark for 3 days.

[0061] (2) The constructed recombinant vector pCambia1305-NbPGL and the pCambia1305 empty vector were transformed into Agrobacterium GV3101 competent cells and cultured at 28°C for about 48 hours. A single colony on the LB plate was picked and inoculated into 3-4 mL of LB liquid medium (containing 50 μg / mL Kan and 100 μg / mL Rif) and cultured at 28°C and 180 rpm for 14-18 hours.

[0062] (3) Transfer 1 mL of bacterial suspension to 100 mL of LB liquid medium (containing 50 μg / mL Kan and 100 μg / mL Rif) at a ratio of 1:100 and culture at 28°C, 180 rpm for 4-6 h until OD 600 =0.4~0.6.

[0063] (4) Collect the cells by centrifugation at 5000 rpm for 8 min at room temperature and suspend the precipitate in 100 mL of sterile ultrapure water.

[0064] (5) The treated bacterial solution was used to infect the dark-treated Nicotiana benthamiana leaf discs, and then cultured in the dark at 25°C for 3 days.

[0065] (6) The dark-treated Nicotiana benthamiana leaf discs were placed on an induction medium, a budding medium, and a rooting medium in sequence, and cultured under a light condition of 16 h / 25° C. and a dark condition of 8 h / 20° C. to induce the production of transgenic plants that overexpressed the target gene.

[0066] 2. ToCV-BJ inoculation of Nicotiana benthamiana plants

[0067] (1) Streak the Agrobacterium strains carrying ToCV-BJ RNA1 and ToCV-BJ RNA2 stored at -80°C on LB plates (containing 50 μg / mL Kan, 100 μg / mL Rif) and culture at 28°C for about 48 h. Pick a single colony on the LB plate and inoculate it into 3-4 mL of LB liquid medium (containing 50 μg / mL Kan, 100 μg / mL Rif) and culture it at 28°C, 180 rpm for 14-18 h.

[0068] (2) Transfer 100 μL of bacterial suspension to 10 mL of LB liquid medium (containing 50 μg / mL Kan and 100 μg / mL Rif) at a ratio of 1:100 and culture at 28°C and 180 rpm for 10 to 12 h.

[0069] (3) At room temperature, centrifuge at 4000 rpm for 10 min to collect the cells and use 3 mL of infiltration buffer (10 mM MES, pH 5.7, 10 mM MgCl 2 , 200 μM acetosyringone) was used to suspend the precipitate, and the concentration of the bacterial suspension was determined by a spectrophotometer.

[0070] (4) After mixing equal volumes of bacterial suspensions carrying ToCV-BJ RNA1 and ToCV-BJ RNA2, the mixture was placed at room temperature for 2-3 hours. A 1 mL syringe was used to infiltrate the lower epidermis of leaves of Nicotiana benthamiana (4-5 leaf stage) overexpressing the NbPGL gene and inject the petiole.

[0071] (5) The infiltrated Nicotiana benthamiana was cultured in an artificial climate chamber under conditions of 16 h / 25°C light and 8 h / 20°C darkness for 21 days.

[0072] 3. Detection of ToCV replication and proliferation levels in N. benthamiana plants overexpressing NbPGL

[0073] The disease situation of the upper systemic leaves of N. benthamiana after inoculation with ToCV was continuously observed. On the 21st day after ToCV inoculation, the systemically infected leaves were taken, and the total RNA was extracted and reverse transcribed into cDNA. Using cDNA as a template and the Kangwei Century Fluorescence Quantitative PCR Kit, Actin gene was used as the internal reference gene, and RT-qPCR was used to identify the relative expression level of NbPGL gene and the content of ToCV genomic RNA. At the same time, the total protein of N. benthamiana leaves was extracted to detect the accumulation of ToCV CP protein.

