Method for constructing uterine stromal cell-specific gene editing mice

Abstract

The application belongs to the technical field of molecular biology, and discloses a construction method of uterine stroma-specific gene editing mice, and the application is based on a CRISPR-Cas9 stroma-specific gene editing mouse. The Cas9 mouse is activated by a Vim-specific promoter Cre mouse, and the Cas9 mouse not only solves the breeding complexity of the traditional Cre mouse, but also realizes the tissue-specific knockout without the need for homozygosity. The Cas9 mouse can be used for knockout of various sgRNAs, and provides more possibilities for development of a gene editing model. The obtained Cas9 mouse is mated with an sgMettl3 reporter mouse, and Mettl3 gene knockout is successfully guided in uterine stroma cells. The application provides a valuable gene editing model for endometrial gene research, and overcomes the challenge of difficulty in double-specific site-mediated gene knockout.

Description

Technical Field

[0001] This invention relates to molecular biology techniques, and more specifically, to a method for constructing uterine matrix-specific gene-edited mice. Background Technology

[0002] Uterine stromal cells are cells found in the matrix of the endometrium, which provides support and nutrition to the endometrium. The endometrium consists of two layers: the epithelial layer (superficial cells) and the stromal layer (supporting cells). Stromal cells are primarily involved in endometrial regeneration and remodeling, playing a crucial role, especially during the menstrual cycle and pregnancy. Uterine stromal cells play a key role in regulating endometrial function, supporting embryo implantation, and maintaining pregnancy. Understanding the function of these cells is of great significance for the diagnosis and treatment of gynecological diseases.

[0003] Vimentin is a gene that encodes an intermediate filament protein, expressed in various cell types, particularly mesenchymal cells. The Vimentin protein encoded by the Vimentin gene is a major component of intermediate filaments in the cytoskeleton. It plays a role in cell structure maintenance, shape stability, intracellular and extracellular signal transduction, and cell migration. Vimentin expression during embryonic development is crucial for normal embryonic differentiation and organogenesis.

[0004] The main principle of the Cre-Loxp system is to insert two LoxP sequences at a specific site in the target genome, forming a target region between the LoxP sites. By expressing the Cre enzyme, this enzyme catalyzes the cleavage of the LoxP sequences and triggers DNA recombination events, enabling gene knockout, insertion, or inversion. If two LoxP sites in the same direction are located on the same chromosomal DNA strand, Cre will recognize and knock out the sequence between the LoxP sites. The Flpo recombinase system is similar to Cre, with the FRT site resembling the LoxP site, and is used to construct conditional knockout mice.

[0005] The CRISPR-Cas system was first discovered in *Escherichia coli*. Its function is to defend against bacteriophage infection by capturing spacer sequences derived from bacteriophages and integrating them into its own genome to gain foreign resistance. The CRISPR-Cas system protects the genome from damage by bacteriophages, viruses, etc., and its effectiveness is related to the host's ability to acquire anti-phage Cas proteins. CRISPR is a natural immune system used by many archaea and bacteria to deal with foreign DNA invasion, utilizing Cas proteases to cleave the DNA and achieve an autoimmune effect. The CRISPR-Cas locus consists of a series of genes encoding Cas proteins and a CRISPR repeat spacer sequence. A typical CRISPR repeat spacer sequence consists of a leader sequence, a series of short, highly conserved positive repeat sequences, and a spacer sequence arranged in sequence.

[0006] In the field of embryo implantation, the progesterone receptor-driven Pgr-Cre mouse is currently a promising candidate for uterine-specific knockout. This mouse model is widely used and has demonstrated the physiological regulatory effects of various important molecules on the uterus. Currently, Cre mice driven by Wnt7a, Sprr2f, and Ltf have also been developed and utilized to achieve uterine epithelial-specific knockout. Furthermore, Amhr2-driven Cre mice have been used to achieve intrastromal knockout. However, Amhr2-Cre is not highly efficient, and it is impossible to distinguish whether knockout affects early reproductive tract development or has a direct impact on embryo implantation. Using the Cre-loxp system requires homozygous Flox mice carrying Cre to achieve successful gene knockout on two chromosomes, making the breeding of multi-gene knockout mice extremely difficult. Summary of the Invention

[0007] The technical problem to be solved by the present invention is to overcome the above-mentioned problems existing in the prior art, and firstly, to provide an sgRNA that targets the Vim gene.

[0008] A second objective of this invention is to provide a DNA fragment for knocking in the Vim gene.

[0009] A third objective of this invention is to provide a method for constructing a Cas9 mouse capable of tissue-specific knockout.

[0010] The fourth objective of this invention is to provide an application of Cas9 mice that can achieve tissue-specific knockout.

[0011] The fifth objective of this invention is to provide TG for conditional knockout mice of the uterine matrix. sgMettl3 -Pgr flpo / + -Vim fsf -Cre / + -Rosa26 lsl-Cas9 / + The construction method.

[0012] The objective of this invention is achieved through the following technical solution:

[0013] The present invention first provides an sgRNA targeting the Vim gene, the sequence of which is shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0014] The present invention also provides a DNA fragment for knocking into the Vim gene, wherein the DNA fragment comprises, from the 5' end to the 3' end, an upstream homologous arm, an FRT-6xSV40 pA-FRT-Kozak-iCre-WPRE-BGH pA expression cassette, and a downstream homologous arm; the nucleotide sequence of the upstream homologous arm is the sequence immediately adjacent to the 5' end of the start codon of the first exon of the Vimentin gene, the nucleotide sequence of the downstream homologous arm is the sequence immediately adjacent to the 3' end of the start codon of the first exon of the Vimentin genome, and the sequence of the FRT-6xSV40 pA-FRT-Kozak-iCre-WPRE-BGH pA expression cassette is shown in SEQ ID NO: 3.

