Bombyx mori molecular breeding method with anti-bmnpv and pyrethroid pesticide

Abstract

The application discloses a silkworm molecular breeding method with both anti-BmNPV and pyrethroid pesticide, which is efficient and practical. First, the silkworm variety of Su Hao and Zhong Ye is endowed with the performance of resisting pyrethroid pesticides through directional introduction and screening technology, and the related molecular markers are all dominant homozygous types. Secondly, the strategy of combining genetic breeding and molecular assisted breeding is adopted to introduce the anti-BmNPV characteristics of the silkworm AN variety, and the anti-pyrethroid pesticide molecular marker is stably controlled to be a dominant homozygous type. Finally, through strict screening and cultivation, a silkworm variety with significant economic advantages and double resistance to pyrethroid insecticides and BmNPV is obtained.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology and relates to the cultivation of the silkworm economic variety "Suhao × Zhongye" with resistance to pyrethroid pesticides and BmNPV. Specifically, it is a molecular breeding method for "Suhao × Zhongye" silkworms that have both resistance to BmNPV and pyrethroid pesticides. Background Technology

[0002] The quality of silkworm cocoons is crucial to their economic value. In the process of breeding silkworm varieties, it is necessary to consider both cocoon quality and the robustness of the silkworms to ensure that the selected varieties have stable economic benefits. In actual production and management, silkworm farmers frequently encounter situations where silkworms fail to spin cocoons due to trace amounts of pesticide poisoning. Pyrethroid insecticides, due to their long residual effect, are one of the main culprits of pesticide pollution in mulberry orchards, leading to silkworms failing to spin cocoons or spinning thin-skinned cocoons.

[0003] Bombyx mori Nuclear Polyhedrosis Virus (BmNPV) is a major disease affecting silkworms, with septicemia accounting for over 50% of total silkworm disease losses, and in some areas reaching as high as 80%. Silkworms that ingest trace amounts of pesticide-contaminated mulberry leaves become more susceptible to septicemia due to weakened immunity. These problems hinder the development of sericulture. Therefore, screening and breeding silkworm varieties with resistance to both hematologic septicemia and pyrethroid insecticides is essential to meeting the needs of the sericulture industry.

[0004] Previous research by our group revealed that the F7 silkworm variety exhibits extremely high tolerance to pyrethroid insecticides, a dominant trait. Compared to conventional varieties, its tolerance to pyrethroid insecticides can reach 100-120 times, making it an ideal candidate for breeding pyrethroid-resistant silkworm varieties. The AN silkworm variety also shows strong resistance to BmNPV, with second-instar silkworms exhibiting a median lethal concentration (LC50) of 10... 9 The concentration of BmNPV virus was above 1000 times that of conventional production strains, indicating a dominant genetic trait. From the second instar onwards, silkworms were fed a high concentration of BmNPV virus solution (1×10⁻⁶). 7 (cfu / mL) and no purulent disease occurred. Summary of the Invention

[0005] Technical problem to be solved: In order to overcome the shortcomings of the existing technology, the present invention adopts a strategy combining genetic breeding and molecular marker-assisted breeding to introduce the pyrethroid insecticide resistance of the F7 silkworm variety and the BmNPV resistance of the AN silkworm variety into the "Suhao × Zhongye" silkworm variety; in view of this, the present invention provides a molecular breeding method for the "Suhao × Zhongye" silkworm that has both BmNPV and pyrethroid pesticide resistance.

[0006] Technical Solution: A molecular breeding method for silkworms, "Suhao × Zhongye," possessing resistance to both BmNPV and pyrethroid pesticides. This method uses the silkworm variety "Suhao × Zhongye" as the female parent. The pyrethroid pesticide resistance trait of the F7 silkworm variety is introduced into the female parent through hybridization. After first-generation segregation, a homozygous second generation is obtained through screening using specific primers for molecular markers of pyrethroid insecticide resistance. Then, BmNPV-resistant lineage from the AN silkworm variety is introduced, and through direct and indirect BmNPV supplementation screening, a silkworm variety "Suhao × Zhongye" possessing resistance to both BmNPV and pyrethroid pesticides is obtained.

[0007] Preferably, the method specifically includes:

[0008] S1. Using the silkworm variety "Suhao × Zhongye" as the female parent and the silkworm variety F7 as the male parent, the G1 generation was obtained by hybridization. Then, the G1 generation was raised normally, and the G2 generation was obtained by self-pollination. 30-40 silkworm eggs were taken from each moth circle of the G2 generation, and the genome was extracted. The specific primers for the molecular marker of pyrethroid insecticide were used for detection. Moth circles with homozygous molecular markers were screened. The silkworm eggs in the selected moth circles are the G2 generation with homozygous molecular markers.

[0009] S2 and the G2 generation with homozygous molecular markers were fed normally and then crossed with the AN silkworm variety to obtain the G3 generation.

[0010] In the S3 and G3 generations, the resistance genes for pyrethroid pesticides and BmNPV both existed in heterozygous form. After normal rearing, the male moths were backcrossed with the "Suhao × Zhongye" variety to obtain the G4 generation. In the G4 generation, 50% of the individuals had the resistance genes for pyrethroid pesticides and BmNPV both in heterozygous form, while the other 50% of the individuals were negative homozygous.

[0011] After the S4 and G4 generations were normally reared to the second instar, they were fed a high concentration of BmNPV virus solution. Among the surviving individuals, the BmNPV resistance gene was heterozygous, while the negative homozygous individuals developed septicemia and died. The surviving male moths were backcrossed with the "Suhao × Zhongye" silkworm variety, with males and females mated one-to-one. When the pairs were separated and the moths were released to lay eggs, the mated males and females were numbered. The genome of the male moths was extracted and detected using specific primers for molecular markers of pyrethroid insecticide resistance. Male moths with heterozygous molecular markers were selected for breeding, resulting in the G5 generation. In the G5 generation, the pyrethroid pesticide resistance gene existed in a heterozygous form, and 50% of the individuals with the BmNPV resistance gene existed in a heterozygous form, while 50% were negative homozygous.

