Penicillium solitum LZ-3, microbial inoculum and application of the microbial inoculum in biological control of panax notoginseng root rot and growth promotion
By using Penicillium sclerotiorum LZ-3 inoculant to antagonize the pathogen causing root rot in Panax notoginseng, the soil pollution problem caused by chemical control was solved, achieving the effect of biological control, promoting the growth of Panax notoginseng and increasing the saponin content, and alleviating the obstacle of continuous cropping of Panax notoginseng.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- YUNNAN AGRICULTURAL UNIVERSITY
- Filing Date
- 2024-10-15
- Publication Date
- 2026-05-22
AI Technical Summary
Among the methods for controlling root rot of Panax notoginseng, the use of chemical pesticides leads to soil pollution, and the application of biological control methods such as Penicillium in the agricultural field has not been widely reported. In particular, there is a lack of effective methods for controlling crop root rot, and the continuous cropping obstacles of Panax notoginseng seriously affect its growth and the content of medicinal components.
The Penicillium glabripennis LZ-3 inoculum was used for root irrigation to antagonize Fusarium and Gastrodia elata fungi, thereby improving the growth and saponin content of Panax notoginseng. By utilizing its antagonistic ability and metabolites, it inhibits pathogens, promotes the growth of Panax notoginseng, and increases the content of medicinal components.
It effectively controls root rot in Panax notoginseng, significantly increases the biomass and saponin content of Panax notoginseng, alleviates continuous cropping obstacles, enhances the systemic resistance of Panax notoginseng, reduces the incidence of root rot, and increases the content of medicinal components.
Smart Images

Figure CN119120222B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological agent technology, specifically relating to a Penicillium glabripennis LZ-3, the agent, and its application in the biological control and growth promotion of root rot in Panax notoginseng. Background Technology
[0002] Sanqi ( Panax notoginseng Panax notoginseng (Panax notoginseng) is a plant belonging to the genus Panax in the Araliaceae family. It is a traditional and precious Chinese medicinal herb with effects such as promoting blood circulation and relieving pain. In recent years, the continuous cropping obstacle of Panax notoginseng has hindered the sustainable development of its cultivation. Continuous cropping obstacle refers to the phenomenon of deterioration in quality and the spread of soil-borne diseases after consecutive planting of the same or closely related crops. Continuous cropping obstacle is severe for Panax notoginseng, and root rot caused by pathogens is considered a major cause of this obstacle, with annual losses typically reaching 5% to 20%. Many pathogens can cause root rot in Panax notoginseng, but Fusarium (Fusarium oxysporum) is the most frequently reported. Fusarium Qiao Xinguo's research found that in the root tissue of Panax notoginseng root rot... Fusarium The relative abundance of this fungus can reach as high as 73.37%. Other fungi causing root rot in Panax notoginseng include *Gnaphalium argenteum* and *Fusarium oxysporum*. Dong Xian's research found that *Fusarium oxysporum* infection in Panax notoginseng can cause root rot, with an incidence rate as high as 77.5%. Wang Jing also reported that the main pathogenic fungus causing root rot in Panax notoginseng is *Fusarium oxysporum*. Fusarium oxysporum Fusarium solani () Fusarium solani ).
[0003] Fusarium pathogens can cause root rot in most crops, resulting in serious losses. The pathogens causing root rot in traditional Chinese medicinal herbs are complex and diverse, including Fusarium fungi. Fusarium spp. Fusarium is the most harmful pathogen among them. In the root rot diseases of 17 kinds of Chinese herbal medicines, including Panax notoginseng and Astragalus membranaceus, Fusarium fungi are the main pathogens, with Fusarium oxysporum and Fusarium solani being the most common, occurring in up to 83.3% of cases. Besides causing root rot in Panax notoginseng, Fusarium also causes root rot in ginseng, which belongs to the Araliaceae family.
[0004] There are many methods for controlling root rot in Panax notoginseng, including physical, chemical, and biological control. While chemical pesticides are effective, their extensive use leads to severe soil pollution. Therefore, biological control, using fungi to control fungi, has become a new approach. For example, the endophytic fungus SDTE-P from Sophora japonica is used to control black spot disease in Panax notoginseng, and bio-fertilizers modified with Trichoderma can improve soil affected by banana wilt. Penicillium (… Penicillium sp.With a broad antibacterial spectrum and strong stress resistance, *Penicillium sclerotiorum* is an excellent biocontrol microorganism, effectively preventing and controlling plant diseases. However, there are few reports on its use in agriculture, mainly as a pathogen, specifically one of the pathogens causing penicillin rot in onions and soft rot in pomegranates during storage. Although there are reports in the field of agricultural biocontrol that *Penicillium sclerotiorum* can help soybeans and sunflowers resist heat stress, there are currently no reports on its ability to control crop root rot, and there are no patents or reports on its ability to biologically control root rot in *Panax notoginseng* or promote its growth. Summary of the Invention
[0005] The purpose of this invention is to provide a Penicillium sclerotiorum LZ-3, a fungal agent, and its application in the biological control of root rot in Panax notoginseng and the promotion of Panax notoginseng growth. The Penicillium sclerotiorum LZ-3 can effectively alleviate the continuous cropping obstacles of Panax notoginseng, antagonize Fusarium fungi and Gastrodia elata fungi, so as to achieve the effect of controlling root rot in Panax notoginseng, while promoting the growth of Panax notoginseng and increasing the saponin content in Panax notoginseng.
