Application of CD44 in preparation of medicine for treating peripheral nerve myelin sheath injury diseases

Abstract

The invention provides application of CD44 in preparation of a medicine for treating peripheral nerve myelin sheath injury diseases, and relates to the technical field of biomedicine. The invention relates to a non-conservative membrane transmembrane structure which contains a conservative N-terminal extracellular domain (including a ligand binding site), a non-conservative membrane near-end region (wherein a variable region is inserted), a conservative transmembrane spanning domain and a conservative cytoplasm tail, and is connected with a cytoskeleton through an adapter protein. The polypeptide is encoded by a gene located on a human chromosome 11 and a mouse chromosome 2, and is widely expressed in lymphocytes, fibroblasts and smooth muscle cells. After the CD44 protein is combined with the ligand hyaluronic acid, the CD44 protein participates in lymphocyte circulation and mediates various cell adhesion effects. Specific embodiments show that the CD44 protein can promote repair of damaged sciatic nerve myelin sheaths and promote movement balance ability, and has a positive treatment effect on peripheral nerve myelin sheath injury diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to application of CD44 in preparing medicines for treating peripheral nerve myelin sheath damage diseases. Background Art

[0002] Peripheral nerve myelin damage diseases are a type of disease characterized by peripheral nerve myelin destruction or demyelinating lesions. Symptoms of this type of disease usually include symmetrical sensory, motor and autonomic dysfunction in the distal limbs, which may be accompanied by pain. The causes of this type of disease may be related to genetics, autoimmunity, nutritional deficiencies, exposure to toxic substances and other factors.

[0003] Treatments for peripheral nerve myelin injury include medication, physical therapy, rehabilitation training, etc. Existing treatments can relieve symptoms and promote recovery to a certain extent, but there are still shortcomings. For example, in medication, some drugs have large side effects, which may affect the patient's treatment compliance; in physical therapy, existing technologies cannot completely solve the functional disorders caused by nerve myelin injury; in rehabilitation training, some patients lack knowledge of rehabilitation training and their compliance is not high. Therefore, there is an urgent need for a new therapeutic drug to treat nerve myelin injury. Summary of the invention

[0004] The purpose of the present invention is to solve the deficiencies of the treatment methods in the prior art and to provide a new therapeutic drug.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] Application of CD44 in the preparation of drugs for treating peripheral nerve myelin damage diseases.

[0007] Preferably, the nerve myelin sheath damage disease includes sciatic nerve myelin sheath damage.

[0008] The present application also provides a drug for treating peripheral nerve myelin damage diseases, wherein the drug comprises CD44.

[0009] The present application also provides a verification method for the use of CD44 in the preparation of drugs for the treatment of peripheral nerve myelin injury diseases, which includes the construction of an in vivo sciatic nerve myelin injury model. 1. The model is divided into three groups, namely: a wild control group, a CD44 gene knockout group, and a CD44 gene overexpression group.

[0010] Preferably, after the in vivo sciatic nerve myelin injury model is constructed, the application of CD44 is verified by rotating rod test, gait test, analysis of transmission electron microscopy morphology, extraction of total RNA from sciatic nerve tissue and detection of its expression, extraction of sciatic nerve tissue protein and detection of its expression.

[0011] Preferably, the method further comprises constructing a rat sciatic nerve segmentation and bridging model, and verifying the application of CD44 by taking photos and observing the growth trend of the regenerated sciatic nerve 8 weeks after the model is constructed.

[0012] The application of CD44 provided in the present application in the preparation of drugs for the treatment of peripheral nerve myelin damage diseases has been verified through specific examples. The results show that CD44 protein can promote the repair of damaged sciatic nerve myelin, promote motor balance ability, and has a positive therapeutic effect on peripheral nerve myelin damage diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a schematic diagram of the results of the rotarod experiment in Example 2 of the present invention;

[0014] Figure 2 This is a schematic diagram of the results of the gait experiment in Example 2 of the present invention;

[0015] Figure 3 This is a comparison diagram of myelin sheath thickness between the CD44 gene knockout group and wild mice in Example 3 of the present invention;

[0016] Figure 4 This is a comparison of the myelin sheath thickness between the CD44 overexpression group and wild mice in Example 3 of the present invention;

[0017] Figure 5 This is a comparison chart of myelin-related gene expression between the CD44 gene knockout group and wild-type mice in Example 4 of the present invention;

[0018] Figure 6 This is a comparison chart of myelin-related gene expression between the CD44 overexpression group and wild mice in Example 4 of the present invention;

[0019] Figure 7 This is a comparison chart of related protein expressions among the CD44 overexpression group, CD44 gene knockout group and wild mouse group in Example 5 of the present invention;

[0020] Figure 8 This is a comparison of the newborn nerves of rats in the control group and after anti-CD44 antibody antagonism in Example 6 of the present invention;

[0021] Fig. 9 This is a comparison of the newly formed nerves of rats in the PBS treatment group and the CD44 protein treatment group in Example 6 of the present invention. DETAILED DESCRIPTION

[0022] The present invention is further described in detail below in conjunction with specific embodiments.