[0015] This invention also provides a method for constructing a tissue-specific knockout Cas9 mouse, comprising the following steps:

[0016] S1, Building Vim fsf-Cre / + Mouse: Cas9 mRNA and the sgRNA described in claim 1 were obtained by in vitro transcription; a homologous recombination vector containing the DNA fragment described in claim 2 was constructed using BAC clone RP23-14I24 as a template; Cas9 mRNA, sgRNA and the homologous recombination vector were transformed into mouse zygotes, and then obtained by genotyping.

[0017] S2, Build Pgr Flpo / + Mice: The 2A-flop sequence was inserted into the 3'UTR of the Pgr gene, and then obtained by genotyping.

[0018] S3, Build Pgr flpo / + -Vim fsf-Cre / + Mice: Vim fsf-Cre / + Mice and Pgr Flpo / + Mouse hybridization, and genotypic selection to obtain double-positive mice Pgr flpo / + -Vim fsf-Cre / + Mice;

[0019] S4, Pgr flpo / + -Vim fsf-Cre / + Mice and Rosa26 lsl-Cas9 / + Mouse hybridization, and genotypic selection to obtain triple-positive mice Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + The mouse is the Cas9 mouse, which can achieve tissue-specific knockout.

[0020] The above-described Pgr driven by Cre and Flpo in this invention flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / +Knockout Plan: Designing and Building Vim fsf-Cre / + In mice, the start codon portion of the Vim gene is replaced with the fsf-Cre expression cassette. fsf-Cre Mouse and Pgr flp Mice mating with deletion of the stop expression cascade resulted in double-positive mouse Pgr. flpo / + -Vim fsf-Cre / + Rosa26 lsl-Cas Mice and Pgr flpo / + -Vim fsf-Cre / + After mating, Cas9-expressing triple-positive mice (Pgr) were obtained through genotyping. flpo / + -Vim fsf -Cre / + -Rosa26 lsl-Cas9 / + .

[0021] This study aims to create uterine matrix-specific knockout mice based on the CRISPR-Cas9 system, addressing the issue of low efficiency in the Amhr2-Cre mouse model. CRISPR-Cas9 can achieve tissue-specific knockout without requiring homozygosity, overcoming the complex breeding issues associated with traditional Cre-Loxp mice. Furthermore, breeding Cas9 mice with mice containing multiple sgRNA tandems can achieve simultaneous knockout of multiple genes, solving the problem of the difficulty in simultaneous multi-gene knockout in traditional Cre-Loxp mice.

[0022] Therefore, the present invention also provides the application of Cas9 mice that can achieve tissue-specific knockout obtained by the above method in the construction of tissue-specific knockout animal models.

[0023] Specifically, the present invention also provides TG-type uterine matrix conditional knockout mice. sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + The construction method of the three-yang mouse Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Mice and TG sgMettl3 TG mice were obtained through hybridization and genotyping to obtain conditional knockout mice of the uterine stromal matrix. sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + .

[0024] Preferably, the TG sgMettl3 The mice were constructed by integrating a DNA fragment of sgRNA targeting Mettl3 into the mouse genome using the PiggyBAC transposase system, followed by genotyping and screening.

[0025] More preferably, the DNA fragment of the sgRNA targeting Mettl3 includes, from the 5' end to the 3' end, the following genes in sequence: U6 promoter, Mettl3-sgRNA1, U6 promoter, Mettl3-sgRNA2, U6 promoter, sgGFP encoding gene, CAG promoter encoding gene, mcherry encoding protein, SV40 poly(A) encoding gene, mcherry encoding protein, P2A peptide encoding gene, GFP encoding gene, and bGH poly(A) encoding gene.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] This invention relates to CRISPR-Cas9-based matrix-specific gene-editing mice. Cre mice, using Vim as a specific promoter, activate Cas9. Cas9 mice not only solve the problem of complex breeding of traditional Cre mice, but also achieve tissue-specific knockout without requiring homozygosity. Cas9 mice can be used to knock out various sgRNAs, providing more possibilities for the development of gene-editing models.

[0028] The resulting Cas9 mice were mated with sgMettl3 reporter mice, successfully achieving guided knockout of the Mettl3 gene in uterine stromal cells. This invention provides a valuable gene-editing model for endometrial gene research, overcoming the challenge of bispecific site-mediated gene knockout. The successful construction of CRISPR-Cas9 conditional knockout mice provides a reference for exploring other gene-editing model animals and broadens the development of model animals in the veterinary field. Attached Figure Description

[0029] Figure 1 This is a schematic diagram of the gene knock-in design strategy in Example 1;

[0030] Figure 2 Vim in Example 2 fsf-Cre / + Mouse genotype electrophoresis identification results;

[0031] Figure 3 For TG sgMettl3 PCR electrophoresis identification results of overexpressing transgenic mice;

[0032] Figure 4 For Pgr flpo / + Mouse PCR electrophoresis identification results; HE indicates heterozygous mice, WT indicates wild-type mice;

[0033] Figure 5 Rosa26 lsl-Cas9 / + Mouse PCR electrophoresis identification results; HE indicates heterozygous mice, WT indicates wild-type mice;

[0034] Figure 6TG in Example 3 sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Electrophoretic identification results of mouse genotypes;

[0035] Figure 7 TG in Example 4 sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Mice, Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Immunohistochemical results of Vimintin protein and METTL3 in the uterus of mice and wild-type mice;

[0036] Figure 8 TG in Example 4 sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Mice, Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Western blot results of METTL3 and CAS9 in the uterus of mice and wild-type mice. Detailed Implementation

[0037] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0038] The antibodies Mettl3, Cas9, Vimentin and β-Actin used in this invention were all purchased from CST Biotechnology, with catalog numbers E3F2A, 19526T, D21H3 and 4970S, respectively.