[0012] After the S5 and G5 generations were normally reared to the second instar, they were fed a high concentration of BmNPV virus solution. Among the surviving individuals, the BmNPV resistance gene was heterozygous, while the homozygous negative individuals died from septicemia. The surviving male moths were backcrossed with the "Suhao × Zhongye" silkworm variety, with males and females mated one-to-one. When the pairs were separated and the moths were released to lay eggs, the mated males and females were numbered. The genome of the male moths was extracted and detected using specific primers for molecular markers of pyrethroid insecticide resistance. Male moths with heterozygous molecular markers were selected for breeding, resulting in the G6 generation. In the G6 generation, the forms of pyrethroid pesticide and BmNPV resistance genes were consistent with those in the G5 generation.

[0013] After the S6 and G6 generations were normally reared to the second instar, they were fed a high concentration of BmNPV virus solution. The BmNPV resistance gene in the surviving individuals was heterozygous. They were then self-pollinated for breeding. 30-40 silkworm eggs were taken from each moth enclosure, marked accordingly, and the silkworm egg genome was extracted. Specific primers for pyrethroid insecticide molecular markers were used for detection. Moth enclosures with dominant homozygous pyrethroid pesticide resistance genes were screened out to obtain the G7 generation. In the G7 generation, the BmNPV resistance gene existed in a dominant homozygous: heterozygous: recessive homozygous form of 1:2:1.

[0014] S7. The G7 generation of single moths were raised to the second instar and fed with high concentration of BmNPV virus solution. The survival rate was investigated. The moths with full resistance to BmNPV were selected, and self-pollination was carried out to establish sublines and obtain the G8 generation. In the sublines of the G8 generation, the pyrethroid pesticide resistance gene exists in a homozygous form. The BmNPV resistance gene exists in three forms: (1) all are dominant homozygous; (2) dominant homozygous: heterozygous = 1:1; (3) dominant homozygous: heterozygous: recessive homozygous = 1:2:1.

[0015] Sixteen to eighteen individual moths from each subline of S8 and G8 generations were raised to the second instar and fed a high concentration of BmNPV virus solution. Survival rates were investigated. Sublines with a survival rate of less than 80% were eliminated. Sublines with a survival rate of more than 95% were selected. After verifying economic traits, only the moth areas that showed full resistance to BmNPV were retained. Sublines were self-pollinated to produce seed and were passed down to the G9 generation.

[0016] Sixteen to eighteen individual moths from each subline of the S9 and G9 generations were raised to the second instar. High concentrations of BmNPV virus solution were added to their feed, and survival rates were investigated. Sublines with a survival rate less than 80% were eliminated. Sublines with a survival rate greater than 95% in all moth areas were selected and raised normally to the third instar. They were then fed 0.1 mg / L deltamethrin to evaluate their resistance to pyrethroid pesticides. Moth areas resistant to both BmNPV and pyrethroid pesticides were obtained. Interbreeding between moth areas resulted in the G10 generation, completing the molecular breeding of the "Suhao × Zhongye" silkworm, which is resistant to both BmNPV and pyrethroid pesticides.

[0017] Furthermore, the molecular marker for the pyrethroid insecticide is SEQ ID NO:1, and its specific amplification primers are SEQ ID NO:2-3. Specifically, the pyrethroid insecticide molecular marker is the upstream regulatory sequence of the BmCarE-6 gene, and SEQ ID NO:1 is as follows:

