Use of substances inhibiting expression of OsPP18 gene in improving rice blast resistance

By using the CRISPR/Cas9 system to target and edit the rice OsPP18 gene, the problem of insufficient resistance to rice blast was solved, resulting in a significant improvement in rice blast resistance, simplifying the breeding process and reducing costs.

CN119120565BActive Publication Date: 2026-07-24CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV
Filing Date
2024-10-24
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

In existing technologies, rice blast resistance is narrow and easily overcome by pathogens. There is a lack of broad-spectrum resistance genes, making it difficult to effectively improve rice resistance to rice blast through gene editing technology.

Method used

By using the CRISPR/Cas9 system to target and edit the OsPP18 gene in rice and suppress its expression, and by using sgRNA to guide the Cas9 protein to cleave the target sequence, the OsPP18 gene can be knocked out or its expression suppressed, thereby enhancing the rice's resistance to rice blast.

Benefits of technology

It significantly improves rice resistance to rice blast, reduces lesion area and pathogen biomass, is simple to operate and low in cost, and has broad prospects for breeding applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119120565B_ABST
    Figure CN119120565B_ABST
Patent Text Reader

Abstract

The present application relates to the field of biotechnology, and discloses application of a substance for inhibiting expression of an OsPP18 gene in improving rice blast resistance, wherein the OsPP18 gene is a gene for encoding an OsPP18 protein. Inoculation experiments show that, compared with a receptor rice, an OsPP18 knockout rice strain has enhanced resistance to rice blast, and an OsPP18 overexpression rice strain has weakened resistance to rice blast, indicating that the OsPP18 is a gene related to plant disease resistance. The method of the present application is simple in operation, low in cost, greatly accelerates the breeding process, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the application of substances that inhibit the expression of the OsPP18 gene in the field of biotechnology in improving rice blast resistance. Background Technology

[0002] "Food is the paramount necessity of the people, and rice is the foremost food crop." Rice is a vital staple crop worldwide, and improving its yield and quality is a crucial issue related to national food security. Rice blast is a significant fungal disease in rice production, severely impacting both yield and quality. Therefore, improving main varieties and cultivating and promoting new rice varieties with stable yields and good resistance are urgently needed. Discovering new genes related to rice disease resistance, conducting in-depth research on the regulatory network of these genes, and applying them to production will lay the foundation for promoting the breeding and dissemination of superior varieties.

[0003] The CRISPR / Cas system is a natural immune system in bacteria, helping to clear invading viruses and foreign nucleic acids. It consists of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) sequence elements and Cas proteins. Through modification, the CRISPR / Cas9 system can use a short RNA (sgRNA) to guide the endonuclease Cas9 to cleave target sequences, achieving mutations in target genes. The CRISPR / Cas9 system has advantages such as simple operation, low cost, and high efficiency. It was named one of the top ten scientific advances of 2013 by Science and one of the most noteworthy technologies of 2014 by Nature Methods. Currently, this system has been successfully applied to crops such as Arabidopsis thaliana, rice, wheat, sorghum, corn, and tomatoes, providing new opportunities for crop improvement and the creation of non-GMO products.

[0004] In plant disease resistance processes, resistance conferred by resistance genes (R genes) generally has a narrow spectrum and is easily overcome by rapidly mutating physiological races. Therefore, it is necessary to find genes with broad-spectrum resistance. In the interaction between plants and pathogens, pathogens utilize a class of genes in plants to promote infection; these genes are called susceptibility genes (S genes). In recent years, with the development of CRISPR / Cas9 gene editing technology, resistance can be acquired in plants by mutating S genes, which has become a new method for breeding disease-resistant varieties. Several susceptibility genes have been reported, such as ROD1, a susceptibility gene in rice, whose deletion enhances rice resistance to multiple diseases including rice blast, bacterial blight, and sheath blight; and MLO, a susceptibility gene in wheat, whose knockout variant exhibits broad-spectrum and durable resistance to wheat powdery mildew. Discovering more novel susceptibility genes can provide candidate gene resources for obtaining disease-resistant plants through gene editing technology. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to improve the resistance of rice to rice blast.

[0006] To address the above technical problems, this invention provides the application of a substance that inhibits OsPP18 gene expression in improving rice blast resistance, wherein the OsPP18 gene is a gene encoding the OsPP18 protein; and the OsPP18 protein is a protein of type A1, A2, or A3 as follows:

[0007] A1. The amino acid sequence is the protein that is the amino acid sequence shown in SEQ ID No. 2 of the sequence listing;

[0008] A2. A protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing, which has more than 80% identity with the protein shown in A1 and is related to rice blast resistance.

[0009] A3, a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1 or A2.