[0039] Example 1: FRT-6xSV40 pA-FRT-Kozak-iCre-WPRE-BGH pA Fragment Knock-in Design Strategy

[0040] The mouse Vim gene (NCBI reference sequence: NM_011701.4) is located on mouse chromosome 2. Nine exons have been identified, with the ATG start codon located in exon 1 and the TAA stop codon located in exon 9 (Transcript: 201ENSMUST00000028062). The Crisprick online tool was used for screening, and the two sgRNAs with the highest scores were selected. Using BAC clone RP23-14I24 as a template, homologous arms were generated by PCR, and the target fragment FRT-6xSV40pA-FRT-Kozak-iCre-WPRE-BGH PA (SEQ ID No. 3) was inserted to replace part of exon 1 of the Vim gene with the target band.

[0041] The two sgRNAs were obtained as follows:

[0042] sgRNA1: 5'GGACACAGACCTGGTAGACA-TGG 3' (SEQ ID No. 1);

[0043] sgRNA2: 5'CCTTCGAAGCCATGTCTACC-AGG 3' (SEQ ID No. 2).

[0044] Example 2 Vim fsf-Cre / + Identification and screening of mouse models

[0045] I. Experimental Methods

[0046] 1. Build Vim fsf-Cre / + Transgenic mice: Cas9 mRNA and sgRNA were obtained through in vitro transcription; Cas9 mRNA and sgRNA, along with a vector containing the homologous recombinant DNA fragment from Example 1, were microinjected into the fertilized eggs of C57BL / 6J mice to obtain transgenic positive first-generation mice, which were confirmed to be successfully constructed by genotyping and sequencing.

[0047] 2. DNA Extraction: Cut 3-5 mm ear samples from the mice to be identified and transfer them to 200 μL centrifuge tubes. Add 50 μL of mouse tissue lysis buffer and 1 μL of Proteinase K to the centrifuge tubes, mix well, and centrifuge rapidly for 20 seconds. Place the centrifuged tubes into a PCR instrument and set the program to 55℃ for 20 min and 95℃ for 5 min to lyse the samples and extract DNA. Store the extracted DNA samples at -40℃ for later use.

[0048] 3. PCR expansion of target fragment: The target fragment was expanded by PCR using the primers shown in Table 1, the PCR amplification system shown in Table 2, and the PCR amplification program shown in Table 3 in the mice to be identified.

[0049] Table 1 Vim fsf-Cre / + Genotype identification primer information:

[0050] Primer Sequence 5'-->3' F TGCCTTCCTTGACCCTGGAAG R1 AGGAATAGAGGCTGCGGCTAG R2 GGGACCCTCTTTCCTAACAGTG

[0051] Table 2 Vim fsf-Cre / + Genotype identification reaction system

[0052] Reaction Component Volume (μl) ddH2O 7.4 2xRapid Taq Master Mix* 10 Primer I (10 pmol / μl) 0.8 Primer II (10 pmol / μl) 0.8 genomic DNA 1 Total 20

[0053] Table 3 Vim fsf-Cre / + Genotype identification reaction conditions

[0054] Step Temp (°C) Time Note 1 95 3min - 2 95 15 seconds - 3 60 15 seconds - 4 72 1min Repeat steps 2-4 for 34 cycles. 5 72 5min - 6 12 - hold

[0055] 3. Agarose gel electrophoresis

[0056] (1) Select a suitable glue-making tank and a matching glue plate, and put the glue plate and comb into the glue-making tank.

[0057] (2) Prepare the gel according to the size of the gel preparation plate. Take 1×TEA at a ratio of 1.5%-2%, weigh agarose, add it to the conical flask and mix thoroughly. Microwave until completely dissolved.

[0058] (3) Add nucleic acid dye at a ratio of 0.1%, shake well and pour into the gel casting tank, check and pop the air bubbles, and let it stand to cool and solidify.

[0059] (4) Carefully remove the solidified agarose gel, pull out the comb, and fully immerse the gel and the sample well into the TAE working solution, with the end near the sample well at the negative electrode.

[0060] (5) Load the sample at a volume of 8uL per well and use the DL2000 DNA Marker to label the band size. The band sizes are 100bp, 250bp, 500bp, 750bp, 1000bp and 2000bp respectively. Electrophoresis is performed at a constant voltage of 120V for 30min. The agarose gel is then placed in a gel imaging system to observe the bands and take pictures.

[0061] II. Experimental Results: Figure 2 As shown, when using specific primers, F+R1 is the mutant allele primer with a fragment size of 340 bp; F+R2 is the wild-type allele primer with a fragment size of 339 bp; HE is a heterozygous mouse; WT is a wild-type control.

[0062] Example 3TG sgMettl3-Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Genotyping and Screening of Tool Mice

[0063] I. Experimental Methods

[0064] 1. TG sgMettl3 Mouse construction

[0065] Use the Crisprick online tool to enter the following parameters:

[0066] (1) Reference genome: Mouse GRCm38

[0067] (2) Mechanism: CRISPR

[0068] (3) Enzyme: SpyoCas9(chen(2013)tracrRNA)

[0069] (4) Gene information: Mettl3 (Ensembl:ENSG00000165819)

[0070] 244 gene sequences were obtained by running the Crisprick online tool. The sequences were then screened using the following two strategies: firstly, sequences with the highest possible overall score were selected; secondly, the number of bases cut between two sgrna cells could not be a multiple of three.

[0071] The two Mettl3 sgRNAs were obtained as follows:

[0072] Mettl3-sgRNA1: 5'-TGCCGCCCAGGAGTTGATTG-3' (SEQ ID No. 15);

[0073] Mettl3-sgRNA2: 5'-GTTGAAAAGTTTCGCTCTCG-3' (SEQ ID No. 16).