[0006] This invention provides a Penicillium glabripennis Penicillium glabrum LZ-3, the preservation number of Penicillium glabripennis LZ-3 is CCTCC NO: M2024280.
[0007] The present invention also provides a fungal agent containing Penicillium glabripennis LZ-3 as described in the above technical solution.
[0008] Preferably, the microbial agent comprises a suspension of Penicillium glabripennis LZ-3 and / or metabolites of Penicillium glabripennis LZ-3.
[0009] Preferably, the concentration of Penicillium glabripennis LZ-3 in the fungal agent is 10. 5 ~10 7 CFU / mL.
[0010] This invention also provides the application of Penicillium sclerotiorum LZ-3 or the fungal agent described in the above-mentioned technical solutions in controlling root rot of Panax notoginseng, resisting Fusarium fungi, resisting Micrococcus spp. fungi, promoting the growth of Panax notoginseng, and increasing the saponin content in Panax notoginseng.
[0011] Preferably, promoting the growth of Panax notoginseng includes one or more of the following: increasing the height of Panax notoginseng plants, increasing the fresh weight of the above-ground parts of Panax notoginseng, and promoting the growth of Panax notoginseng roots.
[0012] Preferably, promoting the growth of Panax notoginseng roots includes increasing the fresh weight of Panax notoginseng roots, increasing the dry weight of Panax notoginseng roots, and increasing the length of Panax notoginseng roots, or one or more of these.
[0013] Preferably, the saponin includes one or more of R1, Rg1, Rb1 and Rd.
[0014] This invention also provides a method for controlling root rot of Panax notoginseng, resisting Fusarium fungi and / or Gastrodia elata fungi, promoting the growth of Panax notoginseng and increasing the saponin content in Panax notoginseng, comprising: drenching Panax notoginseng seedlings with the fungal agent described in the above technical solution.
[0015] Preferably, the concentration of Penicillium glabripennis LZ-3 in the soil after the root irrigation treatment is 10. 5 ~10 7 CFU / g. Beneficial effects
[0016] This invention provides a Penicillium glabripenum ( Penicillium glabrum The present invention provides a fungal agent containing Penicillium sclerotium LZ-3, and the Penicillium sclerotium LZ-3 has been biopreserved. Based on this, the present invention also provides a fungal agent containing Penicillium sclerotium LZ-3. The Penicillium sclerotium LZ-3 and the fungal agent containing it can effectively alleviate the continuous cropping obstacles of Panax notoginseng, antagonize Fusarium fungi and / or Globosa fungi to achieve the effect of controlling root rot of Panax notoginseng, and at the same time promote the growth of Panax notoginseng and increase the saponin content in Panax notoginseng.
[0017] Biological Preservation
[0018] Penicillium glabripennis LZ-3, biologically classified as Penicillium glabrum It was deposited on January 29, 2024, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M2024280. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0020] Figure 1 Evaluation and identification of the biocontrol bacteria in Example 1;
[0021] Figure 2 This study aimed to identify the functional characteristics and evaluate the antagonistic abilities of Penicillium glabripenum LZ-3 and Penicillium polonum LZ-6 in Example 2.
[0022] Figure 3 This study evaluates the biocontrol efficacy of different concentrations of Penicillium sclerotiorum LZ-3 and Penicillium polonium LZ-6 against root rot of Panax notoginseng in Example 2.
[0023] Figure 4 The effects of Penicillium glabripennis LZ-3 and Penicillium polonii LZ-6 on saponin content and enzyme activity in Example 3;
[0024] Figure 5The effects of Penicillium glabripennis LZ-3 and Penicillium polonii LZ-6 on the cell membrane permeability and hydrogen peroxide content of pathogens in Example 4;
[0025] exist Figures 2-4 In the text, the letters a, b, and c represent significant differences. P < 0.05; in Figure 5 Note: * indicates a significant difference, * indicates P < 0.05, ** indicates P < 0.01. Detailed Implementation
[0026] This invention provides a Penicillium glabripenum ( Penicillium glabrum The *Penicillium scintillans* LZ-3, with preservation number CCTCC NO: M2024280, was isolated from a *Panax notoginseng* (Panax notoginseng) base in Laotanshan, Zhutang Township, Lancang County, Pu'er City, Yunnan Province, which suffered from severe root rot and continuous cropping obstacles. Identification revealed that the colony morphology of *Penicillium scintillans* LZ-3 was irregular, with only round spores and few hyphae.
[0027] This invention also provides a fungal agent containing *Penicillium glabripennis* LZ-3 as described in the above-mentioned technical solution. The fungal agent of this invention preferably comprises a bacterial suspension of *Penicillium glabripennis* LZ-3 and / or metabolites of *Penicillium glabripennis* LZ-3, more preferably a bacterial suspension of *Penicillium glabripennis* LZ-3 or metabolites of *Penicillium glabripennis* LZ-3. The concentration of *Penicillium glabripennis* LZ-3 in the fungal agent of this invention is preferably 10. 5 ~10 7 CFU / mL.