[0074] The primer pairs used to identify the NbPGL gene are as follows:

[0075] NbPGL-qRT-F: 5'-TCCATGAACCCAACTCCTGC-3' (SEQ ID NO.5)

[0076] NbPGL-qRT-R: 5'-GTTTTGAACGGCGAAAGCCT-3' (SEQ ID NO.6)

[0077] The primer pairs used to identify the Actin gene are as follows:

[0078] NbActin-qRT-F: 5′-TGCCATTCTCCGTCTTGACT-3′ (SEQ ID NO.7)

[0079] NbActin-qRT-R: 5′-TGCAGTCTCGAGTTCCTGTT-3′ (SEQ ID NO.8)

[0080] The primer pairs used to identify ToCV RNA1 are as follows:

[0081] ToCV-RNA1-qRT-F: 5'-AGACACGGACTGCCTTAT-3' (SEQ ID NO.9)

[0082] ToCV-RNA1-qRT-R: 5'-CACAACTCAAGATACACTCTG-3'(SEQ ID NO.10)

[0083] The primer pairs used to identify ToCV RNA2 are as follows:

[0084] ToCV-RNA2-qRT-F: 5′-TAGATGATGGCGTAGATGAC-3′ (SEQ ID NO.11)

[0085] ToCV-RNA2-qRT-R: 5′-CTAGTGGAGTGTACCTTCAAT-3′ (SEQ ID NO.12)

[0086] The data obtained is 2 -ΔΔCT The analysis steps are as follows:

[0087] First, the C of the reference gene (ref) was used to compare the experimental group samples (test) and the control group samples (calibrator). T The C value of the target gene is normalized T value:

[0088] ΔC T(test) =C T(target,test) -C T(ref,test)

[0089] ΔC T(calibrator) =C T(target,calibrator) -C T(ref,calibrator)

[0090] Secondly, using the △C of the control group sample T The △C of the normalized experimental group samples T value:

[0091] ΔΔC T =ΔC T(test) -ΔC T(calibrator)

[0092] Finally, the expression level ratio is calculated: 2 -ΔΔCT = expression ratio

[0093] The results showed that on the 21st day after ToCV inoculation, the chlorosis symptoms on the leaves of N. benthamiana systemically infected in the experimental groups (OE1 and OE2) overexpressing the NbPGL gene were milder than those in the control group (EV). Figure 1 (A); Compared with the control group, the expression levels of NbPGL in the two N. benthamiana transgenic lines overexpressing the NbPGL gene were upregulated to about 6 and 4 times, respectively. Figure 1(B); The accumulation of ToCV genome RNA1 was reduced to about 0.4 times and 0.3 times respectively; the accumulation of RNA2 was reduced to about 0.5 times. Figure 1 (C).

[0094] Western blot analysis was performed using ToCV CP and NbPGL antiserum as primary antibodies and HRP-labeled goat anti-rabbit antibody as secondary antibodies. The results showed that compared with the control group, the expression levels of NbPGL protein in the two N. benthamiana transgenic lines overexpressing the NbPGL gene were upregulated to about 3.5 times and 2.7 times, respectively, and the accumulation of ToCV CP was reduced to about 0.4 times. Figure 1 (D, the quantitative values ​​of CP in the control group and OE1 and OE2 groups were calculated by ImageJ software. α-actin represents the expression level of actin as the internal reference, and the CP accumulation in the EV control group is set to 1. 0.40 and 0.41 represent the accumulation of CP in the OE1 and OE2 groups relative to that in the EV control group, respectively. The NbPGL accumulation in the EV control group is set to 1, and 3.59 and 2.71 represent the accumulation of NbPGL protein in the OE1 and OE2 groups relative to that in the EV control group, respectively).

[0095] Example 3 Experiment on Inhibition of NbPGL Gene Expression

[0096] To further clarify the role of NbPGL in ToCV infection, transgenic N. benthamiana plants with suppressed NbPGL gene expression were constructed using the leaf disc method and inoculated with ToCV-BJ to determine the effect of suppressing NbPGL expression on ToCV infection and pathogenesis. The specific steps are as follows:

[0097] 1. Extract total RNA from Nicotiana benthamiana and reverse transcribe it into cDNA.