[0023] Application of CD44 in the preparation of drugs for treating peripheral nerve myelin damage diseases.

[0024] The nerve myelin sheath damage diseases include sciatic nerve myelin sheath damage.

[0025] A medicine for treating peripheral nerve myelin damage diseases, comprising CD44.

[0026] The present application also provides a method for verifying the application of CD44 in the preparation of drugs for treating peripheral nerve myelin injury diseases, which includes the construction of an in vivo sciatic nerve myelin injury model. After the model is constructed, the application of CD44 is verified through a rotating rod experiment, a gait experiment, analysis of transmission electron microscopy morphology, extraction of total RNA from sciatic nerve tissue and detection of its expression, extraction of sciatic nerve tissue protein and detection of its expression.

[0027] The verification method also includes the construction of a rat sciatic nerve segmentation and bridging model, and the application of CD44 is verified by taking photos 8 weeks after the operation to observe the growth trend of the regenerated sciatic nerve.

[0028] The above contents of this application are described below in conjunction with specific embodiments:

[0029] Example 1: Construction of an in vivo sciatic nerve myelin injury model:

[0030] Specifically, in one embodiment, 8-week-old CD44 knockout mice and CD44 overexpression mice were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.

[0031] The method for constructing the sciatic nerve myelin injury model is as follows:

[0032] The mice were anesthetized by subcutaneous injection of 3% sodium pentobarbital (1 ml / kg).

[0033] The skin below the buttocks was incised and the muscle was bluntly dissected using fine surgical scissors and forceps to expose the right sciatic nerve in the mid-thigh.

[0034] The sciatic nerves of CD44 knockout mice and wild-type mice were crushed 0.5 cm above the rupture of the sural, common peroneal, and tibial branches. The sciatic nerve was first compressed with straight-tipped serrated 5.0 fine forceps for 15 s until a distinct translucent area appeared. The uninjured sciatic nerve of the right hindlimb was used as a control.

[0035] All animal experimental protocols in this application were approved by the Animal Care and Utilization Committee of Nantong University and the Animal Protection and Ethics Committee of Jiangsu Province, and the establishment of the mouse sciatic nerve injury model was performed in accordance with the approved guidelines.

[0036] Example 2: Behavioral analysis of model mice:

[0037] In order to further clarify the effect of CD44 on sciatic nerve myelin regeneration and motor recovery, in this example, the wild-type mice, CD44 overexpression mice and CD44 knockout mice were subjected to rotarod test and gait test.

[0038] The rotating rod experiment uses an accelerating rotating rod device (LE8500, Pan Laboratory), and the specific steps are as follows:

[0039] Before testing, mice were habituated to the testing room for 30 minutes.

[0040] Mice were gently placed on the rotarod by gently shaking them and trained on the rotarod for 3 days at 3 and 5 minute intervals in an accelerating mode (4-40 rpm). Training was repeated at a constant speed (16 rpm) until the mice were able to stay on the rod for at least 300 seconds.

[0041] For the formal test, mice were placed on a rotating drum and the rotarod was set to an acceleration mode, which accelerated at speeds from 4 to 40 rpm over 5 min. The time spent moving on the rotarod was recorded before the fall was measured.

[0042] In this example, the gait experiment evaluates the gait dynamics of quadrupeds by analyzing the footprints of mice using the Digigait imaging system, and the stride length of the hind limbs is evaluated at a speed of 8 cm / s.

[0043] The footprints were analyzed using four measurements: distance to the contralateral foot, footprint length, maximum toe spread between the first and fifth toes, and paw spread between the centers of the second and fourth toes.

[0044] The sciatic nerve function index reflects the recovery of the damaged sciatic nerve.

[0045] See also Figure 1 and Figure 2 It can be seen that the motor behavior recovery ability of mice with sciatic nerve crush decreased after CD44 knockout, while CD44 overexpression promoted the recovery of motor function in mice with nerve damage. In this embodiment, the recovery of the damaged sciatic nerve was detected by rotarod test and gait test. The results showed that compared with wild-type mice, 14 days after the sciatic nerve was damaged to the same degree, the rotarod time of CD44 knockout mice was reduced, and the sciatic nerve function index became worse, that is, the motor recovery ability was worse; the rotarod time of CD44 overexpressed mice was increased, and the sciatic nerve function index became better, that is, the motor recovery was better. Therefore, CD44 protein can significantly alleviate the motor dysfunction of mice with sciatic nerve myelin injury model, which is beneficial to the motor recovery of mice with sciatic nerve damage.