[0028] The preferred method for preparing the *Penicillium scintillans* LZ-3 bacterial suspension of the present invention includes: inoculating *Penicillium scintillans* LZ-3 onto a PDA solid medium, inverting the culture to obtain *Penicillium scintillans* LZ-3 spores; scraping off the *Penicillium scintillans* LZ-3 spores and resuspending them in distilled water; filtering the mycelia using two layers of gauze to obtain the *Penicillium scintillans* LZ-3 bacterial suspension. The preferred temperature for the inverted culture is 25-30℃, more preferably 28℃; the preferred time is 7-20 days, more preferably 15 days. The preferred method for preparing the metabolites of *Penicillium scintillans* LZ-3 of the present invention includes inoculating the mycelial cake onto a PDA medium containing cellophane for culture. The preferred culture temperature is 25-30℃. After 7 days of culture, the cellophane and mycelia are removed together, and the non-volatile metabolites are retained in the culture medium. The pathogen is then inoculated onto the culture medium and can be used to evaluate its antibacterial activity.
[0029] This invention also provides the application of *Penicillium sclerotiorum* LZ-3 or the fungal agent described in the above-mentioned technical solutions in controlling root rot of *Panax notoginseng*, resisting *Fusarium* fungi, resisting *Sclerotium spp.* fungi, promoting the growth of *Panax notoginseng*, and increasing the saponin content in *Panax notoginseng*, or in one or more of these areas. The resistance to *Fusarium* fungi described in this invention preferably includes resistance to *Fusarium oxysporum* (…). Fusarium oxysporum ) and / or anti-fusarium solani ( Fusarium solani The *Penicillium sclerotiorum* LZ-3 described in this invention is preferably resistant to root rot, and more preferably resistant to *Panax notoginseng* root rot. The method for promoting *Panax notoginseng* growth as described in this invention preferably includes one or more of the following: increasing plant height, increasing the fresh weight of aboveground parts, and promoting root growth; the method for promoting root growth preferably includes one or more of the following: increasing the fresh weight of roots, increasing the dry weight of roots, and increasing root length. The saponins described in this invention preferably include one or more of R1, Rg1, Rb1, and Rd, and more preferably R1, Rg1, Rb1, and Rd.
[0030] The *Penicillium sclerotiorum* LZ-3 described in this invention can increase the content of peroxidase (POD) and phenylalanine ammonia-lyase (PAL) in the roots of *Panax notoginseng*, inducing systemic resistance in *Panax notoginseng*. At the same time, it stimulates hydrogen peroxide in the pathogen *Fusarium oxysporum*, causing oxidative stress damage to cells, leading to the destruction of the pathogen's cell membrane, thereby inhibiting the growth of the pathogen and achieving the effect of resisting *Fusarium oxysporum* and / or *Fusarium solani*, thus achieving the effect of resisting root rot.
[0031] This invention also provides a method for alleviating continuous cropping obstacles in Panax notoginseng, resisting Fusarium fungi and / or Gastrodia elata fungi, promoting the growth of Panax notoginseng, and increasing the saponin content in Panax notoginseng, comprising: drenching Panax notoginseng seedlings with the inoculant described in the above technical solution. The preferred concentration of Penicillium glabripennis LZ-3 in the soil after the root drenching treatment is 10. 5 ~10 7 CFU / g.
[0032] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0033] Soil samples were collected from the Panax notoginseng forest base in Laotanshan, Zhutang Township, Lancang County, Pu'er City, Yunnan Province (coordinates 99°47′59″E, 22°43′19″N). This site had been planted with Panax notoginseng for two years and exhibited severe root rot. Additionally, natural soil and soil from two consecutive years of Panax notoginseng cultivation were selected for subsequent treatment.
[0034] Test plants: One-year-old Panax notoginseng seedlings were obtained from the Panax notoginseng planting base of Nongda Agricultural University in Daheqiao, Xundian (25°31' 8.0" N, 103°16' 41.6" E, H1980m).
[0035] Test pathogen: Fusarium oxysporum LP1 ( Fusarium oxysporum ), Fusarium solani LP2 ( Fusarium solani ) and small irregular cocci ( Plectosphaerella cucumerina (Provided by the Key Laboratory of Agricultural Biodiversity and Pest Control, Ministry of Education, Yunnan Agricultural University).
[0036] Test instruments: Refrigerated high-speed centrifuge (HITACHI CR 22 GⅢ); autoclave (Sanyo, Japan, mLS-3780); laminar flow hood (Suzhou Antai, SW-CJ-2F); Roche LC96 real-time PCR instrument (LightCycler96); microplate reader; analytical balance (Sartorius, BSA124S-CW); centrifuge (Thermo Fisher Scientific, HeraeusFresco17); pipette (Eppendof, Germany); 55kHz ultrasonic cleaner (Shanghai Shengyuan Ultrasonic Instrument Co., Ltd., SY3100DH).