[0018] TCCATGCACTAATCATAACCACAAGTACCACACGTGGAATCAACTAGTTCTCTATAGCA

[0019] AATAATTTTATTAAATACTAGCTGACCCGGCAGACTTCGTAGTGCCTTAATCTATAAAT

[0020] AAAATACCGAAACTTTTGTACAAAATAAACTTAAAACAAACAAAAGGAATCCGTCCGA

[0021] CGTCCGGGGACACATCAAAGGAAAAACAAAATTGTTATTTTTATTTAATTCCGAGCATT

[0022] TTCATATTTATCTACCTTTTAAACCTTCTCTGGACTTCCACAAATAATTCAAGACCAAA

[0023] ATTAGCCAAATCGGTCCAGCCGTTCTCGAGTTTTAACGAGACTAACGAACAGCAATTC

[0024] ATTTTTATATAGACATTGTTGAATTTTGTTAAAATTTGCACAGTTGTCCAGAGAATA

[0025] TTGAAAAACTGTGTGCTTCGTACGAATTTTTTTTTTTTTACGTTTTCGATAATATATAAG

[0026] TTAGCTGAAATTTGTATGGAGTTGGAACGTTTTCCTACGTTTGCGCTGGGGGTGCTGTT

[0027] CCAACTTTTACATTATCGAGAACTTAAAAAAACTCGCGCTAAGCACACTGGAGACTTG

[0028] AGCATTCGGTTGTTGTTAATGTCTACAATGTCTTTTATAAATCTATCCGAAATATTTTGT

[0029] CTTTCAACGGCCGTCTGGTGTAGTGGTAAGTGACATTGTCACTACCTAAGGGGGTCGCG

[0030] GGTTCGAATCCCGCCAAGGGAAGATATTTGTATGATAAATTAATATAAAATGTCTTTTC

[0031] CAGGGTTATGGATGTATATTAAATATATTATGTATGTGTATAATAAAAATCTTACATTT

[0032] ATTTCCGTTATCCGGTACCTTTAACACAAGTTCTTTACGATATTATCACGGATCAGTT

[0033] AACGTGGCGTGATTGTTAGTAAATATTTATTTATTATTTATTTTACTCTTATCTTTCACA

[0034] CTGAGACGCAGTCCGTTCTAGAATAACTTAGTCATCCGTGACCATGAAACTTGTAATGC

[0035] ATTCGAACCGTCGGAAAAAAGAAAAAAATGGACGTGATATTAAACAGTAAAATGAATTT

[0036] TATTCGATTATAAATTATGAACGCGAATCCGTATGAACGTCGAAAAATAGAACAATTA

[0037] CGAAACTAAAATTCTTAATTACAAATTAAATTAAAACTCCTTAGACTTATCAAGAAATT

[0038] AGAAACATCATTTGAATTAGTTAATTAGAAAATAAACGGAACACGGCATTTTAATTCTT

[0039] AAACATTTCAGTGACATTGCTATAAATATATATATCGACACTTGAAAGGCAAAAGTGA

[0040] CTAAGCGGCAATAACTGATTTGTACATAAATGATAGGCAATAACCATATTAGATGCGC

[0041] AAAAAAATATATTTCTAGGTCTATTAAAATCATTTCAATCCTACAGCTACACTAGAATCTA.

[0042] SEQ ID NO:2 is the forward primer for amplifying the sequence of SEQ ID NO:1, specifically: 5'-TCCATGCACTAATCATAACCA-3'; SEQ ID NO:3 is the reverse primer for amplifying the sequence of SEQ ID NO:1, specifically: 5'-TAGATTCTAGTGTAGCTGTAGGA-3'.

[0043] Furthermore, the molecular marker for the pyrethroid insecticide is SEQ ID NO:4, and its specific amplification primers are SEQ ID NO:5-6. Specifically, the pyrethroid insecticide molecular marker is the upstream regulatory sequence of the BmGST-2 gene, and SEQ ID NO:4 is as follows:

[0044] GTGTAGAACAAGGATTCCCCAAGGTGATTGTCCAGAGATCAACTTAATCGAAAATTGA

[0045] TTTTGTGTGTCGACGAGGTCTAAAAATCTGAGGTATCAAATTATTTTGGAAAAGGAGTC

[0046] TTTTACCCAAAATGATTTGGGAATCCCTGATGTCGATTCTACAGACTTTTGGAATTGCT

[0047] TGTGTAGGCTTTAATATTACTGTGCAATGCAGAAACTGACGAACATGTAAATTTGACCA

[0048] TATCATCGTAACGTAGTGTTTATATACATTCTATTTAACTCTCTCGCTTGTTTTACAGAA

[0049] CCGCTGGCTCCAAGTACGTCAATAAAGATTCATTCAGTCAATCAAAATGGAACGTGTA

[0050] GACCGAACGTAGAACATTAAAAATATGTGAAGAAGTGAACCTCACCACTCCAAGATGA

[0051] ATGAACAATAAGAGCAAATTAAAATTACATGTCATAGATAATAAATACATGTATTTTA

[0052] TTTATTGAATGCGTAGATATGTAACGAAATTTTAATAAAAACATGATAACTTCCACTGTAAGTCTGGCCATGCACCTAATATATTCGTCGTTTCAAGGTGTTCGAGTTATCAGTC.

[0053] SEQ ID NO:5 is the forward primer for amplifying the sequence of SEQ ID NO:4, specifically: 5'-GTGTAGAACAAGGATTCCCC-3'; SEQ ID NO:6 is the reverse primer for amplifying the sequence of SEQ ID NO:4, specifically: 5'-GACTGATAACTCGAACACCTT-3'.

[0054] Furthermore, the molecular marker for the pyrethroid insecticide is SEQ ID NO:7, and its specific amplification primers are SEQ ID NO:8-9. Specifically, the pyrethroid insecticide molecular marker is the upstream regulatory sequence of the BmCXE-26 gene, and SEQ ID NO:7 is as follows:

[0055] GAAAGAAAACGGAGCTCTAACCTGGGACGATGCTAACACTAGCCCTAGCAAGAGCAG

[0056] CGCTTCTCAGATGAGAACAAAGATACACTGAAAGGCTTTATATACGAATTGCGCTAAC

[0057] AAAATTATGACTAAACATAATCTTCAGCTGTGAAGGCCGGGACAAGAAATGCAGTAAA

[0058] AAAGTACTTAACGCAAAATTGTAAACAGCTTGTATTACAAATTAAAGTTAACCTAAGG

[0059] ATTTTAAATATGCTTGAAGGTCAGTGTAGTAATTAGAACTAAAACGCGAGAAGTAGAC

[0060] GTGTGTGTAATATTGTGTAAAACTATAAAAAATAAAGAAACTTATCAGACATTGTCCG

[0061] AGACTAGGTAAAAGTAACGTTATCTATATATAAATTATCGTGACCTTCGTTTGTATCAA

[0062] CGTGACTAAATTGATCGCTTGACTTTTAAATGCGAGTTAAGTTCATTGCATTTCAAATG

[0063] CAAAGTACCTTAATTGTTTTGTAATAATTACATATTTTTACTGTTTTTTTATTGCTTAGA

[0064] TGAGTGGATGAGCTCACAGCCCACCTGGTGTTAAGTGGTCACTGGAGGCCCATAGACAT

[0065] CTACAACATAAATGCGCCACCCCACCCACCATCAATGTTCATTTGCATTTTTCCTTGTTTG

[0066] TCCTCTGCTTTGTGAGGACTCTCGGTTGGATTTAAAAGAAAGGGTTTAACATAGTACCA

[0067] TCAACTGATGACGCGCGAGTACTTTGAAGAAATCGATGTTTTTCTTACGATTAGCGTTG

[0068] ATCTTATCGGAGTGAGGATCTCACTATTTTTTTTATATTATACATAAACAATAAACTAG

[0069] ATAAAAAACGTCTATCACCCTACATTTATAATATTTGGTAGCCAATACTTTTAAGAGTC

[0070] AGACTTTGTTCAGGTGCACATTTTTAATGAAGTACCTTAACGTCATATTGTTTTATAATT

[0071] TACTATCTACTTCGGTTCCGGTCCAAAGAGTAATACAAAAGCTATTGAGTATATCTTAT

[0072] ACCTCAAGGTGGAAAATAGTACTCACGGTACATTAACAAAAAAATATTTCATATTTGA

[0073] TTCGTTTATCCGTTGTTCTTAAAATTTAACAAAACTGTCTCAGAACATATTGGCCAACTT

[0074] GATCTGAGACCTTGATCAACATTACGTTACAACGAACTAGTATCTTCTGCTAAATTTGG

[0075] CAGATATTACCAACATGTCATTTACAATTTTACAATGTCAAGATCAAGAAACTACCGTTTGGCAAATAACCAATTGATCAAAATCCAGTACACCGTTTGAAAAGCGAATC.

[0076] SEQ ID NO:8 is the forward primer for amplifying the sequence of SEQ ID NO:7, specifically: 5'-GAAAGAAAACGGAGCTCTAAC-3'; SEQ ID NO:9 is the reverse primer for amplifying the sequence of SEQ ID NO:7, specifically: 5'-GATTCGCTTTTCAAACGGTG-3'.

[0077] Furthermore, the molecular marker for the pyrethroid insecticide is SEQ ID NO:10, and its specific amplification primers are SEQ ID NO:11-12. Specifically, the pyrethroid insecticide molecular marker is the upstream regulatory sequence of the BmCYP4C1 gene, and SEQ ID NO:10 is as follows:

[0078] TTAACAGTTTCACAGGCGATGTACAGGCCTTTAGTCTTAACAGTAAGCCTCTGATACGC

[0079] CCTTTTCGGTTGCCACTTGGAGGTTGCATCGCCGACTCTTAGGGCCCGCGTTCAGTCAG

[0080] CGGGTGCTCAATGGTTTCATCAGTGCTTTCAACTGCAAGTCGAGGGCGCTCGTCACCCA

[0081] GCTGGAGGACCGGGTCGGGCGAGGGCCTTTCGACCACGTCCCCTACCTGTCCTTCAAT

[0082] AACTTGGAAACTATATGTCGTGAGTATTCATGTTTTTTTTTATTGCTTAGATGAGCGTTC

[0083] AAGCTCATAGCTCACCTGGTGTTAAGTGGTTACTGGAGCCCATAGACATTTACAACGTA

[0084] CCACCCACCTTGAGATGTAAGTTGTAAGGTCTCAGTATAGTTACAACGGCTGCCCCACC

[0085] CTTCGAACCGAAACGCATTACTGCTTCACGGCAGAAACAGGCATGGTGGTGGTACCCA

[0086] CCCGCGCGGACTCACATGAGGTCCCACCACCATGCGCGGCGCTCTCTCGCAGCTTTTTC

[0087] AATTCAGTGCAGTATTGCAGCTATGTTCGTTCGCGTTAAGAATGCAGTTAATTATCATT

[0088] GTTCGCCGCCTCCTAACCAATCAAATCTTTTCAAATTACAAGGTCAAGTTCACAGTGAC

[0089] CAGTTGAAAGCACAGCTTCGAACGCGACGGTTGTGTCCTATAATTGTGTTAACTGATTT

[0090] ATATTTAAAAAAATGAATACCTCACCAATTCGTAAAAATAAAAGTGGTTCGTAATTCA

[0091] CAGTGGGGCAGAAAAGTTACAATGTTTTAAAGTATTTTAAACAGTCTGATTTAAATGTG

[0092] ACTGTGGACAGCATAGGACAAATATTTTATAACGCAATTTGGTTAGCGCTGATCGATG

[0093] GAAGAAATGCCGCGAACCACGTCTTGCAAGAAGAAAATACCATGTGGTGTTTAGATGA

[0094] TGTCATGGAACTCGCTAGTCGGCATCGATGCGCATTTCGACAAAGCGGCACGACACG

[0095] AGAGCCCTTCCATCGTGGCCGTCGGTAACTACATTCCCGATCCTACGGACAGAATGGA

[0096] AAGCAGTCGATGTCGCCCAAAACACGTCATTTCGGATCCTCCCGATCCAATAACGGGG

[0097] CTTTTAGGTACCTCAAGCACCGGTTACCGTTCTCGTCGAACCCGTGCCTTGCGACGAAG

[0098] GGCTCGACGAGTAAATTAACCCTCAGACACAGCCCACTGCGTTTCTCGCCGGATCTTTCT

[0099] CAGTGGGTCGCGTTGCCGGTCCAGTGGTAGATTCTGCGAAGCACTGCTCTTGCTAGGGT

[0100] TCGTGTTAGCAACGTCATCAGGTTTGAGCCCCGCGAGCTCACCTACTAGTTAAGGTTCC

[0101] GCTGGTATAGCCTCTCAAGGCTATCAGCTTAGGTAGGAAAAAAAAGAAAAACTCTTGTG

[0102] CAGAAAATTAATTTATTATAAATACTAACGAGGACACTTTAAGCTCATTAAACTTAATC

[0103] TTTAAGAATATAATTGTTTCAATGTTCACACCACTGTGAAAACACCTTTACCCTTCAGTTGC。

[0104] SEQ ID NO:11 is the forward primer for amplifying the sequence of SEQ ID NO:10, specifically: 5'-TTAACAGTTTCACAGGCGAT-3'; SEQ ID NO:12 is the reverse primer for amplifying the sequence of SEQ ID NO:10, specifically: 5'-GCAACTGAAGGGTAAAGGTG-3'.