[0010] In the above applications, the protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag can be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc. The amino acid sequences of some available tags are shown in Table 1.

[0011] Table 1: Label Sequence

[0012] Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL

[0013] In the above application, SEQ ID No.2 consists of 348 amino acid residues.

[0014] In the above applications, identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0015] In the above applications, the 80% or more of identity can be at least 81%, 85%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

[0016] In the above applications, the OsPP18 gene can specifically be the gene shown in E1 or E2 below:

[0017] E1, The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 1;

[0018] E2, the nucleotide sequence is the DNA molecule at positions 3001-6370 of SEQ ID No. 3.

[0019] In the above applications, the inhibition of OsPP18 gene expression is achieved by chemical mutagenesis, physical mutagenesis, RNAi, site-directed genome editing, or homologous recombination of the OsPP18 gene in rice.

[0020] In the above applications, the gene editing can be achieved using zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), clustered regularly interspaced short palindromic repeats / CRISPR-associated (CRISPR / Cas9 system), and other technologies capable of site-specific genome editing.

[0021] In the above applications, the genome editing can be specifically implemented using a CRISPR / Cas9 system. The target sequence of the CRISPR / Cas9 system is any XXX sequence located on a nucleotide sequence including XXXNGG in the OsPP18 gene; where XXX is any 19-20 bp nucleic acid sequence in the DNA molecule, and N is any nucleotide from A, T, G, or C.

[0022] The specific target sequences are those shown in positions 3273-3292 and 4129-4148 of SEQ ID No. 3 in the sequence listing.

[0023] In a specific embodiment of the present invention, the recombinant vector of the CRISPR / Cas9 system includes the recombinant vector pYL-HU-U3-OsPP18; the recombinant vector pYL-HU-U3-OsPP18 contains an sgRNA expression cassette and a Cas9 protein encoding gene, and can express sgRNA and Cas9.

[0024] In the above applications, the substances that inhibit OsPP18 gene expression include the following F1 or F2:

[0025] F1, sgRNA; the target site of the sgRNA is the sequence shown in positions 3273-3292 and 4129-4148 of SEQ ID No. 3;

[0026] F2, a CRISPR / Cas9 vector expressing the sgRNA described in F1.

[0027] The present invention also provides a method for improving rice blast resistance, comprising the following steps: inhibiting the expression of the OsPP18 gene in recipient rice to obtain target rice with higher rice blast resistance than the recipient rice.

[0028] In the above method, the improvement of rice blast resistance can be specifically manifested in the fact that the length (area) of the lesions on the leaves of the target rice after infection with the rice blast pathogen is shorter (smaller) than that of the recipient rice, and the biomass of the rice blast pathogen on the leaves of the target rice is less than that of the recipient rice.

[0029] To address the aforementioned technical problems, the present invention also provides a plant reagent for resisting rice blast, wherein the active ingredient of the reagent is a substance that inhibits the expression of the gene encoding the OsPP18 protein, reduces the abundance of the OsPP18 protein, and / or knocks out the gene encoding the OsPP18 protein.

[0030] The above-mentioned reagent for resisting rice blast contains the following substances: F1, F2, or F3:

[0031] F1, sgRNA, siRNA, shRNA, miRNA, or antisense RNA targeting the gene;

[0032] F2. Generate a DNA molecule that targets the gene with sgRNA, a DNA molecule that targets the gene with siRNA, a DNA molecule that targets the gene with shRNA, a DNA molecule that targets the gene with miRNA, or a DNA molecule that targets the gene with antisense RNA.

[0033] F3, generating an expression vector for sgRNA targeting the gene, generating an expression vector for siRNA targeting the gene, generating an expression vector for shRNA targeting the gene, generating an expression vector for miRNA targeting the gene, or generating an expression vector for antisense RNA targeting the gene.

[0034] The active ingredients of the above-mentioned agents for resisting rice blast may also contain other biological and / or non-biological components. The other active ingredients of the above-mentioned agents can be determined by those skilled in the art based on the plant's disease resistance effect.

[0035] The present invention also provides an OsPP18 protein, wherein the OsPP18 protein is a protein of type A1, A2, or A3 as follows:

[0036] A1. The amino acid sequence is the protein that is the amino acid sequence shown in SEQ ID No. 2 of the sequence listing;

[0037] A2. A protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing, which has more than 80% identity with the protein shown in A1 and is related to rice blast resistance.

[0038] A3, a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1 or A2.