[0037] Experimental data were analyzed and processed using Microsoft Excel 2016, and statistical analysis was performed using SPASS 18.0 software. GraphPad Prism 8.0 software was used for plotting. Example
[0038] Microorganisms in soil were isolated using the dilution plate method. 10 g of the isolated soil sample was added to 90 mL of sterile water and shaken at 120 r / min for 90 min to prepare a soil microbial suspension. This suspension was then diluted sequentially to 10⁻⁶. -4 and 10 -5 g / mL. Take 50 μL of the concentration as 10. -5 A bacterial suspension of g / mL was evenly spread onto PDA medium and incubated in a 28℃ constant temperature and light incubator. After colonies grew, single colonies of different morphologies were picked for pure culture.
[0039] Strain morphology identification: The activated strains were inoculated onto different culture media for morphological observation, including potato dextrose agar (PDA), synthetic nutrient medium (SNA), corn flour medium (Maize) (Wang Haiyan, 2023), Czapek agar (Czapek), and oat flake agar (OA) (Nian Wenkai, 2022).
[0040] The purified strain was sequenced (Beijing Qingke Biotechnology Co., Ltd.) using the following primers. The sequenced sequences were BLAST-aligned in the NCBI database, and a phylogenetic tree was constructed using MEGA-X software and Neighbor-Joining (NJ) method.
[0041] The ITS sequence of LZ-3 is 5'--3' (SEQ ID NO.1);
[0042] TUB2 sequence of LZ-3: 5'-ACGTGCTGACACGATCCCAATTGATAGCCTGTTGGACCGAATCACTGACTGGTTTCTAGGCAAACCATTGCTGGCGAGCACGGACTTGATGGTGATGGACAGTGAGTTTCAACATCGATGAGATTGCGAGGTGGAAATGGCGGTCTGATAATTTTTAGCGTCAACGAGGCTTCCGACCTCCAGTTGGAGCGCATGAACGTCTACTTCAACG AGGTATGTGTGGAATTGAAGCTATAGGTATAAAGGCTTCTCTAATGTTGATTGTGATAGGCCAGCAGCAACCGTTACGTTCCCCGTGCCGTCCTTGTCGACTTGGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCCTTCGGTGGTCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCAAAACC-3' (SEQ ID NO.2).
[0043] gene locus Primer sequence ITS1F: 5'-CTTGGTCATAGGAAGAAGTAA-3' (SEQ ID NO.3) ITS4R: 5'-TCTCGCTTTATGATATGC-3' (SEQ ID NO.4) bt2a: 5'-GGTAAACCAAATCGGTGCTGCTTTC-3' (SEQ ID NO.5) bt2b: 5'-ACCCTCAGTG TAGTGACCCTTGGC-3' (SEQ ID NO.6)
[0044] The biocontrol efficacy of the isolated strains was evaluated using a bottle culture experiment. First, soil samples from continuous cropping of Panax notoginseng were dispensed into 200 mL sterile tissue culture bottles, 50 g per bottle. Each bacterial suspension was then diluted to 10⁻⁶. 7 CFU / mL was inoculated into tissue culture bottles, 20 mL per bottle, with 6 bottles inoculated for each treatment. Sterile water of the same volume was added as a control. Sterilized Panax notoginseng seeds were planted in tissue culture bottles containing continuous cropping soil, 10 plants per bottle. The bottles were placed in a greenhouse for cultivation. After three months of cultivation, the survival rate of the plants was measured and recorded (Luo L, 2021).
[0045] The results are as follows Figure 1 As shown, A represents the screening of biocontrol bacteria through bottle cultivation experiments; B represents the phylogenetic tree constructed based on ITS; C represents the colony morphology and spore morphology; and D represents the phylogenetic tree constructed based on TUB2.
[0046] Depend on Figure 1 It can be concluded that 12 antagonistic bacteria strains were isolated from the Panax notoginseng planting soil in Lancang County. Figure 1(A) A bottle culture experiment was conducted on these 12 strains to screen biocontrol bacteria. The results showed that strains LZ-3 and LZ-6 could improve the continuous cropping barrier of Panax notoginseng. From the perspective of colony morphology, both strains had irregular shapes, with only round spores, and were predominantly spores, with fewer hyphae. The number of hyphae in LZ-3 was greater than that in LZ-6. Figure 1 (C). Phylogenetic trees were constructed using primers ITS and TUB2, respectively. The results showed that LZ-3 is *Penicillium glabripennis*, and LZ-6 is *Penicillium polonii*. Figure 1 (D). Example
[0047] Penicillium glabripennis LZ-3 and Penicillium polonii LZ-6 were inoculated onto Ashby nitrogen-free solid medium, silicate culture medium (SSM), phosphate solubilizing medium (PSM), potassium solubilizing medium, CAS medium, cellulase culture medium (CCM), cellulase culture medium (LCM), and Salkowski reagent (Wang Haiyan, 2023) for functional qualitative evaluation. The results are as follows: Figure 2 As shown in Figure A, from left to right, the median consists of Ashby nitrogen-free solid medium (N), phosphorus-solubilizing medium (P), silicate hydrochloride medium (K), potassium-solubilizing medium, CAS medium, cellulase medium, and laccase medium. IAA detection was performed using white ceramic plates. CK1: IAA standard solution + Salkowski reagent, CK2: Salkowski reagent, CK3: non-IAA-producing fungi + Salkowski reagent, and T: fermentation broth of the fungus + Salkowski reagent.