[0074] The following sgRNA expression elements were designed: U6-sgRNA1-U6 sgRNA2-U6-sgRNA3-CAG-mcherry-SV40poly(A)-mcherry-P2A-GFP-bGH poly(A); sgRNA1 is shown in SEQ ID No. 1; sgRNA2 is shown in SEQ ID No. 2; and sgRNA3 is shown in SEQ ID No. 17. These elements were then sent to Sangon Biotech (Shanghai) Co., Ltd. for full-gene synthesis.

[0075] sgRNA3 (sgGFP encoding gene): 5'-CGAAGTTATATTAAGGGTTC-3' (SEQ ID No. 17).

[0076] The DNA recombination method was performed according to the In-Fusion® HD Cloning Kit instructions. The hNCR3-Tg plasmid was digested with BamHI and SalI to generate sticky ends. The target fragment U6-sgRNA1-U6sgRNA2-U6-sgRNA3-CAG-mcherry-SV40 poly(A)-mcherry-P2A-GFP-bGH poly(A) was obtained by PCR amplification. The obtained target fragment and the digested vector were recombined using In-Fusion enzymes and identified to obtain the vector plasmid PiggyBAC.

[0077] PiggyBAC mRNA and the vector plasmid PiggyBAC containing the target insert (sgRNA expression element) were injected into the fertilized eggs of C57BL / 6J mice via microinjection. The injected fertilized eggs were then transferred into the oviducts of pseudopregnant mice to obtain mice for identification.

[0078] 2. DNA extraction: Cut a 5mm sample from the mouse ear to be identified and transfer it to a 200μL centrifuge tube.

[0079] Add 50 μL of mouse tissue lysis buffer and 1 μL of proteinase K to a centrifuge tube, mix well, and centrifuge rapidly for 20 seconds.

[0080] Place the centrifuge tubes into a PCR instrument and set the program to 55℃ for 20 min and 95℃ for 5 min to lyse the samples and extract DNA. Store the extracted DNA samples at -40℃ for later use.

[0081] PCR expansion of target fragment: The target fragment was expanded by PCR using the primers shown in Table 4, the PCR amplification system shown in Table 5, and the PCR amplification procedure shown in Table 6 in the mice to be identified.

[0082] Table 4 TG sgMettl3 Genotype identification primer information

[0083] Primer Sequence 5'-->3' Primer Type F ACAAGCTGGAGTACAACTACAACA Forward R CGGTAAGTGTCACTGATTTTGAACT Reverse

[0084] Table 5TG sgMettl3 Genotype identification reaction system

[0085] Reaction Component Volume (μl) ddH2O 7.4 2xRapid Taq Master Mix* 10 Primer I (10 pmol / μl) 0.8 Primer II (10 pmol / μl) 0.8 genomic DNA 1 Total 20

[0086] Table 6 TG sgMettl3Genotype identification reaction procedure

[0087] Step Temp (°C) Time Note 1 95 3min - 2 95 15 seconds - 3 60 15 seconds - 4 72 2min Repeat steps 2-4 for 34 cycles. 5 72 5min - 6 12 - hold

[0088] 3. Agarose gel electrophoresis

[0089] Clean the glue-making tank, glue plate, comb, measuring cylinder and conical flask, and let them dry. Then put the glue plate and comb into the glue-making tank for later use.

[0090] Add 60 mL of 1×TEA solution and 1.2 g of agar powder to an Erlenmeyer flask. According to our laboratory standards, we use an agarose content of 1.5% to 2%. Then, heat the mixture to boiling using a microwave oven. Once the agar powder is completely dissolved and the mixture is clear, remove it from the microwave and shake well before use.

[0091] After the mixture has cooled slightly, add 6 μL of nucleic acid dye (diluted at a ratio of 1:1000), shake well again, pour it into the gel casting tank, and let it cool and solidify at room temperature. You can gently shake it to check the solidification of the gel.

[0092] After the gel solidifies, remove the comb and carefully transfer the gel to the electrophoresis tank, being careful to keep the TAE working solution in the electrophoresis tank clean and free of impurities.

[0093] Samples were loaded at a rate of 6 μL per well and labeled using a DL2000 DNA Marker, with band sizes of 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, and 2000 bp, respectively. Electrophoresis was then performed at a constant voltage of 120 V for 30 min, and the agarose gels were then placed in a gel imaging system for band observation and photographic recording.

[0094] Experimental results: such as Figure 3 As shown, using specific primers, PCR amplified a 791bp band, and the positive mouse numbers identified were 1, 4, 6, 7, 8, 16, 18, 19, 24, 26, 27, 29, 30, 31, 33, 34, and 35.

[0095] 2. Pgr flpo / + Identification of mice:

[0096] Pgr flpo / + Mice were purchased from Jackson Laboratory and used for propagation in the laboratory. Based on the DNA extraction method described above, the genotype identification results are as follows: Figure 4 As shown in Table 2, the corresponding PCR amplification system for genotype identification is shown in Table 7, and the amplification program information is shown in Table 9. The heterozygous mouse F+R1 amplified a 193bp fragment, and F+R2 also amplified a 300bp fragment; the heterozygous mouse only amplified a 300bp fragment in F+R2.

[0097] The mouse was designed to insert the 2A-flpo sequence into the 3'UTR of the mouse Pgr gene, allowing the endogenous Pgr promoter region to directly express the flpo recombinase to the uterine region without interfering with its gene expression.