[0046] Example 3: Transmission electron microscopy morphological analysis:

[0047] In this example, three mice with sciatic nerve crush (14 days after injury) were randomly selected from different groups (wild control group, CD44 gene knockout group and CD44 gene overexpression group).

[0048] Under deep animal anesthesia, the sciatic nerve tissue from the distal end of the injury was cut into electron microscope specimen size (1.2 mm x 1 mm x 1 mm), immersed in 4% glutaraldehyde solution for fixation, and fixed with 1% osmium acid for secondary fixation. The specimens were stained with uranyl acetate, dehydrated with gradient ethanol, embedded in epoxy resin, positioned with semi-thin sections, counterstained with lead citrate for ultra-thin sections, and observed under a transmission electron microscope.

[0049] The obtained photos were used to measure the diameter of myelinated nerves and axons on the instrument's built-in image analysis system, and the myelin thickness was measured using the axon diameter / myelinated nerve diameter value (G ratio). The larger the G ratio, the thinner the myelin thickness, thereby inferring the effect of CD44 protein on the myelin regeneration process.

[0050] See also Figure 3 and Figure 4 , the thickness of myelin sheath in the regenerated tissue of mice with sciatic nerve crush became thinner after CD44 knockout, while the thickness of myelin sheath in the regenerated nerve tissue increased after overexpression. In order to reveal the mechanism by which CD44 protein affects the motor ability of mice with sciatic nerve injury, this project further detected the microstructure of the myelin sheath in sciatic nerve tissue by transmission electron microscopy. The results showed that 14 days after injury, compared with wild-type mice, CD44 knockout mice had fewer complete myelin sheaths and thinner thickness in the regenerated sciatic nerve tissue; overexpression mice promoted the growth of new myelin sheaths. Therefore, CD44 protein is beneficial to maintaining the integrity of the myelin sheath structure of the regenerated sciatic nerve tissue, that is, CD44 protein is beneficial to the recovery of the tissue structure of mice with sciatic nerve injury.

[0051] Example 4: Total RNA extraction from sciatic nerve tissue and detection of gene expression:

[0052] In this example, the total RNA of sciatic nerve tissue was extracted using Invitrogen's Trizol reagent, and the first-strand cDNA was synthesized using Roche's reverse transcription kit. Gene expression analysis was performed using Roche's SYBR Green Supermix, and the instrument was Bio-Rad's iQ5 Multicolor Real-Time PCR Detection System. The analysis results were analyzed using 2 -△△Ct mRNA levels were calculated using the 18S housekeeping gene. The primer sequences used were as follows:

[0053] 18S rRNA forward primer: AGCTCCAATAGCGTATATTAAAG

[0054] 18S rRNA negative primer: CGGTCCTATTCCATTATTCCTA

[0055] PMP22 forward primer: ATCTCAAAGCCTTCGTCACTCC

[0056] PMP22 negative primer: GGCCAATACAAGTCATCGCTAG

[0057] MPZ forward primer: GGATAAGAAATAGCGGTTAGC

[0058] MPZ negative primer: TTGAGGCTGGTTCTACTG

[0059] Example 5: Sciatic nerve tissue protein extraction and protein expression detection

[0060] The sciatic nerve tissues of mice in different groups were minced and placed in pre-cooled tissue protein lysis buffer (25mM Tris-HCl, pH 7.4; 100mM NaF; 50mM Na4P2O7; 10mM Na3VO4; 10mM EGTA; 10mM EDTA; 1% NP-40; 10μg / ml Leupeptin; 10μg / ml Aprotinin; 2mM PMSF; 20nM Okadaic acid).

[0061] Then, the tissue was placed in a tissue homogenizer to grind the tissue, and all tissue fragments were transferred to a pre-cooled 1.5 ml EP tube and fully lysed on ice for 20 minutes (during which time, it was shaken on an oscillator several times to facilitate lysis), followed by refrigerated centrifugation (13000 rpm, 4°C) for 20 minutes. After centrifugation, the supernatant was transferred to a new 1.5 ml centrifuge tube.

[0062] The protein content of the samples was determined using the BCA protein quantification kit from Pierce Company. Based on the results, the protein concentrations of all samples were adjusted to the same level, and the loading buffer was added and mixed, boiled at 100°C for 5 min, and cooled to room temperature for Western blot analysis.