[0048] Depend on Figure 2 From A, we can conclude that both *Penicillium glabripennis* LZ-3 and *Penicillium polonii* LZ-6 have the ability to fix nitrogen, solubilize phosphorus, and solubilize potassium, but neither can produce siderophores. Both can produce cellulase, laccase, and IAA, indicating that they may inhibit the growth of pathogens by producing cellulase and laccase, improve soil physicochemical properties by fixing nitrogen, solubilizing phosphorus, and solubilizing potassium, and promote crop growth by producing IAA.
[0049] The highly pathogenic bacteria LP1 and LP2, as well as *Penicillium tumefaciens*, were selected for plate co-culture and cellophane culture tests to determine the inhibitory effect of *Penicillium* on the pathogens. The test methods are as follows:
[0050] Plate confrontation method: Antagonistic bacteria were screened using the plate confrontation culture method. One side of the petri dish was inoculated with Penicillium mold cake, and the other side was inoculated with pathogen mold cake. After incubation at 25℃ for 4 days, the inhibition rate and relative inhibition effect were calculated. Each treatment was replicated 3 times. Inhibition rate (%) = [(control colony radius - confrontation culture colony radius) / control colony radius] × 100% (Luo Lifen, 2018).
[0051] Cellophane culture experiment: Penicillium mycelium cakes were inoculated onto PDA medium covered with sterile cellophane, with a control group inoculated with PDA blank agar blocks. After 7 days, the cellophane was removed, and mycelium cakes of pathogens LP1, LP2, and *Sclerotium spp.* were inoculated separately, and the inhibition rates were calculated (Wang Haiyan, 2023). Results are as follows: Figure 2 Figures B through D show the co-culture results, where B represents the plate culture, CK represents the three pathogens, and the treated Penicillium is on the left side of the petri dish. C represents the inhibition rate of the co-culture, and D represents the inhibition rate of the non-volatile metabolites of Penicillium. The cellophane co-culture experiment was used. After Penicillium grows in PDA medium containing cellophane, its volatile metabolites are secreted into the medium through the cellophane. After removing the cellophane, the pathogens are inoculated to determine whether the non-volatile metabolites of Penicillium can inhibit bacterial growth.
[0052] Depend on Figure 2 From B to D, we can conclude that both *Penicillium glabripentum* LZ-3 and *Penicillium polonum* LZ-6 can inhibit the growth of *Fusarium* LP1 and LP2, as well as *Microcystis aeruginosa*. *Penicillium glabripentum* LZ-3 showed stronger inhibitory effects on both LP1 and LP2 than *Penicillium polonum* LZ-6. *Penicillium glabripentum* LZ-3 exhibited the strongest inhibitory effect against *Fusarium* LP2 in co-culture, with an average inhibition rate of 86%, followed by *Microcystis aeruginosa* with an average inhibition rate of 66%, and finally, LP1 with an average inhibition rate of 64%. However, there was no significant difference in the inhibitory effects of their metabolites.
[0053] Based on the indoor results in step 2.2, LP2, the most pathogenic strain, was selected for a pot experiment to verify the biocontrol effects of Penicillium glabripenum LZ-3 and Penicillium polonum LZ-6 on pathogen LP2. The specific steps are as follows:
[0054] Preparation of Penicillium spore suspension: *Penicillium glabripenum* LZ-3 and *Penicillium polonum* LZ-6 were inoculated separately onto PDA solid medium plates and incubated upside down at 28°C for 15 days. Spores were scraped from the plates, and the activated strains were diluted with distilled water to prepare a spore suspension. The suspension was filtered through double-layered gauze, and the concentration of the potential biocontrol spore suspension was calculated using an optical microscope to achieve a concentration of 10. 6 ~10 8 CFU / mL, reaching 10 in the soil after root irrigation. 5 ~10 7The final soil concentration (CFU / g) after root irrigation with a suspension of Fusarium oxysporum LP2 pathogen was 10. 5 CFU / g.
[0055] 2.3.1 One-year-old Panax notoginseng seedlings were selected for root drenching experiments. Two types of sterilized soil were used: natural soil from under pine forests was sterilized at 121℃ for 30 min to obtain sterile soil (Luo L, 2021). Pots with a diameter of 15cm and a height of 13cm were used, and each pot contained 1kg of soil. The sterilized soil was first drenched with a suspension of Fusarium oxysporum LP2 to achieve a final soil concentration of 10%. 5 After CFU / g, administer antagonistic bacteria.
[0056] Three months later, the incidence rate of root rot in Panax notoginseng, the fresh weight of Panax notoginseng roots, and the length of Panax notoginseng roots were statistically analyzed. The results are as follows: Figure 2 The figures are E~G, where E is the fresh weight of Panax notoginseng root; F is the incidence rate of root rot in Panax notoginseng; and G is the length of Panax notoginseng root.
[0057] As shown in Figures E-G, both *Penicillium glabripennis* LZ-3 and *Penicillium polonum* LZ-6 reduced the incidence of root rot in Panax notoginseng caused by LP2, with an average decrease of 36% and 50% respectively. Both also increased root length and fresh weight, with fresh weight increasing by 55% and 56% and root length by 32% and 40%, respectively. However, there were no statistically significant differences between the treatments. The results indicate that both *Penicillium* strains possess good disease control and growth-promoting effects.