[0098] 3. Rosa26 lsl-Cas9 / + Identification of mice:

[0099] Rosa26 lsl-cas9 / + Mice (purchased from Shanghai Southern Model Biotechnology Development Co., Ltd.) were conditionally overexpressing Cas9 mice. After breeding with Cre mice, the loxp-stop-loxp fragment was deleted to induce Cas9 expression. Mice were used for laboratory propagation. Based on the DNA extraction method described above, the corresponding PCR amplification system for genotyping is shown in Table 2, the amplification primers in Table 7, the amplification program information in Table 10, and the genotyping results are as follows: Figure 5 As shown, heterozygous mice F+R1 amplified a 275bp fragment, and F+R2 amplified a 435bp fragment; heterozygous mice only had F+R2 amplify a 435bp fragment.

[0100] 4. Hybridization and propagation: The above Vim... fsf-Cre / + Transgenic mice and TG sgMettl3 ,Pgr flpo / + Rosa26 lsl-Cas9 / + Mice were crossbred and genotypes were identified and screened to obtain offspring of triple-positive and quadruple-positive mice.

[0101] Table 7 TG sgMettl3 ,Pgr flpo / + Rosa26 lsl-Cas9 / + Genotype identification primer information

[0102]

[0103] Table 8 TG sgMettl3 Genotype identification reaction procedure

[0104]

[0105] Table 9 Pgr flpo / + Genotype identification reaction procedure

[0106]

[0107] Table 10 Rosa26 lsl-Cas9 / + Genotype identification reaction procedure

[0108]

[0109] II. Experimental Results

[0110] like Figure 6 As shown, lane 1 is TG. sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Mice were used, with lane 2 serving as a wild-type control and lane 3 as a blank control. Mouse number 1 had ear label t397, and its Pgr... flpo / + The mutant allele primers amplified a 193bp band, while the wild-type allele primers amplified a 300bp band, for Pgr. flpo / + Hybrid. Vim fsf -Cre / + The mutant allele primers amplified a 340bp band, while the wild-type allele primers amplified a 339bp band, for Vim. fsf-Cre / + Heterogeneous, Rosa26 lsl-Cas9 / + The mutant allele amplified a 275bp band, and the wild-type allele amplified a 435bp band, namely Rosa26. lsl-Cas9 / + Hybrid. TG sgMettl3 The target gene was amplified into a 791bp band, indicating a positive result. In contrast, control mouse 2 (wild-type mouse) showed no allele amplification bands.

[0111] Example 4 Immunohistochemical detection of TG sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Protein expression of Vimintin and METTL3 in mouse uterine epithelium

[0112] I. Experimental Methods

[0113] 1. Solution Preparation: 4% Paraformaldehyde Fixative: Dissolve 4g of paraformaldehyde in 10mL of 1×PBS and 90mL of distilled water. 10×PBS: Weigh 14.2g of Na₂HPO₄, 14.2g of KH₂PO₄, 2g of KCl, and 81.8g of NaCl, and add deionized water to a final volume of 1L. 1×PBS: Measure 100mL and add distilled water to a final volume of 1000mL. Sodium Citrate Antigen Retrieval Solution: Weigh 1.47g of trisodium citrate dihydrate and 0.18g of anhydrous sodium citrate, dissolve in 300mL of distilled water, then add distilled water to a final volume of 500mL and adjust the pH to 6.0. EDTA antigen retrieval solution: Measure 50 mL of 50×Tris-EDTA antigen retrieval solution, add 490 mL of distilled water, and adjust the pH to 8.0. 3% hydrogen peroxide solution: 20 mL hydrogen peroxide (30%) + 180 mL methanol. Blocking solution (10% goat serum): 100 μL of blocking goat serum + 900 μL of 1×PBS. Ammonia solution for blueing: 1 mL of ammonia solution + 200 mL of distilled water. Hydrochloric acid for color separation: 20 μL of salt + 20 mL of distilled water. Weak hematoxylin staining agent: 1 mL of hematoxylin staining solution + 3 mL of 1×PBS. DAB chromogenic solution: 60 μL of DAB chromogenic solution + 1200 μL of DAB chromogenic solution B.

[0114] 2. Paraffin slice preparation

[0115] (1) The mice were euthanized by cervical dislocation, the uterus was dissected and removed, the mesentery, fallopian tubes and ovaries were removed, the uterine segments were placed in a tissue embedding frame and fixed in 4% paraformaldehyde (PFA) solution for more than 16 hours.

[0116] (2) Set the program of the fully automatic tissue dehydrator and perform gradient dehydration: 50% alcohol for 1 hour, 70% alcohol for 1 hour, 80% alcohol for 1 hour, 90% alcohol for 1 hour, 100% alcohol I for 1 hour, 100% alcohol II for 1 hour, alcohol xylene 1:1 mixture for 20 minutes, xylene I for 10 minutes, xylene II for 10 minutes, xylene paraffin 1:1 mixture for 30 minutes, paraffin I for 1 hour.

[0117] (3) After the dehydration process is completed, remove the embedding frame containing the tissue and place it in pre-melted wax II. Incubate the tissue in a 70°C oven for 1 hour. Remove the tissue from the paraffin embedding machine, pour liquid paraffin into the embedding mold, and quickly place it into the uterine segment in the required direction using tweezers. After the wax block cools and solidifies, mark it and store it for subsequent paraffin sectioning.

[0118] (4) Fix the wax block on the wooden block, trim the cutting area with a blade, fix it on the microtome, set the thickness of the section to 5 micrometers, spread the water droplet and observe the tissue morphology under a microscope, collect the intact and flat sections and mark them, place them in a 40℃ drying oven overnight, and collect and store them.

[0119] 3. Immunohistochemical staining

[0120] (1) Set the baking machine to 55℃ and place the sliced ​​slices for baking for 1 hour.

[0121] (2) Place the sections on a staining rack and immerse them in a staining tank containing xylene for dewaxing, 10 minutes each time. Use an alcohol gradient of 100%, 100%, 90%, 80%, 70%, and 50% for five minutes each, and then rehydrate with deionized water for five minutes.