[0039] This invention also provides biomaterials related to the OsPP18 protein, which are any one of B1 to B5 below:

[0040] B1. A nucleic acid molecule encoding the protein OsPP18;

[0041] B2, an expression cassette containing the nucleic acid molecule described in B1;

[0042] B3, a recombinant vector containing the nucleic acid molecule described in B1, or a recombinant vector containing the expression cassette described in B2;

[0043] B4. Recombinant microorganisms containing the nucleic acid molecules described in B1, or recombinant microorganisms containing the expression cassette described in B2, or recombinant microorganisms containing the recombinant vector described in B3;

[0044] B5. A transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the nucleic acid molecule described in B1, or a transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the expression cassette described in B2.

[0045] The nucleic acid molecule can be a DNA molecule, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be an RNA molecule, such as mRNA or hnRNA.

[0046] In the above-mentioned biological materials, the nucleic acid molecule described in B1 is a gene as shown in E1 or E2 below:

[0047] E1, The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 1;

[0048] E2, the nucleotide sequence is the DNA molecule at positions 3001-6370 of SEQ ID No. 3.

[0049] The present invention also protects a CRISPR / Cas9 system comprising a vector expressing Cas9 and sgRNA, wherein the target sequence of the sgRNA is positions 3273-3292 and 4129-4148 of SEQ ID No. 3 in the sequence listing.

[0050] Inoculation experiments showed that, compared with recipient rice, OsPP18 knockout rice lines exhibited enhanced resistance to rice blast, while OsPP18 overexpression rice lines showed weakened resistance to rice blast, indicating that OsPP18 is a gene related to plant disease resistance. The method of this invention is simple to operate, low in cost, and greatly accelerates the breeding process, possessing broad application prospects. Attached Figure Description

[0051] Figure 1 This refers to the gene editing form of OsPP18 in wild-type Nipponbare (NPB) and OsPP18 knockout plants (OsPP18-8 and OsPP18-10) in Example 1 of this invention.

[0052] Figure 2 The figure shows the relative expression levels of the OsPP18 gene in wild-type Nipponbare (NPB) and OsPP18 overexpressing plants (OsPP18-OE20 and OsPP18-OE30) in Example 2 of this invention. The ** in the figure represents the result of the significance analysis, where P < 0.01.

[0053] Figure 3The results of resistance testing after inoculation of wild-type Nipponbare (NPB), two knockout lines (OsPP18-8 and OsPP18-10), and two overexpression lines (OsPP18-OE20 and OsPP18-OE30) with rice blast fungus in Example 3 of this invention are as follows. Figure 3 Figure A shows the phenotypes of wild-type Nipponbare (NPB), two knockout lines (OsPP18-8 and OsPP18-10), and two overexpression lines (OsPP18-OE20 and OsPP18-OE30) after inoculation with strain P131. Figure 3 Figure B is Figure 3 The statistical results of the lesion area in Figure A. Figure 3 The C diagram is Figure 3 Figure A shows the results of blast fungus biomass detection. ** in the figure represent significant differences (P < 0.01).

[0054] Figure 4 The ROS burst levels at different time points after chitin treatment in Example 4 of this invention are: wild-type Nipponbare (NPB), knockout line (OsPP18-8), and overexpression line (OsPP18-OE20).

[0055] Figure 5 The values ​​represent the MAPK activation levels at different time points after chitin treatment in Example 5 of this invention, for wild-type Nipponbare (NPB), knockout line (OsPP18-8), and overexpression line (OsPP18-OE20).

[0056] Figure 6 Figure 6 shows the relative expression levels of disease-related genes after chitin treatment in wild-type Nipponbare (NPB), knockout line (OsPP18-8), and overexpression line (OsPP18-OE20) of this invention. In the figure, * indicates a significant difference result of P<0.05, and ** indicates a significant difference result of P<0.01. The disease-related genes are OsPR1b and OsAOS2. Detailed Implementation

[0057] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0058] In the quantitative experiments described below, three replicate experiments were conducted, and the average value of the results was taken.

[0059] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0060] The composition and concentration of MS culture medium used in the following examples are shown in Table 2.

[0061] Table 2 MS medium composition and concentration used

[0062]

[0063] The vector pYL-HU-U3-CCDB used in the following examples is a product of Wuhan Boyuan Biotechnology Co., Ltd., described in the literature "Zhao W, Zheng S, Ling H Q. An efficient regeneration system and Agrobacterium-mediated transformation of Chinese upland rice cultivar Handao297. Plant Cell Tissue & Organ Culture. 2011, 106(3):475.", which can be obtained by the public from China Agricultural University (i.e., the applicant) to replicate the experiments of this application.