[0105] Furthermore, the concentration of BmNPV virus in the high-concentration BmNPV virus solution is 10. 7 cfu / mL or higher.

[0106] Beneficial Effects: The molecular breeding method described in this invention is efficient and practical. First, through targeted introduction and screening techniques, the "Suhao × Zhongye" silkworm variety acquires resistance to pyrethroid pesticides, and the relevant molecular markers are all dominant homozygous. Second, by employing a strategy combining genetic breeding and molecular-assisted breeding, the resistance to BmNPV in the AN silkworm variety is introduced, while the molecular markers for pyrethroid pesticide resistance are stably controlled to be dominant homozygous. Finally, through rigorous screening and cultivation, a silkworm variety with significant economic advantages and dual resistance to pyrethroid insecticides and BmNPV is obtained. Attached Figure Description

[0107] Figure 1 This is a flowchart of the molecular breeding method for the "Suhao × Zhongye" silkworm, which possesses resistance to both BmNPV and pyrethroid pesticides, as described in this invention.

[0108] Figure 2 This is an electrophoretic image of the form in which the molecular marker SEQ ID NO:1 for pyrethroid insecticides exists in silkworm F7 and Dazao varieties; where M is the DL2000 Marker, 1 is F7, and 2 is Dazao.

[0109] Figure 3 This is an electrophoresis image of the pyrethroid insecticide molecular marker SEQ ID NO:1 in the "Soho × Zhongye" variety after the introduction of F7 bloodline; where M is DL2000 Marker, 1 is F7, 2 is the Chinese maternal line 1 of "Soho × Zhongye" with the introduction of F7 bloodline, 3 is the Chinese maternal line 2 of "Soho × Zhongye" with the introduction of F7 bloodline, 4 is the Japanese maternal line 1 of "Soho × Zhongye" with the introduction of F7 bloodline, and 5 is the Japanese maternal line 2 of "Soho × Zhongye" with the introduction of F7 bloodline.

[0110] Figure 4This is an electrophoresis image of the presence of the molecular marker SEQ ID NO:1 for pyrethroid insecticides in F7, “Suhao × Zhongye”, and AN purebred silkworms; where M is the DL2000 Marker, 1 is F7, 2 is the Chinese maternal strain 1 of “Suhao × Zhongye”, 3 is the Chinese maternal strain 2 of “Suhao × Zhongye”, 4 is the Japanese maternal strain 1 of “Suhao × Zhongye”, 5 is the Japanese maternal strain 2 of “Suhao × Zhongye”, and 6 is the AN purebred silkworm.

[0111] Figure 5 This is the screening result of the G2 generation molecular marker SEQ ID NO:1; where the red-marked area represents the dominant homozygous offspring.

[0112] Figure 6 This is the screening result of the G6 generation molecular marker SEQ ID NO:1; where the red-marked area represents the dominant homozygous offspring.

[0113] Figure 7 This is an electrophoretic image of the form in which the molecular marker SEQ ID NO:4 for pyrethroid insecticides exists in silkworm F7 and Dazao varieties; where M is the DL2000 Marker, 1 is F7, and 2 is Dazao.

[0114] Figure 8 This is an electrophoresis image of the pyrethroid insecticide molecular marker SEQ ID NO:4 in the "Soho × Zhongye" variety after the introduction of F7 bloodline; where M is DL2000 Marker, 1 is F7, 2 is the Chinese maternal line 1 of "Soho × Zhongye" with the introduction of F7 bloodline, 3 is the Chinese maternal line 2 of "Soho × Zhongye" with the introduction of F7 bloodline, 4 is the Japanese maternal line 1 of "Soho × Zhongye" with the introduction of F7 bloodline, and 5 is the Japanese maternal line 2 of "Soho × Zhongye" with the introduction of F7 bloodline.

[0115] Figure 9 This is an electrophoretic image of the form in which the molecular marker SEQ ID NO:7 for pyrethroid insecticides exists in the F7 and Dazao silkworm varieties; where M is the DL2000 Marker, 1 is F7, and 2 is Dazao.

[0116] Figure 10 This is an electrophoresis image of the pyrethroid insecticide molecular marker SEQ ID NO:7 in the "Soho × Zhongye" variety after the introduction of F7 bloodline; where M is the DL2000 Marker, 1 is F7, 2 is the Chinese maternal line 1 of "Soho × Zhongye" with the introduction of F7 bloodline, 3 is the Chinese maternal line 2 of "Soho × Zhongye" with the introduction of F7 bloodline, 4 is the Japanese maternal line 1 of "Soho × Zhongye" with the introduction of F7 bloodline, and 5 is the Japanese maternal line 2 of "Soho × Zhongye" with the introduction of F7 bloodline.

[0117] Figure 11This is an electrophoretic image of the form in which the molecular marker SEQ ID NO:10 for pyrethroid insecticides exists in silkworm F7 and Dazao varieties; where M is the DL2000 Marker, 1 is F7, and 2 is Dazao.

[0118] Figure 12 This is an electrophoresis image of the pyrethroid insecticide molecular marker SEQ ID NO:10 in the "Soho × Zhongye" variety after the introduction of F7 bloodline; where M is DL2000 Marker, 1 is F7, 2 is the Chinese maternal line 1 of "Soho × Zhongye" with the introduction of F7 bloodline, 3 is the Chinese maternal line 2 of "Soho × Zhongye" with the introduction of F7 bloodline, 4 is the Japanese maternal line 1 of "Soho × Zhongye" with the introduction of F7 bloodline, and 5 is the Japanese maternal line 2 of "Soho × Zhongye" with the introduction of F7 bloodline. Detailed Implementation

[0119] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Modifications and substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are all within the scope of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0120] Example 1: Identification and application of SEQ ID NO:1, a molecular marker for pyrethroid insecticide resistance in silkworm F7 variety.