[0058] 2.3.2 One-year-old Panax notoginseng seedlings were selected for root irrigation experiments. Soil from continuous planting of Panax notoginseng for two years was selected for the experiment. The treatment group was inoculated with 100 mL of spore suspension of the strain, and sterile water was used as the control (CK). Each treatment was inoculated into 6 pots, with 10 seedlings in each pot.
[0059] Observe the phenotypic characteristics of Panax notoginseng after 3 months, such as Figure 3 As shown in Figure A, in the potted Panax notoginseng in the first and second rows, from left to right, they are CK and 10 respectively. 7 10 6 and 10 5 The incidence rate of root rot in Panax notoginseng, fresh weight of roots, fresh weight of above-ground parts, dry weight of roots, plant height, and root length were statistically analyzed. The results are as follows: Figure 3 The values B through G are shown in the table, where B represents the incidence rate of root rot in Panax notoginseng; C represents the fresh weight of Panax notoginseng roots; D represents the fresh weight of the above-ground parts; E represents the dry weight of the roots; F represents the plant height; and G represents the root length.
[0060] Depend on Figure 3 It can be concluded that both *Penicillium glabripennis* LZ-3 and *Penicillium polonii* LZ-6 can reduce the incidence of root rot in *Panax notoginseng*, increase the dry and fresh weight of roots, the fresh weight of above-ground parts, and the plant height. Furthermore, at 10... 6 CFU / g and 105 At a CFU / g concentration, *Penicillium glabripennis* LZ-3 significantly reduced the incidence of root rot in Panax notoginseng compared to *Penicillium polonii* LZ-6. 5 CFU / g and 10 6 At both CFU / g concentrations, *Penicillium scintillans* LZ-3 showed a stronger ability to reduce root rot, decreasing the incidence of root rot by 66% and 64%, respectively. This was 50% and 12% higher than the average inhibition rate of *Penicillium polonum* LZ-6. In conclusion, *Penicillium scintillans* LZ-3 has a more significant effect in controlling root rot, therefore, *Penicillium scintillans* LZ-3 was chosen for patent application.
[0061] Both *Penicillium sclerotiorum* LZ-3 and *Penicillium polonum* LZ-6 at three concentrations increased the fresh and dry weight of *Panax notoginseng* roots by more than 100%, increased the average plant height by more than 17%, and increased the average root length by more than 30%. Compared with the blank control, *Penicillium sclerotiorum* LZ-3 increased the fresh weight of *Panax notoginseng* roots by an average of 128%, increased the fresh weight of the aboveground parts by more than 22%, increased the dry weight of the roots by 206%, increased the plant height by more than 17%, and increased the root length by more than 30%. Therefore, *Penicillium sclerotiorum* LZ-3 has good efficacy in preventing root rot and promoting growth. Example
[0062] Following the method described in step 2.3.2 of Example 3, the Panax notoginseng plants were treated with Penicillium glabripennis LZ-3 and Penicillium polonii LZ-6, respectively. The saponin content of Panax notoginseng was then determined according to the method of Luo Cheng et al. (Luo Cheng, 2022): each treatment had 6 pots as replicates, with 10 Panax notoginseng plants per pot, and 3 plants were randomly selected from each pot for saponin determination. Three months after root irrigation, the main root of Panax notoginseng was dried, ground, and passed through a 100-mesh sieve. 0.2 g of the powder was accurately weighed, and 15 mL of 75% methanol was added. The mixture was extracted ultrasonically for 30 min, centrifuged for 10 min (12000 r / min), and 1 mL of the supernatant was placed in a brown sample bottle. The contents of four saponins, R1, Rg1, Rb1, and Rd, in Panax notoginseng were measured using ultra-high performance liquid chromatography. The results are as follows: Figure 4 As shown in Figures A through D, where A through D represent the contents of saponins Rg1, Rb1, Rd, and R1, respectively.
[0063] Depend on Figure 4 From A to D, we can conclude that *Penicillium sclerotium* LZ-3 significantly increases the content of saponins, the medicinal component of *Panax notoginseng*, by an average of 11%, 39%, 37%, and 40% for Rg1, Rb1, Rd, and R1, respectively. However, *Penicillium polonii* LZ-6 does not increase the saponin content. Only *Penicillium sclerotium* LZ-3 can increase the content of saponins, the core medicinal quality component of *Panax notoginseng*. Therefore, LZ-3 was chosen for patent application, which will provide a new approach to improving the medicinal quality of *Panax notoginseng*.
[0064] Roots of Panax notoginseng were collected after root drenching with *Penicillium glabripentum* LZ-3 and *Penicillium polonum* LZ-6. Samples were taken at 24 h and 120 h, respectively, to determine enzyme activities. Three plants were collected from each pot as one replicate, and three replicates were made for each treatment. Sterile water was used as a control. Kits purchased from Suzhou Keming Biotechnology Co., Ltd. were used to measure superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and phenylalanine ammonia-lyase (PAL) (Yang K. et al. 2023). Results are as follows: Figure 4 The figures E to L represent the contents of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and phenylalanine ammonia-lyase (PAL) in the roots of Panax notoginseng 24 hours after irrigation, respectively; while I to L represent the contents of these same enzymes in the roots of Panax notoginseng 120 hours after irrigation.