[0064] The carrier pUbi1305 in the following embodiments is described in the non-patent literature “Liu Y, Zhang X, Yuan G, Wang D, Zheng Y, Ma M, Guo L, Bhadauria V, Peng YL, Liu JA designer rice NLR immunereceptor confers resistance to the rice blast fungus carrying noncorresponding avirulence effectors. Proc Natl Acad Sci US A. 2021 Nov; 118(44):e2110751118.doi:10.1073 / pnas.2110751118.”, which can be obtained by the public from China Agricultural University (i.e., the applicant) to replicate the experiments of this application.

[0065] The rice variety Nipponbare in the following examples is a hybrid variety obtained by the Aichi Prefectural Agricultural Research Station in Japan in 1957 by crossing "Yamahiko" and "Sachikaze". It was introduced to China by the Chinese Academy of Agricultural Sciences from Japan in 1967. It was approved by Shandong Province in 1985, with the number: Jingyin 153. The public can obtain it from China Agricultural University (i.e., the applicant) to repeat the experiments in this application.

[0066] The *Magnaporthe oryzae* strain P131 in the following examples is the pathogen of rice blast, described in the non-patent literature "Liu H, Lu X, Li M, Lun Z, Yan X, Yin C, Yuan G, Wang X, Liu N, Liu D, Wu M, Luo Z, Zhang Y, Bhadauria V, Yang J, Talbot NJ, Peng YL. Plant immunity suppression by an exo-β-1,3-glucanase and an elongation factor 1α of the rice blastfungus. Nat Commun. 2023 Sep 7;14(1):5491. doi:

[0067] "10.1038 / s41467-023-41175-z." is available to the public from China Agricultural University (i.e., the applicant) to replicate the experiments described in this application.

[0068] The data in the following examples were processed using GraphPad Prism 9 statistical software. The experimental results are expressed as mean ± standard deviation. The t-test was used, and P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates a highly significant difference.

[0069] Example 1: Establishment and identification of OsPP18 gene knockout lines

[0070] The genomic sequence of the OsPP18 gene is shown in SEQ ID No. 3, where positions 1-3000 are its own promoter, positions 3149-3375 are exon 1, positions 4128-4255 are exon 2, positions 4347-4445 are exon 3, positions 4536-4694 are exon 4, positions 4919-5005 are exon 5, positions 5094-5185 are exon 6, positions 5423-5497 are exon 7, and positions 5599-5778 are exon 8. The CDS sequence of the OsPP18 gene is shown in SEQ ID No. 1, and the protein it encodes is named OsPP18, the amino acid sequence of which is shown in SEQ ID No. 2.

[0071] SEQ ID No.1

[0072]

[0073] SEQ ID No.2

[0074] MHGRPSRPLASSSSSSSSRVFSFFLAPRVFLLVVVVVVVVFLPGRSSCWWLEGTEELEEEMGFAGDCSPVSGGGLSENGKFSYGYASAPGKRASMEDFYETRIDGVDGETIGLFGVFDGHGGARAAEYVKQHLFSNLIKHPKFISDIKSAIAETYNHTDSEFLKAESSHTRDAGSTASTAILVGDRLLVANVGDSRAVVCRGGDAIAVSRDHKPDQSDERQRIEDAGGFVMWAGTWRVGGVLAVSRAFGDKLLKQYVVADPEIKEEIVDSSLEFLILASDGLDVVSNKEAVDMVRPIQDPEQAAKRLLQEAYQRGSADNITVVIVRFLEGTTTGGGPSREAASDQNS

[0075] SEQ ID No.3

[0076]

[0077] 1. A short sequence from the OsPP18 gene is artificially synthesized as a guide RNA (SgRNA). The target sequences of the SgRNA are TGCCGGGTCGGTCGTCTTGC (SEQ ID No. 3, positions 3273-3292, referred to as target 1) and GAAAACGGCAAGTTCAGTTA (SEQ ID No. 3, positions 4129-4148, referred to as target 2).

[0078] 2. The vector pYL-HU-U3-CCDB was digested with the restriction endonuclease BsaI to recover the vector backbone. The coding sequence of sgRNA was ligated to the vector backbone of pYL-HU-U3-CCDB using T4 ligase, yielding the recombinant vector pYL-HU-U3-OsPP18. The structure of the recombinant vector pYL-HU-U3-OsPP18 is described as follows: The coding sequence of sgRNA was inserted into the BsaI restriction site of the vector pYL-HU-U3-CCDB, while keeping the other sequences of the vector pYL-HU-U3-CCDB unchanged. The recombinant vector pYL-HU-U3-OsPP18 expresses sgRNA and Cas9.

[0079] 3. The recombinant vector pYL-HU-U3-OsPP18 was used for Agrobacterium-mediated transformation of rice. When it infected the callus tissue of the rice variety Nipponbare, the SgRNA guided the endonuclease Cas9 to the target sequence in the transgenic rice cells, completing the gene editing of the target sequence. T0 generation transformants were obtained by screening with hygromycin.