[0063] The extracted total protein samples were separated by polyacrylamide gel electrophoresis (SDS-PAGE), and the proteins in the gel were transferred to a PVDF membrane. The PVDF membrane after transfer was blocked with TBST (Tris-buffered saline solution / Tween) buffer containing 5% bovine serum albumin for 1 hour. The blocked PVDF membrane was incubated with specific primary antibodies (anti-PMP22, anti-MPZ) overnight (4°C). The PVDF membrane was then washed three times with TBST, and then incubated with the corresponding secondary antibody at room temperature for 1 hour, and then washed three times with TBST. Finally, the PVDF membrane was reacted with a chemiluminescence assay system (Pierce) and exposed to X-ray film (Kodak). The quantification of the expression level of each protein was analyzed using the software Quantity-One (Bio-Rad). All antibodies were purchased from Cell Signaling Technology.

[0064] See also Figure 5 and Figure 6 The expression of myelin-related genes and proteins in sciatic nerve crush mice after CD44 knockout decreased, while overexpression of CD44 promoted the expression of myelin-related genes. The expression of myelin-related genes and proteins PMP22 and MPZ was detected by real-time quantitative PCR and Western Blot experiments. The results showed that compared with wild-type crush mice, the expression of myelin-related genes and proteins in sciatic nerve crush mice after CD44 knockout decreased, while the expression of myelin-related genes and proteins in sciatic nerve tissue of CD44 overexpression mice increased.

[0065] Example 6: Construction of rat sciatic nerve bridging model

[0066] In this example, the sciatic nerve tissue of Sprague Dawley rats was cut with microscissors to form a 5 mm incision, and both ends of the sciatic nerve were sutured with a silicone tube with an inner diameter of 1.5 mm.

[0067] Subsequently, gel-encapsulated PBS, CD44 recombinant protein, anti-CD44 antibody and anti-IgG antibody were injected into the silicone tube respectively, the wound was sutured with disinfected sutures, and a sciatic nerve segmentation and bridging model was established. Eight weeks after the operation, photos were taken to observe the growth trend of the regenerated sciatic nerve.

[0068] See also Figure 7 and Figure 8In the rat sciatic nerve bridging model, after CD44 protein was antagonized, the new sciatic nerve recovered worse than that of wild-type rats, while excessive CD44 protein increased and promoted the regeneration of sciatic nerve. Through the observation of regenerated nerve morphology 8 weeks after surgery, compared with the sciatic nerve bridging rats in the control group, the new nerve morphology of the rats after CD44 protein antagonism was thinner and weaker, and the damaged nerve repair was worse, while the new nerves of the rats with excessive CD44 protein were thicker. Therefore, CD44 protein is conducive to the repair and regeneration of damaged sciatic nerves.

[0069] The application of CD44 provided in the present application in the preparation of drugs for the treatment of peripheral nerve myelin damage diseases has been verified through specific examples. The results show that CD44 protein can promote the repair of damaged sciatic nerve myelin sheath, promote motor balance ability, and has a positive therapeutic effect on peripheral nerve myelin damage diseases.

Claims

1. Application of CD44 in the preparation of drugs for the treatment of peripheral nerve myelin damage diseases.

2. The use of CD44 according to claim 1 in the preparation of a drug for treating peripheral nerve myelin damage diseases, characterized in that: The nerve myelin sheath damage diseases include sciatic nerve myelin sheath damage.

3. A drug for treating peripheral nerve myelin damage diseases, characterized in that: The drug includes CD44.

4. A method for verifying the use of CD44 in drugs for treating peripheral nerve myelin damage diseases, characterized in that: The invention comprises the construction of an in vivo sciatic nerve myelin injury model, wherein the model is divided into three groups: a wild control group, a CD44 gene knockout group and a CD44 gene overexpression group.

5. The verification method for the use of CD44 in drugs for treating peripheral nerve myelin damage diseases according to claim 4, characterized in that: After the in vivo sciatic nerve myelin injury model was constructed, the application of CD44 was verified through rotating rod experiments, gait experiments, analysis of transmission electron microscopy morphology, extraction of total RNA from sciatic nerve tissue and detection of its expression, extraction of sciatic nerve tissue protein and detection of its expression.

6. The verification method for the use of CD44 in drugs for treating peripheral nerve myelin damage diseases according to claim 4, characterized in that: It also includes the construction of a rat sciatic nerve segmentation and bridging model, and the application of CD44 is verified by taking photos and observing the growth trend of the regenerated sciatic nerve 8 weeks after the model is constructed.

Images