[0065] Depend on Figure 4 The results from E~L show that the peroxidase (POD) of Panax notoginseng treated with *Penicillium scintillans* LZ-3 and *Penicillium polonum* LZ-6 showed an increasing trend on both day 1 and day 5. The increase in POD from *Penicillium scintillans* LZ-3 was more significant, increasing by 480% on day 5, while *Penicillium polonum* LZ-6 only increased by 59%. *Penicillium scintillans* LZ-3 more strongly increased the POD activity of the Panax notoginseng resistance enzyme, while the control *Penicillium polonum* LZ-6 did not increase POD on day 5, indicating a more significant upregulation by *Penicillium scintillans*. Phenylalanine ammonia-lyase (PAL) was significantly upregulated on day 1, increasing by an average of 125% and 407%, respectively. The PAL activity of *Penicillium scintillans* LZ-3 was 282% higher than that of *Penicillium polonum* LZ-6. On day 5, *Penicillium scintillans* LZ-3 still showed the highest PAL activity, increasing by 196%. Overall, Penicillium glabripennis LZ-3 can induce more disease resistance-related enzyme activity in Panax notoginseng than Penicillium polonii LZ-6, which may induce systemic resistance in Panax notoginseng. This may be one of the reasons why Penicillium glabripennis has better control efficacy. Example
[0066] Referring to the plate confrontation test in section 2.2 of Example 2, Penicillium glabripenum LZ-3 and Penicillium polonum LZ-6 were confronted with pathogens LP1 and LP2, respectively, and mycelia of pathogens LP1 and LP2 were obtained after being confronted with plates of Penicillium glabripenum LZ-3 and Penicillium polonum LZ-6, respectively.
[0067] The method of Guo Ning et al. (Guo Ning et al., 2023) was slightly modified: the propidium bromide (PI) staining method was adopted: 10 mL of 2.5 μg·mL⁻¹ of pathogenic mycelium that had been confronted with Penicillium agar was added. -1The mycelia were stained with PI staining solution for 15 min in the dark, then rinsed with physiological saline to remove the staining solution. The staining was immediately observed under a fluorescence microscope. Normally growing pathogens were used as controls. Hydrogen peroxide levels in the pathogens were determined using a kit from Suzhou Gres Biotechnology Co., Ltd. Results are as follows: Figure 5 As shown, A is a fluorescence observation photograph of the effect of Penicillium glabripenum LZ-3 and Penicillium polonum LZ-6 on the cell membrane permeability of the two pathogens LP1 and LP2, and B is the effect of Penicillium glabripenum LZ-3 and Penicillium polonum LZ-6 on the hydrogen peroxide content of the two pathogens LP1 and LP2.
[0068] Depend on Figure 5 It can be concluded that both pathogens, LP1 and LP2, were stained red, while only a small amount of hyphae in the blank control were stained red. This indicates that *Penicillium glabripentum* LZ-3 and *Penicillium polonum* LZ-6 can cause cell membrane damage to *Fusarium* hyphae, leading to increased permeability and even disruption of their integrity, thus making it easier for PI staining solution to penetrate the damaged cell membrane and enter the hyphae. This example also measured the hydrogen peroxide content of the same sample. The results showed that the hydrogen peroxide content was significantly increased after treatment with *Penicillium glabripentum* LZ-3 and *Penicillium polonum* LZ-6. Therefore, this invention hypothesizes that these two *Penicillium* strains can induce an increase in intracellular hydrogen peroxide content in pathogens, thereby damaging the cell membrane and causing hyphal cell death, thus inhibiting pathogen growth.
[0069] This invention reveals that *Penicillium sclerotiorum* LZ-3 can reduce root rot in *Panax notoginseng*, increase its biomass, and enhance the content of saponins, the core medicinal quality component of *Panax notoginseng*, providing new insights for improving its medicinal quality. Furthermore, this invention also found that *Penicillium sclerotiorum* LZ-3 can increase the activity of resistance-related enzymes in *Panax notoginseng*, particularly significantly increasing the content of PAL. PAL is an enzyme catalyzing the first reaction in the phenylpropanoid metabolic pathway and is closely related to lignin synthesis; it is likely that PAL can induce systemic resistance in *Panax notoginseng* to resist Fusarium pathological infection.
[0070] Reactive oxygen species mainly include superoxide radicals (O2). 2- Hydrogen peroxide (H2O2), hydroxyl radicals (-OH), and nitric oxide radicals (NO) - ) and singlet oxygen ( 1(Wang Haode, 2018). Many studies have also elucidated the important role of low concentrations of reactive oxygen species (ROS) in pathogenic processes. Increased H2O2 inhibits the growth of viable trophic pathogens, whether generated by the pathogen itself or induced by the plant and accumulated. When ROS accumulate to a certain concentration, it can cause oxidative stress damage to cells (Zhang Yandong, 2019). The experimental results of this invention show that *Penicillium glabripennis* LZ-3 can increase the H2O2 content of two *Fusarium* strains. Combined with PI staining results, it can be seen that the cell membrane of the pathogen is damaged and its contents are leaked. Therefore, this invention hypothesizes that *Penicillium* may induce an increase in hydrogen peroxide content in the pathogen, leading to cell membrane damage and thus inhibiting pathogen growth.