[0080] 4. Add 60 μL of M5 Hiper super-fast mix direct amplification best partner to a 2 mL centrifuge tube containing a 5 mm diameter steel ball. Cut a 1 cm leaf of the T0 generation transformant and put it into the 2 mL tube, then grind it with a grinder.

[0081] 5. Extract rice DNA by heating at 65℃ for 10 min, centrifuge at 12000 rpm for 1 min, and take 0.5 μL of the supernatant for PCR amplification. The primers used are as follows:

[0082] OsPP18-ba1-F:TCTTCCTCCTCCTCTCTCTC;

[0083] OsPP18-ba1-R:AGAGGGGTCAAGTCAAGAAAGCCC.

[0084] OsPP18-ba2-F: TGCAAACAAGTTCTTTTTTTGTCC;

[0085] OsPP18-ba2-R:AGTACCGTCGAATACGCCAAA.

[0086] 6. The sequences of the PCR products were compared with those of the wild type to identify the gene editing pattern in the OsPP18 knockout rice materials. Several homozygous knockout lines were selected, with two homozygous lines designated as OsPP18-8 and OsPP18-10. Results are shown below. Figure 1 :

[0087] OsPP18-8: Compared with wild-type Nipponbare (NPB), the OsPP18-8 mutant plant has a mutation in the OsPP18 gene in its genome. At target site 2, two homologous chromosomes have deleted G at position 4145 of SEQ ID No. 3 (located in exon 2), a total deletion of 1 bp, resulting in a frameshift mutation of the OsPP18 gene. This prevents it from encoding the protein OsPP18 with the amino acid sequence of SEQ ID No. 2, ultimately leading to the loss of function of OsPP18 and thus knocking out the OsPP18 gene.

[0088] OsPP18-10: Compared with wild-type Nipponbare (NPB), the OsPP18-10 mutant plant has a mutation in the OsPP18 gene in its genome. At target site 2, two homologous chromosomes have deleted AG at positions 4144-4145 of SEQ ID No. 3 (located in exon 2), resulting in a frameshift mutation of the OsPP18 gene. This mutation prevents the OsPP18 protein with the amino acid sequence of SEQ ID No. 2 from being encoded, ultimately leading to the loss of function of OsPP18 and thus knocking out the OsPP18 gene.

[0089] Example 2: Establishment and identification of OsPP18 overexpression lines

[0090] 1. Using cDNA from the rice variety Nipponbare as a template, the open reading frame sequence of the OsPP18 gene was amplified by PCR, and the PCR product was recovered. The primers used are as follows:

[0091] HA-OsPP18-Flag-F:5'-GTTCCAGATTACGCTTCT AAGCTT ATGCATGGGAGGCCGTCG-3' (its 25th-42nd positions are identical to the 1st-18th positions of SEQ ID No. 1, and the underlined sequence is the Hind III enzyme recognition site sequence);

[0092] HA-OsPP18-Flag-R:5'-ATGGTCTTTGTAGTCAGA AAGCTTTGAGTTTTGGTCGCTGGCG-3' (its 25-43 positions are inversely complementary to the sequence of SEQ ID No. 1, positions 1026-1044; the underlined sequence is the Hind III enzyme recognition site sequence).

[0093] The PCR product was recovered to obtain the OsPP18 gene fragment.

[0094] 2. The vector pUbi1305 was digested with Hind III to obtain the digested vector pUbi1305. The OsPP18 gene fragment was ligated into the digested vector pUbi1305 to obtain the recombinant expression vector pUbi1305-OsPP18. After verification by bacterial PCR and sequencing, the structure of the recombinant expression vector pUbi1305-OsPP18 is described as follows: The DNA molecule shown in positions 1-1044 of SEQ ID NO. 1 was inserted into the Hind III restriction endonuclease site of vector pUbi1305, while keeping the other sequences of vector pUbi1305 unchanged. In the recombinant expression vector pUbi1305-OsPP18, the expression of the OsPP18 gene is driven by the Ubi promoter.

[0095] 3. The recombinant expression vector pUbi1305-OsPP18 obtained in step 2 was introduced into Agrobacterium strain EHA105 to prepare recombinant Agrobacterium EHA105-OsPP18, which was then used to infect callus tissue of the rice variety Nipponbare. T0 generation transformants were obtained by screening with hygromycin.