[0121] In the F7 silkworm variety, the expression of the BmCarE-6 gene was significantly upregulated by feeding it 0.1 mg / L deltamethrin (dried leaf method). Therefore, the upstream regulatory sequence of the BmCarE-6 gene in the F7 silkworm variety (SEQ ID NO:1) was cloned and analyzed. The specific amplification primers were SEQ ID NO:2-3. Using the F7 silkworm egg genome as the amplification template, the PCR reaction conditions were: 94℃ pre-denaturation for 4 min, followed by 94℃ denaturation for 40 s, 58℃ annealing for 40 s, and 72℃ extension for 1 min 40 s, for a total of 35 cycles, and a final extension at 72℃ for 10 min. The PCR product was recovered and ligated into the pMD19-T vector according to the TA cloning method, and then transformed into DH5α competent cells according to the procedure. Positive clones verified by bacterial PCR were sent to Zhejiang Shangya Biotechnology Co., Ltd. for sequencing. The upstream regulatory sequence (1414 bp) of BmCarE-6 in the F7 silkworm variety was obtained by sequencing. Bioinformatics analysis showed that the upstream regulatory sequence of the silkworm F7 variety BmCarE-6 had a continuous deletion of 683 bp compared with that of the Dazao variety. Figure 2Analysis of the pyrethroid insecticide resistance mechanism in silkworm F7 revealed that F7 silkworms develop resistance to pyrethroid insecticides through the upregulation of detoxification enzyme genes, and this resistance is dominantly inherited. Therefore, the upstream regulatory sequence of the silkworm F7 variety BmCarE-6 is suitable as a molecular marker for resistance breeding.

[0122] The pyrethroid insecticide resistance of the F7 silkworm variety was introduced into the maternal parent of the economically important silkworm variety "Suhao × Zhongye" through hybridization. Molecular biological analysis of the hybrid silkworm eggs showed that all genomic molecular markers existed in heterozygous form (i.e., both complete large fragments and missing small fragments). Figure 3 In both the parent plant of "Suhao × Zhongye" and the AN variety, it exists in the form of complete large fragments. Figure 4 ).

[0123] Example 2: Molecular breeding of silkworms "Suhao × Zhongye" with resistance to both BmNPV and pyrethroid pesticides

[0124] like Figure 1 As shown, the method includes the following steps:

[0125] S1. Using the silkworm variety "Suhao × Zhongye" as the female parent and the silkworm variety F7 as the male parent, the G1 generation was obtained by hybridization. Then, the G1 generation was raised normally, and the G2 generation was obtained by self-pollination. 30-40 silkworm eggs were taken from each moth circle of the G2 generation, and the genome was extracted. The specific primers for the molecular marker of pyrethroid insecticide were used for detection. Moth circles with homozygous molecular markers were screened. The silkworm eggs in the selected moth circles are the G2 generation with homozygous molecular markers.

[0126] S2 and the G2 generation with homozygous molecular markers were fed normally and then crossed with the AN silkworm variety to obtain the G3 generation.

[0127] In the S3 and G3 generations, the resistance genes for pyrethroid pesticides and BmNPV both existed in heterozygous form. After normal rearing, the male moths were backcrossed with the "Suhao × Zhongye" variety to obtain the G4 generation. In the G4 generation, 50% of the individuals had the resistance genes for pyrethroid pesticides and BmNPV both in heterozygous form, while the other 50% of the individuals were negative homozygous.

[0128] After the S4 and G4 generations were normally reared to the second instar, they were fed a high concentration of BmNPV virus solution. Among the surviving individuals, the BmNPV resistance gene was heterozygous, while the negative homozygous individuals developed septicemia and died. The surviving male moths were backcrossed with the "Suhao × Zhongye" silkworm variety, with males and females mated one-to-one. When the pairs were separated and the moths were released to lay eggs, the mated males and females were numbered. The genome of the male moths was extracted and detected using specific primers for molecular markers of pyrethroid insecticide resistance. Male moths with heterozygous molecular markers were selected for breeding, resulting in the G5 generation. In the G5 generation, the pyrethroid pesticide resistance gene existed in a heterozygous form, and 50% of the individuals with the BmNPV resistance gene existed in a heterozygous form, while 50% were negative homozygous.

[0129] After the S5 and G5 generations were normally reared to the second instar, they were fed a high concentration of BmNPV virus solution. Among the surviving individuals, the BmNPV resistance gene was heterozygous, while the homozygous negative individuals died from septicemia. The surviving male moths were backcrossed with the "Suhao × Zhongye" silkworm variety, with males and females mated one-to-one. When the pairs were separated and the moths were released to lay eggs, the mated males and females were numbered. The genome of the male moths was extracted and detected using specific primers for molecular markers of pyrethroid insecticide resistance. Male moths with heterozygous molecular markers were selected for breeding, resulting in the G6 generation. In the G6 generation, the forms of pyrethroid pesticide and BmNPV resistance genes were consistent with those in the G5 generation.

[0130] After the S6 and G6 generations were normally reared to the second instar, they were fed a high concentration of BmNPV virus solution. The BmNPV resistance gene in the surviving individuals was heterozygous. They were then self-pollinated for breeding. 30-40 silkworm eggs were taken from each moth enclosure, marked accordingly, and the silkworm egg genome was extracted. Specific primers for pyrethroid insecticide molecular markers were used for detection. Moth enclosures with dominant homozygous pyrethroid pesticide resistance genes were screened out to obtain the G7 generation. In the G7 generation, the BmNPV resistance gene existed in a dominant homozygous: heterozygous: recessive homozygous form of 1:2:1.