[0098] 2. Using the cDNA obtained in step 1 as a template, perform PCR amplification using primer pairs consisting of pFGC5941::NbPGL-F1 and pFGC5941::NbPGL-R1 and pFGC5941::NbPGL-F2 and pFGC5941::NbPGL-R2 to obtain PCR amplification products of partial gene fragments of NbPGL.

[0099] pFGC5941::NbPGL-F1(SEQ ID NO.13):

[0100] ACAATTACCATGGGGCGCGCCATTCATCGCACAAGCCAAGAA pFGC5941::NbPGL-R1(SEQ IDNO.14):

[0101] GAAATTCTTACACATTTAAATGCAAGAATCCATTTGCCATTG pFGC5941::NbPGL-F2(SEQ IDNO.15):

[0102] AATTTGCAGGTATTTGGATCCGCAAGAATCCATTTGCCATTG pFGC5941::NbPGL-R2(SEQ IDNO.16):

[0103] GGTCTTAATTAACTCTCTAGAATTCATCGCACAAGCCAAGAA

[0104] 3. Use restriction endonucleases Asc I and Swa I to digest the pFGC5941 vector to obtain the pFGC5941 vector backbone.

[0105] 4. Use homologous recombination ligase to connect the PCR recovered products obtained by amplification of pFGC5941-NbPGL-F1 and pFGC5941-NbPGL-R1 to the pFGC5941 vector backbone.

[0106] 5. The recombinant vector obtained in step 4 was digested with restriction endonucleases BamH I and Xba I to obtain the pFGC5941-NbPGL-1 vector backbone.

[0107] 6. Use homologous recombination ligase to connect the PCR recovery products obtained by amplification of pFGC5941::NbPGL-F2 and pFGC5941::NbPGL-R2 to the pFGC5941-NbPGL-1 vector backbone to obtain the recombinant vector pFGC5941-NbPGL. The structure of the recombinant vector pFGC5941-NbPGL is described as follows: The double-stranded DNA molecule shown in positions 362-661 of SEQ ID NO.2 was inserted into the BamH I restriction site of the vector pFGC5941.

[0108] 7. Using the leaf disc method, Agrobacterium transferred with pFGC5941-PGL was used to infect pre-cultured Nicotiana benthamiana leaf explants. After inducing callus, buds and roots, transgenic Nicotiana benthamiana plants with suppressed NbPGL expression were obtained.

[0109] 8. Inoculate ToCV on transgenic N. benthamiana plants at the 4-5 leaf stage, with wild-type N. benthamiana as a control. Place the infiltrated N. benthamiana plants in an artificial climate chamber with 16h / 25℃ light and 8h / 20℃ dark conditions for 21 days.

[0110] The disease situation of the upper systemic leaves of N. benthamiana after inoculation with ToCV was continuously observed. On the 21st day after ToCV inoculation, the systemically infected leaves were taken, and the total RNA was extracted and reverse transcribed into cDNA. Using cDNA as a template and the Kangwei Century Fluorescence Quantitative PCR Kit, Actin gene was used as the internal reference gene, and RT-qPCR was used to identify the relative expression level of NbPGL gene and the content of ToCV genomic RNA. At the same time, the total protein of N. benthamiana leaves was extracted to detect the accumulation of ToCV CP protein.

[0111] The results showed that on the 21st day after ToCV inoculation, the systemic chlorosis symptoms of the infected leaves in the experimental groups (Ri-5, Ri-7) inhibited by NbPGL were more severe than those in the control group (WT). Figure 2 (A); NbPGL expression was downregulated by about 40% and 60%, respectively. Figure 2 (B); The accumulation of ToCV genome RNA1 increased by about 45% and 90%, and the accumulation of RNA2 increased by about 50% and 95%, respectively. Figure 2 (C).