[0096] 4. Leaves from wild-type Nipponbare and T0 generation transformants were cut, and DNA was extracted from them. Using Hyg-F and Hyg-R primers, the DNA from wild-type Nipponbare and T0 generation transformants was amplified. The specific sequences of Hyg-F and Hyg-R are as follows:

[0097] Hyg-F: 5'-TTGGCGACCTCGTATTGGGAA-3';

[0098] Hyg-R: 5'-CAAAGATCGTTATGTTTATCGGCACT-3'.

[0099] Electrophoresis was performed on the obtained PCR fragments. Plants that amplified approximately 500 bp of hygromycin fragments were identified as T0 generation OsPP18 transgenic positive plants (i.e., OsPP18 overexpressing plants).

[0100] 5. Transplant T0 generation OsPP18 transgenic positive plants into soil, self-pollinate to collect T1 generation seeds, continue planting and self-pollinate to collect T2 generation seeds, and analyze the segregation of hygromycin resistance in the T2 generation. Several overexpression homozygous lines were selected, among which two homozygous lines were numbered OsPP18-OE20 and OsPP18-OE30, respectively.

[0101] 6. Total RNA was extracted from rice, and cDNA was obtained by reverse transcription, followed by qRT-PCR. Using the OsUBQ10 gene as an internal control, the expression level of the OsPP18 gene in wild-type Nipponbare (NPB) and various overexpression homozygous lines (OsPP18-OE20 and OsPP18-OE30) was detected by quantitative real-time PCR (ABI 7500, USA).

[0102] The primer sequences used are shown in Table 3, and the experiment was repeated three times.

[0103] Table 3 Primer sequences

[0104] OsPP18 CTCAACTGCCTCAACAGCTATTC GGGTTTGTGATCCCTTGAAACTG OsUBQ10 TGGTCAGTAATCAGCCAGTTTGG GCACCACAAATACTTGACGAACAG

[0105] See results Figure 2 It can be seen that the expression of the OsPP18 gene is significantly upregulated in the transgenic rice lines OsPP18-OE20 and OsPP18-OE30.

[0106] Example 3: Phenotypic Analysis of OsPP18 Knockout and Overexpression Rice Lines Against Rice Blast

[0107] To detect the resistance of OsPP18 knockout and overexpression rice lines to rice blast fungus, phenotype was observed through scratch inoculation. The specific steps are as follows:

[0108] 1. Seeds of wild-type Nipponbare, two knockout lines (OsPP18-8 and OsPP18-10), and two overexpression lines (OsPP18-OE20 and OsPP18-OE30) were soaked in water in a 37℃ incubator for two days to germinate. The germinated seeds were then transferred to 9 cm diameter pots and cultured at 30℃ for approximately 20 days until the four-leaf stage. The greenhouse was maintained at 70% relative humidity, with 14 hours of light and 10 hours of darkness daily.

[0109] 2. Activated Magnolia oryzae strain P131 was grown in an incubator at 28°C for about 7 days.

[0110] 3. Take the second-to-last leaf from the four-leaf stage of rice plants in step 1, and take at least 5 leaves from each plant line. Cut them into 6-7 cm lengths and lightly score them with an insect needle to a depth of about 1 mm. 2Make three incisions on the main vein of each leaf. Place the treated, incised leaves in a 10cm x 10cm petri dish, pre-lined with moistened filter paper to maintain humidity.

[0111] 4. Rinse the petri dishes from step 2 with 0.025% Tween water, collect the spores of strain P131, and adjust the spore concentration to 1.5 × 10⁻⁶. 5 A P131 spore suspension was prepared at a concentration of spores / mL.

[0112] 5. Before inoculation, spray the surface of the leaves treated in step 3 evenly with 0.025% Tween water to form a mist, which will increase the adhesion of the spore suspension. Inoculate each wound on the leaf with 10 μL of P131 spore suspension (see step 4). Keep the inoculated leaves moist in a petri dish and treat them in the dark for 24 to 36 hours.

[0113] 6. After dark treatment, move the petri dishes to light conditions and observe and photograph the lesions after 3 to 4 days. The phenotypes of wild-type Nipponbare, two knockout lines (OsPP18-8 and OsPP18-10), and two overexpression lines (OsPP18-OE20 and OsPP18-OE30) after inoculation with strain P131 are shown in the figure. Figure 3 Figure A.

[0114] 7. Perform lesion length statistics, as follows:

[0115] The areas of 12 lesions infected with strain P131 were measured in wild-type Nipponbare plants, two knockout lines (OsPP18-8 and OsPP18-10), and two overexpression lines (OsPP18-OE20 and OsPP18-OE30). The average value was calculated, and a Student's t-test was used to determine statistical significance. Results are shown in […]. Figure 3 Figure B.