[0131] S7. The G7 generation of single moths were raised to the second instar and fed with high concentration of BmNPV virus solution. The survival rate was investigated. The moths with full resistance to BmNPV were selected, and self-pollination was carried out to establish sublines and obtain the G8 generation. In the sublines of the G8 generation, the pyrethroid pesticide resistance gene exists in a homozygous form. The BmNPV resistance gene exists in three forms: (1) all are dominant homozygous; (2) dominant homozygous: heterozygous = 1:1; (3) dominant homozygous: heterozygous: recessive homozygous = 1:2:1.

[0132] Sixteen to eighteen individual moths from each subline of S8 and G8 generations were raised to the second instar and fed a high concentration of BmNPV virus solution. Survival rates were investigated. Sublines with a survival rate of less than 80% were eliminated. Sublines with a survival rate of more than 95% were selected. After verifying economic traits, only the moth areas that showed full resistance to BmNPV were retained. Sublines were self-pollinated to produce seed and were passed down to the G9 generation.

[0133] Sixteen to eighteen individual moths from each subline of the S9 and G9 generations were raised to the second instar. High concentrations of BmNPV virus solution were added to their feed, and survival rates were investigated. Sublines with a survival rate less than 80% were eliminated. Sublines with a survival rate greater than 95% in all moth areas were selected and raised normally to the third instar. They were then fed 0.1 mg / L deltamethrin to evaluate their resistance to pyrethroid pesticides. Moth areas resistant to both BmNPV and pyrethroid pesticides were obtained. Interbreeding between moth areas resulted in the G10 generation, completing the molecular breeding of the "Suhao × Zhongye" silkworm, which is resistant to both BmNPV and pyrethroid pesticides.

[0134] The molecular marker for the pyrethroid insecticide is SEQ ID NO:1, and its specific amplification primers are SEQ ID NO:2-3.

[0135] The high-concentration BmNPV virus solution contained a BmNPV virus concentration of 10. 7 cfu / mL.

[0136] Example 3: Identification and application of SEQ ID NO:4, a molecular marker for pyrethroid insecticide resistance in silkworm F7 variety.

[0137] The difference from Example 1 is that the molecular marker for pyrethroid insecticide resistance is the upstream regulatory sequence of the BmGST-2 gene (SEQ ID NO:4), and the specific primers for amplifying this upstream regulatory sequence are SEQ ID NO:5-6. The experimental results of this example are as follows... Figure 7-8 As shown.

[0138] Example 4

[0139] The difference from Example 2 is that the molecular marker of the pyrethroid insecticide is SEQ ID NO:4, and its specific amplification primers are SEQ ID NO:5-6.

[0140] Example 5: Identification and application of SEQ ID NO:7, a molecular marker for pyrethroid insecticide resistance in silkworm F7 variety.

[0141] The difference from Example 1 is that the molecular marker for pyrethroid insecticide resistance is the upstream regulatory sequence of the BmCXE-26 gene (SEQ ID NO:7), and the specific primers for amplifying this upstream regulatory sequence are SEQ ID NO:8-9. The experimental results of this example are as follows: Figure 9-10 As shown.

[0142] Example 6

[0143] The difference from Example 2 is that the molecular marker of the pyrethroid insecticide is SEQ ID NO:7, and its specific amplification primers are SEQ ID NO:8-9.

[0144] Example 7: Identification and application of SEQ ID NO:10, a molecular marker for pyrethroid insecticide resistance in silkworm F7 variety.

[0145] The difference from Example 1 is that the molecular marker for pyrethroid insecticide resistance is the upstream regulatory sequence of the BmCYP4C1 gene (SEQ ID NO:10), and the specific primers for amplifying this upstream regulatory sequence are SEQ ID NO:11-12. The experimental results of this example are as follows... Figure 11-12 As shown.

[0146] Example 8

[0147] The difference from Example 2 is that the molecular marker of the pyrethroid insecticide is SEQ ID NO:10, and its specific amplification primers are SEQ ID NO:11-12.

[0148] Example 9

[0149] After raising the G10 generation, we investigated its resistance to pyrethroid pesticides, resistance to BmNPV, and practical economic traits. F7 and “Suhao × Zhongye” were used as control groups. The results are shown in Tables 1-3.

[0150] Table 1. Results of the Economic Traits Survey of Generation G10

[0151]

[0152] Table 2 Results of the resistance survey to G10 generation deltamethrin pesticide

[0153]

[0154] Table 3. Results of the G10 generation BmNPV resistance survey.

[0155]