[0112] Western blot analysis was performed using ToCV CP and NbPGL antiserum as primary antibodies and HRP-labeled goat anti-rabbit antibody as secondary antibodies. The results showed that compared with the control group, the expression of NbPGL protein in the two strains with inhibited NbPGL gene expression was downregulated to about 0.3 times, and the accumulation of ToCV CP increased to about 5 times. Figure 2 (D, the quantitative values ​​of CP in the control group and Ri-5 and Ri-7 groups were calculated by ImageJ software. CBB means that the expression level of Rubisco protein was used as the internal reference, and the CP accumulation in the WT control group was set to 1. 5.39 and 4.27 respectively represent the accumulation of CP in the Ri-5 and Ri-7 groups relative to that in the WT control group. The accumulation of NbPGL in the WT control group was set to 1. 0.30 and 0.29 respectively represent the accumulation of NbPGL protein in the Ri-5 and Ri-7 groups relative to that in the WT control group).

[0113] The above research results show that by overexpressing the NbPGL gene in N. benthamiana, the chlorotic symptoms caused by ToCV can be weakened, and the levels of ToCV genomic RNA and CP protein can be significantly reduced; while inhibiting the expression of the NbPGL gene enhanced the chlorotic symptoms caused by ToCV in N. benthamiana leaves, and significantly increased the levels of ToCV genomic RNA and CP protein. These results show that the NbPGL protein and its encoding gene play an important role in the replication and proliferation of ToCV, and are dominant host antiviral genes against ToCV. They can be used to prevent and control the tomato chlorotic virus disease caused by ToCV, as well as for molecular breeding against ToCV.

[0114] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of NbPGL protein, or its encoding gene, or biological materials containing its encoding gene in regulating the expression of tomato chlorosis virus; The amino acid sequence of the NbPGL protein is shown in SEQ ID No.

1.

2. Application of NbPGL protein, or its encoding gene, or biological material containing its encoding gene in at least one of the following aspects: (1) Regulate plant resistance to tomato chlorosis virus; (2) regulating crop yields; (3) Prevent and control tomato chlorosis virus disease; The amino acid sequence of the NbPGL protein is shown in SEQ ID No.

1.

3. Application of NbPGL protein, or its encoding gene, or biological materials containing its encoding gene in plant germplasm resource improvement; The amino acid sequence of the NbPGL protein is shown in SEQ ID No.

1.

4. The use according to any one of claims 1 to 3, characterized in that: The coding gene of the NbPGL protein is the sequence shown in SEQ ID No.2; or the nucleotide sequence shown in positions 207-1169 of SEQ ID NO.2; Or the nucleotide sequence shown in positions 207-1172 of SEQ ID NO.

2.

5. The use according to any one of claims 2 to 4, characterized in that: By regulating the content or activity of NbPGL protein, the plant's disease resistance to tomato chlorosis virus disease can be regulated, crop yield can be controlled, tomato chlorosis virus disease can be prevented and treated, or germplasm resources can be improved.

6. The use according to claim 5, characterized in that: The content or activity of NbPGL protein is regulated by genetic engineering technology.

7. The use according to claim 6, characterized in that: By increasing the content or activity of NbPGL protein, the replication and proliferation of tomato chlorosis virus can be inhibited, so as to improve the plant's disease resistance to tomato chlorosis virus disease, increase crop yield, or improve germplasm resources.

8. The use according to any one of claims 1 to 7, characterized in that: The biological material is an expression cassette, a vector, a host cell, a transgenic cell line or a recombinant microorganism.

9. A product, characterized in that The product is a pesticide, a fertilizer or a fertilizer additive; the product achieves at least one of the following purposes by regulating the content or activity of the NbPGL protein: (1) Regulate plant resistance to tomato chlorosis virus; (2) regulating crop yields; (3) Prevent and control tomato chlorosis virus disease.

10. A method for inhibiting the replication and proliferation of tomato chlorosis virus in plants, characterized in that: include: The content or activity of NbPGL protein is increased through genetic engineering technology.

Images