[0116] 8. Quantitative analysis of bacterial biomass in rice leaves:

[0117] For specific implementation methods, please refer to "Yoji Kawano, Akira Akamatsu, Keiko Hayashi, Yusuke Housen, Jun Okuda, Ai Yao, Ayako Nakashima, Hiroki Takahashi, Hitoshi Yoshida, HannLing Wong, Tsutomu Kawasaki, Ko Shimamoto. Activation of a Rac GTPase by the NLRfamily disease resistance protein Pit plays a critical role in rice innateimmunity, Cell Host Microbe,2010,7(5):362-75" article.

[0118] Leaves measuring 2×1cm in size, including lesions, were inoculated with strain P131. DNA was extracted using the conventional CTAB method, and the DNA concentration was measured and quantified to 3μg.

[0119] Real-time quantitative PCR was used, following the manufacturer's (Genestar) instructions. SYBR green I fluorescent dye was added to the PCR system, and the expression of the *MoPot2* gene from *Blastomyces oryzae* was detected using a quantitative PCR instrument (ABI 7500, USA), with the *Ubiquitin* gene from rice as an internal control. The primer sequences used are shown in Table 4. The experiment was performed in triplicate, and the results are shown below. Figure 3 Figure C.

[0120] Table 4 Primer sequences

[0121] MoPot2 ACGACCCGTCTTTACTTATTTGG AAGTAGCGTTGGTTTTGTTGGAT OsUbiqintin TTCTGGTCCTTCCACTTTCAG ACGATTGATTTAACCAGTCCATGA

[0122] Figure 3 The results showed that, compared with the wild type, the OsPP18 knockout lines exhibited enhanced resistance to rice blast fungus, while the overexpression lines showed weakened resistance to rice blast. Specifically, the area of ​​rice blast lesions on the leaves of OsPP18 knockout lines was smaller and the biomass of rice blast fungus was reduced, while the area of ​​rice blast lesions on the leaves of OsPP18 overexpression lines was larger and the biomass of rice blast fungus was increased.

[0123] Example 4: ROS burst levels in rice lines with OsPP18 knockout and overexpression under chitin treatment

[0124] To detect the ROS burst level in OsPP18 knockout and overexpression rice lines treated with chitin, the specific method is as follows:

[0125] 1. Seeds of wild-type Nipponbare, the knockout line OsPP18-8, and the overexpression line OsPP18-OE20 were soaked in water in a 37℃ incubator for two days to germinate. The germinated seeds were then transferred to 9 cm diameter pots and cultured in a 30℃ incubator for approximately 20 days until the seedling stage (four leaves and one bud). The greenhouse was maintained at a relative humidity of 70%, with 14 hours of light and 10 hours of darkness per day.

[0126] 2. Take rice heart slices in good growth condition, make them into small round slices using a 4mm diameter punch, and transfer them to sterile water to recover for 12-18 hours.

[0127] 3. Add 50 μL of sterile water to each well of the 96-well plate, and use a white pipette tip to pick up a small round disc and place it into the well.

[0128] 4. Prepare the reaction solution, which contains 0.02 mM luminol, 20 μg / ml horseradish peroxidase, 10 μg / ml chitin or sterile water, and add it to an eight-tube PCR tube.

[0129] 5. Using a multi-pipette, quickly add 50 μL of reaction solution to the well containing the small discs. Place the plate in the microplate reader and take readings every minute for 20-40 minutes until the curve gradually decreases. See the results below. Figure 4 .

[0130] Figure 4 The results showed that, compared with the wild type, the ROS burst level in the OsPP18 knockout line rice ospp18-8 was significantly increased, while the ROS burst level in the OsPP18 overexpression line rice OsPP18-OE20 was significantly decreased.

[0131] Example 5: Activation levels of MAPKs in rice lines with OsPP18 knockout and overexpression after chitin treatment.

[0132] To detect the activation levels of MAPKs in OsPP18 knockout and overexpression rice lines treated with chitin, the specific methods are as follows:

[0133] 1. Treat the seeds of wild-type Nipponbare, knockout line OsPP18-8 and overexpression line OsPP18-OE20 with 70% alcohol for 3 minutes, then wash with 30% laundry detergent for 45 minutes. After that, rinse the seeds with plenty of sterile water in a laminar flow hood until there is no foam and then air dry.

[0134] 2. Spread the seeds on solid 1 / 2 MS medium and incubate at 28°C for 5 to 7 days, then transfer them to liquid 1 / 2 MS medium and incubate for 2 to 3 days.

[0135] 3. Seedlings of wild-type, OsPP18 knockout, and overexpression lines were treated with ultrapure water and 10 μg / mL chitin suspension (chitin suspension was prepared with water, sonicated, and stored at -20℃, with a stock solution concentration of 1 mg / mL). Samples were taken at 0, 15, 30, and 60 minutes, respectively.