Claims

1. A molecular breeding method for silkworms, "Suhao × Zhongye," exhibiting resistance to both BmNPV and pyrethroid pesticides, characterized by: The method uses the silkworm variety "Suhao × Zhongye" as the female parent. The pyrethroid pesticide resistance trait of the silkworm F7 variety is introduced into the female parent through hybridization. After the first generation of segregation, the homozygous second generation is obtained by screening with specific primers for molecular markers of pyrethroid insecticide resistance. Then, the BmNPV-resistant lineage of the silkworm AN variety is introduced. After screening by direct and indirect feeding with BmNPV, the "Suhao × Zhongye" silkworm variety with both BmNPV and pyrethroid pesticide resistance is obtained. The method is specifically as follows: S1. Using the silkworm variety "Suhao × Zhongye" as the female parent and the silkworm variety F7 as the male parent, the G1 generation was obtained by hybridization. Then, the G1 generation was raised normally, and the G2 generation was obtained by self-pollination. 30-40 silkworm eggs were taken from each moth circle of the G2 generation, and the genome was extracted. The specific primers for the molecular marker of pyrethroid insecticide were used for detection. Moth circles with homozygous molecular markers were screened. The silkworm eggs in the selected moth circles are the G2 generation with homozygous molecular markers. S2 and the G2 generation with homozygous molecular markers were fed normally and then crossed with the AN silkworm variety to obtain the G3 generation. In the S3 and G3 generations, the resistance genes for pyrethroid pesticides and BmNPV both existed in heterozygous form. After normal rearing, the male moths were backcrossed with the "Suhao × Zhongye" variety to obtain the G4 generation. In the G4 generation, 50% of the individuals had the resistance genes for pyrethroid pesticides and BmNPV both in heterozygous form, while the other 50% of the individuals were negative homozygous. After the S4 and G4 generations were normally reared to the second instar, they were fed a high concentration of BmNPV virus solution. Among the surviving individuals, the BmNPV resistance gene was heterozygous, while the negative homozygous individuals developed septicemia and died. The surviving male moths were backcrossed with the "Suhao × Zhongye" silkworm variety, with males and females mated one-to-one. When the pairs were separated and the moths were released to lay eggs, the mated males and females were numbered. The genome of the male moths was extracted and detected using specific primers for molecular markers of pyrethroid insecticide resistance. Male moths with heterozygous molecular markers were selected for breeding, resulting in the G5 generation. In the G5 generation, the pyrethroid pesticide resistance gene existed in a heterozygous form, and 50% of the individuals with the BmNPV resistance gene existed in a heterozygous form, while 50% were negative homozygous. After the S5 and G5 generations were normally reared to the second instar, they were fed a high concentration of BmNPV virus solution. Among the surviving individuals, the BmNPV resistance gene was heterozygous, while the homozygous negative individuals died from septicemia. The surviving male moths were backcrossed with the "Suhao × Zhongye" silkworm variety, with males and females mated one-to-one. When the pairs were separated and the moths were released to lay eggs, the mated males and females were numbered. The genome of the male moths was extracted and detected using specific primers for molecular markers of pyrethroid insecticide resistance. Male moths with heterozygous molecular markers were selected for breeding, resulting in the G6 generation. In the G6 generation, the forms of pyrethroid pesticide and BmNPV resistance genes were consistent with those in the G5 generation. After the S6 and G6 generations were normally reared to the second instar, they were fed a high concentration of BmNPV virus solution. The BmNPV resistance gene in the surviving individuals was heterozygous. They were then self-pollinated for breeding. 30-40 silkworm eggs were taken from each moth enclosure, marked accordingly, and the silkworm egg genome was extracted. Specific primers for pyrethroid insecticide molecular markers were used for detection. Moth enclosures with dominant homozygous pyrethroid pesticide resistance genes were screened out to obtain the G7 generation. In the G7 generation, the BmNPV resistance gene existed in a dominant homozygous:heterozygous:recessive homozygous = 1:2:1 ratio. S7. The G7 generation of single moths were raised to the second instar and fed with high concentration of BmNPV virus solution. The survival rate was investigated. The moths with full resistance to BmNPV were selected, and self-pollination was carried out to establish sublines and obtain the G8 generation. In the sublines of the G8 generation, the pyrethroid pesticide resistance genes were all homozygous. The BmNPV resistance genes were in three forms: (1) all were dominant homozygous; (2) dominant homozygous: heterozygous = 1:1; (3) dominant homozygous: heterozygous: recessive homozygous = 1:2:

1. Sixteen to eighteen individual moths from each subline of S8 and G8 generations were raised to the second instar and fed a high concentration of BmNPV virus solution. Survival rates were investigated. Sublines with a survival rate of less than 80% were eliminated. Sublines with a survival rate of more than 95% were selected. After verifying economic traits, only the moth areas that showed full resistance to BmNPV were retained. Sublines were self-pollinated to produce seed and were passed down to the G9 generation. Sixteen to eighteen individual moths from each subline of the S9 and G9 generations were raised to the second instar. High concentrations of BmNPV virus solution were added to their feed, and survival rates were investigated. Sublines with a survival rate less than 80% were eliminated. Sublines with a survival rate greater than 95% in all moth areas were selected and raised normally to the third instar. They were then fed 0.1 mg / L deltamethrin to evaluate their resistance to pyrethroid pesticides. Moth areas resistant to both BmNPV and pyrethroid pesticides were obtained. Interbreeding between moth areas resulted in the G10 generation, completing the molecular breeding of the "Suhao × Zhongye" silkworm, which is resistant to both BmNPV and pyrethroid pesticides.

2. The molecular breeding method for "Suhao × Zhongye" silkworms with resistance to both BmNPV and pyrethroid pesticides as described in claim 1, characterized in that, The molecular marker for the pyrethroid insecticide is SEQ ID NO:1, and its specific amplification primers are SEQ ID NO:2-3.

3. The molecular breeding method for "Suhao × Zhongye" silkworms with resistance to both BmNPV and pyrethroid pesticides as described in claim 1, characterized in that, The molecular marker for the pyrethroid insecticide is SEQ ID NO:4, and its specific amplification primers are SEQ ID NO:5-6.

4. The molecular breeding method for "Suhao × Zhongye" silkworms with resistance to both BmNPV and pyrethroid pesticides as described in claim 1, characterized in that, The molecular marker for the pyrethroid insecticide is SEQ ID NO:7, and its specific amplification primers are SEQ ID NO:8-9.

5. The molecular breeding method for "Suhao × Zhongye" silkworms with resistance to both BmNPV and pyrethroid pesticides as described in claim 1, characterized in that, The molecular marker for the pyrethroid insecticide is SEQ ID NO:10, and its specific amplification primers are SEQ ID NO:11-12.

6. The molecular breeding method for "Suhao × Zhongye" silkworms with resistance to both BmNPV and pyrethroid pesticides as described in claim 1, characterized in that, The high-concentration BmNPV virus solution contained a BmNPV virus concentration of 10. 7 cfu / mL or higher.

Images