[0122] (3) Weigh 1.47g of trisodium citrate dihydrate and 0.18g of anhydrous citric acid and dissolve them in 500mL of deionized water to prepare an acidic repair solution. Heat the repair solution in a microwave oven until it boils, put the slice in, heat on low for 10 minutes to repair the antigen determinants, cool to room temperature and then put it in 1×PBS for 5 minutes.

[0123] (4) Prepare 200ml of 3% hydrogen peroxide solution by mixing 30% hydrogen peroxide and methanol in a 1:9 ratio. Place the slice in the solution for 10 minutes to block endogenous peroxidase. Wash with 1×PBS 3 times for 5 minutes each time.

[0124] (5) Use a histochemical pen to outline the tissue area, add 10% goat serum, and seal in a 37°C oven for 1 hour.

[0125] (6) Rabbit-derived specific antibodies were prepared by diluting 10% goat serum (primary antibodies). The primary antibodies used included: Anti-Progesterone Receptor A / B Rabbit mAb (1:1000), Anti-CRISPR-Cas9 Rabbit mAb (1:1000), Vimentin Rabbit mAb (1:1000), and Mettl3 Rabbit mAb (1:1000). The antibodies were incubated overnight at 4°C.

[0126] (7) Recover the primary antibody and wash three times with 1×PBS for 5 minutes each time.

[0127] (8) Prepare a goat anti-rabbit IgG solution (secondary antibody) in the appropriate proportion and incubate at 37°C for 1 hour.

[0128] (9) Discard the secondary antibody, wash three times with 1×PBS for 5 min each time, dilute the horseradish peroxidase (HRP) solution (tertiary antibody) according to the ratio, and incubate at 37℃ for 40 min.

[0129] (10) Discard the triple antibody, wash three times with 1×PBS for 5 minutes each time, add chromogenic solution, develop color in real time under a microscope, record the color development time, and stop the color development by placing it in deionized water.

[0130] (11) Stain with hematoxylin dilution solution for about one minute, rinse with deionized water, put in ammonia water to turn blue for 2 minutes, separate the color with hydrochloric acid for 2 seconds, rinse with deionized water, put in ammonia water to turn blue for 4 minutes, and place the slice in deionized water for 5 minutes.

[0131] (12) Dehydrate with alcohol at gradients of 50%, 70%, 80%, 90%, 100%, and 100% for 2 minutes each, and soak in xylene I and xylene II for 3 minutes each.

[0132] (13) Add an appropriate amount of neutral resin, cover with a clean coverslip, seal the slide, observe under a microscope and take a picture.

[0133] II. Experimental Results: Number t397 is genotype TG sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Four-positive mice, t393 is Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + In tri-positive mice, black arrows represent epithelial cells, including luminal and glandular epithelium. White arrows represent stromal cells. LE represents luminal epithelial cells, GE represents glandular epithelial cells, and ST represents stromal cells. The scale bar is 100 micrometers. Results are as follows: Figure 7 As shown, Vimintin is normally expressed in mouse uterine stromal cells. In wild-type mice and triple-positive mice (t393), METTL3 is expressed in the endometrium, but in quadrivalent mice (t397), METTL3 is mainly expressed in the endometrial epithelium, with significantly reduced expression in stromal cells; Mettl3 is knocked out in the uterine stromal.

[0134] Example 5: Western blot (WB) detection of TG sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Protein expression of CAS9 and METTL3 in mouse uterine epithelium

[0135] I. Experimental Methods

[0136] 1. Solution preparation:

[0137] RIPA protein lysis buffer: RIPA 1 mL, protease inhibitor 10 μL; 1× SDS-PAGE protein loading buffer: 5× SDS-PAGE protein loading buffer 1 mL, RIPA protein lysis buffer 4 mL; 1× electrophoresis buffer: SDS-PAGE electrophoresis buffer (10×) 100 mL, add distilled water to a final volume of 1 L; 1× transfer buffer: Western spectroscopy buffer... Blot transfer buffer (10×) 100mL, methanol 200mL, add distilled water to make up to 1L; 10% upper gel: upper gel solution 0.75mL, upper gel buffer 0.75mL, modified coagulant 15μL; 10% lower gel: lower gel solution 2.7mL, lower gel buffer 2.7mL, modified coagulant 60μL; 1×TBST buffer: TBST wash buffer (10×) 100mL, add distilled water to make up to 1L; 5% skim milk blocking buffer: skim milk powder 5g, 1×TBST buffer 100mL.

[0138] 2. Preparation of mouse uterine protein samples

[0139] (1) Objective: Mice were euthanized by vertebral dislocation, and the uterus was dissected, the mesentery, fallopian tubes and ovaries were removed, and the uterus was cut into several segments.

[0140] (2) Add 100-250 μL of lysis buffer containing protease inhibitors to each 20 mg tissue sample, place it in a grinding tube with 2-3 grinding beads per tube, mark it and tighten the cap, and homogenize it thoroughly with a tissue homogenizer.

[0141] (3) Centrifuge at 13,000 rpm for 15 min at 4℃, collect the supernatant with a pipette, aliquot and label, and store at -40℃ for easy subsequent experiments.

[0142] (4) Protein sample concentration was determined using the BCA method, according to the BCA protein concentration assay kit (Pierce). TM According to the instructions of the BCAProtein Assay Kit, prepare and dilute the BCA standard (2 mg / mL) in the kit to concentrations of 0, 250, 500, 1000 and 2000 ng / μL. Shake the prepared standard thoroughly, centrifuge and store at 4°C.

[0143] (5) Mix solution A and solution B in the kit at a volume ratio of 50:1. Prepare an appropriate amount of mixture according to the volume of 100 μL required for each sample, vortex to mix, and then centrifuge briefly for later use.