[0136] 4. To extract total protein from the sample obtained in step 3, the phosphatase inhibitor PhosSTOP needs to be added to the protein extraction buffer. TM .

[0137] 5. The protein content of MAPK3, MAPK6 and the internal reference protein Actin in the above protein samples was detected by Western blotting using Phospho-p44 / 42 antibody (for detecting the level of phosphorylated MAPKs) and Actin antibody (both commercially available antibodies; Phospho-p44 / 42 antibody catalog number: Cell Signaling Technology 4370; Actin antibody catalog number: EASYBIO BE0027-100).

[0138] Figure 5 The results showed that, compared with the wild type, the activation levels of MAPK3 and MAPK6 in the OsPP18 knockout line rice OsPP18-8 were significantly increased, while the activation levels of MAPK3 and MAPK6 in the OsPP18 overexpression line rice OsPP18-OE20 were significantly decreased.

[0139] Example 6: Expression levels of disease-related genes in OsPP18 knockout and overexpression rice lines treated with chitin.

[0140] To detect the expression levels of disease-related genes in OsPP18 knockout and overexpression rice lines treated with chitin, the specific steps are as follows:

[0141] 1. Treat the seeds of wild-type Nipponbare, knockout line OsPP18-8 and overexpression line OsPP18-OE20 with 70% alcohol for 3 minutes, then wash with 30% laundry detergent for 45 minutes. After that, rinse the seeds with plenty of sterile water in a laminar flow hood until there is no foam and then air dry.

[0142] 2. Spread the seeds on solid 1 / 2 MS medium and incubate at 28°C for 5 to 7 days, then transfer them to liquid 1 / 2 MS medium and incubate for 2 to 3 days.

[0143] 3. Seedlings of wild-type, OsPP18 knockout, and overexpression lines were treated with ultrapure water and 10 μg / mL chitin suspension (chitin suspension was prepared with water, sonicated, and stored at -20℃, with a stock solution concentration of 1 mg / mL). Samples were taken 6 hours after treatment.

[0144] 4. Extract total RNA from the sample obtained in step 3 and reverse transcribe it to obtain cDNA.

[0145] 5. The expression levels of pathogenesis-related genes OsPR1b and OsAOS2 in the above cDNA samples were detected by real-time PCR (ABI 7500, USA), with OsUBQ10 as an internal reference gene (the detection gene and primer sequences are shown in Table 5).

[0146] Table 5

[0147] OsPR1b TACGCCAGCCAGAGGAGC GCCGAACCCCAGAAGAGG OsAOS2 AAGCTGCTGCAATACGTGTACTGG CGACGAGCAACAGCCTTCCG OsUBQ10 TGGTCAGTAATCAGCCAGTTTGG GCACCACAAATACTTGACGAACAG

[0148] Figure 6 The results showed that, compared with the wild type, the induction of disease-related genes in the OsPP18 knockout rice line OsPP18-8 was significantly increased, while the induction of disease-related genes in the OsPP18 overexpression rice line OsPP18-OE20 was significantly decreased.

[0149] In summary, knocking out the OsPP18 gene significantly improves rice blast resistance, while overexpressing the OsPP18 gene significantly reduces rice blast resistance.

[0150] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Inhibition OsPP18 The application of gene-expressed substances in improving rice blast resistance is characterized by: The OsPP18 The gene is the gene encoding the OsPP18 protein; the OsPP18 protein is a protein of type A1 or A2 as follows: A1. The amino acid sequence is the protein that is the amino acid sequence shown in SEQ ID No. 2 of the sequence listing; A2, a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1.

2. The application according to claim 1, characterized in that: The OsPP18 The gene is one shown in E1 or E2 below: E1, The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 1; E2, the nucleotide sequence is the DNA molecule at positions 3001-6370 of SEQ ID No.

3.

3. The application according to claim 1 or 2, characterized in that: The inhibition of rice OsPP18 Gene expression is achieved through the expression of receptors in rice. OsPP18 The gene editing was achieved using the CRISPR / Cas9 system.

4. The application according to claim 3, characterized in that: The CRISPR / Cas9 system includes a vector expressing Cas9 and sgRNA, wherein the target sequence of the sgRNA is positions 3273-3292 and 4129-4148 of SEQ ID No. 3 in the sequence listing.

5. A method for improving rice blast resistance, characterized in that: Includes the following steps: inhibiting the receptor in rice as described in claim 1 or 2 OsPP18 Gene expression was used to obtain rice varieties with higher resistance to rice blast than the recipient rice.