[0071] References:
[0072] [1] Wang Haiyan. Isolation, identification and mechanism of endophytic Trichoderma strain 6S-2 in controlling apple continuous cropping obstacle [D]. Shandong Agricultural University, 2023. DOI:10.27277 / d.cnki.gsdnu.2023.000004.
[0073] [2] Nian Wenkai. Pathogenic study and screening of control agents for five new pathogens of Rehmannia glutinosa, including Cucumber Fibrosum (Master's thesis) [D]. Henan Agricultural University, 2022.
[0074] [3] Luo L, Guo C, Wang L, et al. Negative Plant-Soil Feedback Drivenby Re-assemblage of the Rhizosphere Microbiome With the Growth of Panaxnotoginseng[J]. Frontiers in microbiology, 2019, 10:1597.
[0075] [4] Luo L, Wang L, Deng L, Mei X, Liu Y, Huang H, Du F, Zhu S, YangM. Enrichment of Burkholderia in the Rhizosphere by Autotoxic Ginsenosides toAlleviate Negative Plant-Soil Feedback. Microbiol Spectr. 2021 Dec 22;9(3):e0140021. doi: 10.1128 / Spectrum.01400-21. Epub 2021 Nov 10. PMID: 34756064; PMCID: PMC8579924.
[0076] [5] Yang K, Wang H, Luo L, Zhu S, Huang H, Wei Z, Zhu Y, Guo L, He 10.1016 / j.jenvman.2022.117069. Epub 2022Dec 28. PMID: 36584512.
[0077] [6] Wang Haode. The role of H2O2 and the functional analysis of CAT in the formation of sclerotia of Rhizoctonia solani [D]. Shenyang Agricultural University, 2018.
[0078] [7] Zhang Yandong. Study on the response and mechanism of Alternaria alternata, the causal agent of black spot on pear fruit, to oxidative stress [D]. Gansu Agricultural University, 2019. DOI:10.27025 / d.cnki.ggsnu.2019.000268.
[0079] [8] Zhang Qian, Li Ping, He Zikang, et al. Active substances against Ralstonia solanacearum in the endophytic fungi Penicillium citrinum and Penicillium pollenum of Portulaca oleracea [J]. Journal of Tropical and Subtropical Botany, 2019, 27(06):731-738.
[0080] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A type of Penicillium glabripenum ( Penicillium glabrum LZ-3, the preservation number of Penicillium glabripennis LZ-3 is CCTCCNO: M2024280.
2. An inoculum containing Penicillium glabripennis LZ-3 as described in claim 1.
3. The microbial agent according to claim 2, characterized in that, The inoculum includes a suspension of Penicillium glabripennis LZ-3.
4. The microbial agent according to claim 2, characterized in that, The fungal agent includes metabolites of Penicillium glabripennis LZ-3 and mycelia of Penicillium glabripennis LZ-3; the preparation method of the fungal agent includes: inoculating the fungal cake onto a PDA medium containing cellophane for cultivation, the cultivation temperature is preferably 25-30℃, and after 7 days of cultivation, the cellophane and mycelia are removed together to obtain the fungal agent.
5. The microbial agent according to any one of claims 2 to 4, characterized in that, The concentration of Penicillium glabripennis LZ-3 in the bacterial agent is 10. 5 ~10 7 CFU / mL.
6. The *Penicillium sclerotium* LZ-3 as described in claim 1 or the fungal agent as described in any one of claims 2 to 5, in controlling root rot of *Panax notoginseng* and resisting *Fusarium* spp. (… Fusarium spp Fungi and *Spherulites* resistant to small irregular shells ( Plectosphaerella Applications in one or more fungi.
7. The use of Penicillium glabripennis LZ-3 as described in claim 1 or the fungal agent as described in any one of claims 2 to 3 and 5 in promoting the growth of Panax notoginseng and / or increasing the saponin content in Panax notoginseng.
8. The application according to claim 7, characterized in that, The promotion of Panax notoginseng growth includes one or more of the following: increasing the height of Panax notoginseng plants, increasing the fresh weight of the above-ground parts of Panax notoginseng, and promoting the growth of Panax notoginseng roots.
9. The application according to claim 8, characterized in that, The promotion of Panax notoginseng root growth includes increasing the fresh weight of Panax notoginseng roots, increasing the dry weight of Panax notoginseng roots, and increasing the length of Panax notoginseng roots, or one or more of these.
10. The application according to claim 7, characterized in that, The saponins include one or more of R1, Rg1, Rb1, and Rd.
11. A method for controlling root rot of Panax notoginseng and resisting Fusarium fungi and / or Globosa fungi, characterized in that, include: The seedlings of Panax notoginseng were treated with a fungal agent according to any one of claims 2 to 5 by root irrigation.
12. A method for promoting the growth of Panax notoginseng and increasing the saponin content in Panax notoginseng, characterized in that, include: The seedlings of Panax notoginseng were treated with a fungal agent according to any one of claims 2 to 3 and 5 by root irrigation.
13. The method according to claim 11 or 12, characterized in that, The concentration of Penicillium glabripennis LZ-3 in the soil after the root irrigation treatment was 10. 5 ~10 7 CFU / g.