[0144] (6) Prepare 200 μL empty PCR tubes for standards and test samples. Add 100 μL of freshly prepared BCA working solution to each tube. Add 5 μL of gradient standards and test protein samples in sequence. Replace 4000 ng / μL standard with 10 μL of 2000 ng / μL standard. Vortex to mix, centrifuge briefly, and incubate in a 37℃ oven for 1 h.

[0145] (7) Take 80 μL of BCA reaction solution into a 96-well plate, check and pop the air bubbles, put it into the microplate reader, set the absorbance value at a wavelength of 560 nm, plot the binomial standard curve with the concentration of standard from 0 to 4000 ng / μL and the corresponding absorbance value, and calculate the protein concentration of the sample to be tested according to the formula.

[0146] (8) Dilute each sample to the same concentration using RIPA protein lysis buffer, add 5×SDS-PAGE protein loading buffer at one-quarter of the sample volume, vortex to mix, centrifuge, boil for 5-10 min, and store at -20℃ for later use.

[0147] 3. SDS-PAGE gel preparation

[0148] (1) Prepare the glue-making tools. Select a 1 mm thick glass long plate and a glass short plate, clean them with pure water to remove any residue, align the ends of the long and short plates and insert them into the glue-making bracket. Pour pure water into the glass plate to check for leakage. If leakage is found in a short time, reassemble. If there is no leakage, let it dry for later use.

[0149] (2) Using the YARN PAGE Gel Rapid Preparation Kit (10%), prepare a 1 mm gel according to the instructions. Take 2.7 mL each of the lower gel solution and the lower gel buffer and mix thoroughly.

[0150] (3) Add 60 μL of modified coagulant to the lower layer adhesive mixture, mix well, and then use a 1 mL pipette to draw up the solution and slowly inject it into the glass plate along the edge of the short plate until the liquid surface is about 0.5 cm away from the upper edge of the glass short plate. Then add it to the upper edge of the glass short plate to make the lower layer adhesive solidify and flat.

[0151] (4) After the lower gel has solidified, pour off the isopropanol, gently rinse off the excess liquid with pure water, invert for several minutes to filter out the water, and carefully absorb the excess liquid with absorbent paper. Take 0.75 mL each of the upper gel solution and the upper gel buffer, mix well, add 15 μL of modified coagulant, mix gently, fill the glass tank, insert a clean 1 mm comb, and wait for the upper gel to solidify.

[0152] 4. SDS-polyacrylamide gel electrophoresis

[0153] (1) Install the solidified gel plate into the electrophoresis tank, pour in freshly prepared electrophoresis buffer, carefully remove the comb, observe the integrity of the pores, and use a syringe to draw electrophoresis solution to gently rinse the sample wells so that the liquid in the sample wells is balanced with the electrophoresis solution, so as to avoid affecting the migration of the sample proteins.

[0154] (2) According to the experimental sequence, add 10 μL of protein sample in sequence (the amount of sample added depends on the gel thickness and comb). Add protein marker to one side and add the same volume of 1×SDS-PAGE protein loading buffer to the blank well.

[0155] (3) Install the electrophoresis equipment and set it to 100V constant voltage electrophoresis. After the bromophenol blue stripe runs out of the stacking gel, adjust it to 120V constant voltage for electrophoresis to completely separate the protein markers. Stop electrophoresis when the bromophenol blue stripe reaches the bottom of the gel.

[0156] 5. SDS-PAGE protein transfer

[0157] (1) After the protein separation by gel electrophoresis, remove the gel plate, separate the glass plate, use a gel knife to cut off the stacking gel and the gel below bromophenol blue, and carefully put it into the pre-cooled transfer buffer to equilibrate.

[0158] (2) Take out the pre-cut PVDF membrane with a pore size of 0.22 to 0.45 micrometers, place it in methanol for 3 minutes to activate, and then transfer it to a pre-cooled transfer buffer for equilibration. At the same time, put the filter paper and the sponge pad used for transfer into the pre-cooled transfer buffer to moisten them for later use.

[0159] (3) With the blackboard facing down, stack the sponge, filter paper, SDS-PAGE gel, PVDF membrane, filter paper, and sponge from bottom to top. Note that the transfer should be carried out in pre-cooled transfer buffer. Ensure that the SDS-PAGE gel and PVDF membrane are free from impurities and damage, fully wet them, and avoid air bubbles during stacking that could affect the protein transfer effect. Secure the sponge tightly.

[0160] (4) Place the transfer clamp in the transfer tank with the positive and negative poles in the corresponding directions, put in the ice box and fill it with transfer buffer, put the transfer electrophoresis box in ice water, close the lid with the positive and negative poles in the corresponding directions, and set the constant current of 150mA for 90min for transfer.

[0161] 6. Immunoblotting

[0162] (1) After the transfer is complete, remove the PVDF membrane, with the side in contact with the SDS-PAGE gel facing up, immerse it in Ponceau S staining solution for 1 min, then wash off the staining solution with methanol and observe the protein lanes.

[0163] (2) Based on the molecular weight of the target protein and the protein marker band, cut out the corresponding range of lane positions. After cutting, place the PVDF membrane into a labeled incubator and wash the membrane three times with 1×TBST for 5 minutes each time.

[0164] (3) Freshly prepared 5% skim milk powder was sealed in a shaker at room temperature for 1 hour, and the membrane was washed three times with 1×TBST for 5 minutes each time.

[0165] (4) Dilute the antibody using the Western Blot primary antibody dilution buffer from Guangzhou Shuiyuntian Company according to the instructions. The primary antibodies used included: Anti-GAPDH Rabbit mAb (1:1000, CST), Anti-Progesterone Receptor A / BRabbit mAb (1:1000, CST), Anti-CRISPR-Cas9 Rabbit mAb (1:1000, CST), and METTL3 Rabbit mAb (1:1000, CST). Immerse the PVDF membrane with the corresponding primary antibody and incubate overnight at 4°C on a shaker. Recover the primary antibody and wash the PVDF membrane three times with 1×TBST for 5 min each time.

[0166] (5) The secondary antibody is selected according to the source of the primary antibody and diluted with 5% skim milk powder at a ratio of 1:20000. The PVDF membrane is added to the secondary antibody and incubated on a shaker at room temperature for 1 hour. The secondary antibody is discarded and the membrane is washed 3 times with 1×TBST for 5 minutes each time.

[0167] (6) According to the instructions of the Shuiyuntian ECL chemiluminescence reagent kit, solution A and solution B are mixed in a 1:1 ratio, and evenly added to the membrane. The membrane is then detected on a chemiluminescence analyzer, photographed and saved, and plotted for analysis.

[0168] II. Experimental Results: Figure 8 As shown, immunoblotting analysis was used to observe the protein expression in uterine tissue. t397 represents TG. sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Mice, t393 is Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl -Cas9 / + Mice, WT being wild-type mice. CAS9 protein expression was detected in both four-positive and three-positive mice, with no significant difference in expression levels. No expression was observed in wild-type mice, indicating that CAS9 protein was successfully induced and activated. METTL3 protein expression was slightly lower in four-positive mice, but no significant change was observed in three-positive and wild-type mice, proving that METTL3 protein was successfully knocked down in the uterus of four-positive mice.

[0169] Combining the results of Examples 4 and 5, immunohistochemistry showed no TG. sgMettl3 In the genotype, METTL3 was not knocked out in the mouse uterine stroma, consistent with wild-type expression. In the presence of TG... sgMettl3 In genotype-positive mice, METTL3 expression in stromal cells was significantly decreased, and CAS9 expression was not detected by immunohistochemistry. Western blotting, however, detected TG. sgMettl3 -Pgr flpo / + -Vim fsf -Cre / + -Rosa26 lsl-Cas9 / + Mice and Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Mice successfully expressed CAS9, and METTL3 was only expressed in TG. sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + It was knocked out in mice.

[0170] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.

Claims

1. A method for constructing a Cas9 mouse with a gene knockout specific to uterine stromal cells, characterized in that, Includes the following steps: S1, Building Vim fsf-Cre / + Mouse: Cas9 mRNA and sgRNA targeting the Vim gene were obtained by in vitro transcription; a homologous recombination vector for knocking in the Vim gene DNA fragment was constructed using BAC clone RP23-14I24 as a template; Cas9 mRNA, sgRNA and homologous recombination vector were transformed into mouse zygotes and then obtained by genotyping. The sequence of the sgRNA targeting the Vim gene is shown in SEQ ID NO: 1 and SEQ ID NO: 2; the DNA fragment for knocking into the Vim gene includes, from the 5' end to the 3' end, an upstream homologous arm, an FRT-6xSV40 pA-FRT-Kozak-iCre-WPRE-BGH pA expression cassette, and a downstream homologous arm; the nucleotide sequence of the upstream homologous arm is the sequence immediately adjacent to the 5' end of the start codon of the first exon of the Vimentin gene, the nucleotide sequence of the downstream homologous arm is the sequence immediately adjacent to the 3' end of the start codon of the first exon of the Vimentin gene, and the sequence of the FRT-6xSV40 pA-FRT-Kozak-iCre-WPRE-BGH pA expression cassette is shown in SEQ ID NO: 3; S2, Build Pgr Flpo / + Mice: The 2A-flop sequence was inserted into the 3'UTR of the Pgr gene, and then obtained by genotyping. S3, Build Pgr flpo / + -Vim fsf-Cre / + Mice: Vim fsf-Cre / + Mice and Pgr Flpo / + Mouse hybridization, and genotypic selection to obtain double-positive mice Pgr flpo / + -Vim fsf-Cre / + Mice; S4, Pgr flpo / + -Vim fsf-Cre / + Mice and Rosa26 lsl-Cas9 / + Mouse hybridization, and genotypic selection to obtain triple-positive mice Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + The mouse, namely the Cas9 mouse, can achieve gene knockout specifically in uterine stromal cells.

2. The application of the Cas9 mice with uterine stromal cell-specific gene knockout obtained by the method of claim 1 in the construction of tissue-specific gene knockout animal models.

3. Conditional knockout mice of uterine stromal cells (TG) sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + The construction method is characterized by, The three-yang rat Pgr obtained by the method described in claim 1 flpo / + -Vim fsf-Cre / + -Rosa26 lsl -Cas9 / + Mice and TG sgMettl3 TG mice were obtained through hybridization and genotyping to create conditional knockout mice of uterine stromal cells. sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + ; The TG sgMettl3 The mice were constructed by integrating a DNA fragment of sgRNA targeting Mettl3 into the mouse genome using the PiggyBAC transposase system, followed by genotyping and screening. The DNA fragment of the sgRNA targeting Mettl3, from the 5' end to the 3' end, includes, in sequence, the U6 promoter, Mettl3-sgRNA1, U6 promoter, Mettl3-sgRNA2, U6 promoter, sgGFP encoding gene, CAG promoter encoding gene, mcherry encoding protein, SV40 poly(A) encoding gene, mcherry encoding protein, P2A peptide encoding gene, GFP encoding gene, and bGH poly(A) encoding gene; The sequence of Mettl3-sgRNA1 is: 5'-TGCCGCCCAGGAGTTGATTG-3'; The sequence of Mettl3-sgRNA2 is: 5'-GTTGAAAAGTTTCGCTCTCG-3'.

Images