Method for editing cattle gene based on Pro-iCHI

Abstract

The invention belongs to the technical field of molecular biology and genetics, and particularly relates to a method for editing cattle genes based on Pro-iCHI. The invention provides a method for editing cattle genes based on Pro-iCHI, which comprises the following steps: transiently expressing protamine in cattle AG-haESCs after gene editing, and injecting into mature oocytes to obtain reconstructed embryos. The protamine can remove abnormal DNA methylation generated by an oocyte cytoplasm injection haploid stem cell technology, cell nucleuses are compressed into a sperm-like structure, the obtained bovine Pro-iCHI embryo can smoothly develop into a blastocyst, and the ratio of the blastocyst to the blastocyst obtained by in-vitro fertilization is equivalent. Moreover, the protamine coding gene is inserted into the saccharomyces cerevisiae protein expression vector and then is subjected to transient expression, so that the protamine coding gene cannot be integrated into a genome to cause insertion of an exogenous gene while abnormal DNA methylation is erased.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology and genetics, and specifically relates to a method for editing cattle genes based on Pro-iCHI. Background Art

[0002] Haploid cells only contain one set of chromosomes, so gene mutations in haploid cells are dominant mutations, which can be applied to gene screening at the mammalian cell level. Under natural conditions, the only haploid cells in mammals are eggs and sperm. The egg and sperm combine to obtain a diploid fertilized egg, which eventually develops into a complete individual. Haploid embryos of mice, cattle, and sheep can be obtained through parthenogenetic activation and micromanipulation to remove female pronuclei. Since their genomes spontaneously diploidize in vitro, haploid stem cells are obtained from haploid embryos, and then maintained using flow cytometry to obtain haploid embryonic stem cells that can be cultured in vitro for a long time and can be used for biological research.

[0003] Studies have confirmed that gene-edited semi-cloned mice can be prepared in mice through gene-edited sperm-like haploid cells and oocyte intracytoplasmic haSCs injection (iCHI). However, there are still some difficulties in the application of this technology in cattle breeding. During the development of reconstructed embryos, there are abnormal methylation modifications, which makes it difficult for reconstructed embryos to develop into blastocysts and cannot be used for the subsequent preparation of semi-cloned animals. Summary of the invention

[0004] The purpose of the present invention is to make up for the shortcomings of the existing technology, to perform gene editing on cattle, to erase the abnormal methylation modification produced by the oocyte cytoplasmic injection of haploid stem cell technology, to obtain iCHI blastocysts, to enable the iCHI blastocysts to successfully develop into embryos, close to the blastocysts obtained by in vitro fertilization (IVF), and to prepare gene-edited cattle.

[0005] The present invention provides a method for editing cattle genes based on Pro-iCHI, comprising the following steps: Gene-editing of bovine haploid stem cells to obtain gene-edited bovine AG-haESCs; transiently expressing protamine in the gene-edited bovine AG-haESCs to obtain gene-edited bovine Pro-AG-haESCs; Injecting the gene-edited bovine Pro-AG-haESCs into mature oocytes to obtain reconstructed embryos; The reconstructed embryos were activated with ionomycin and then incubated with 6-dimethylaminopurine to obtain bovine Pro-iCHI embryos.

[0006] Preferably, the method for transiently expressing protamine in the gene-edited bovine AG-haESCs comprises: transfecting the gene-edited bovine AG-haESCs with a recombinant vector; The recombinant vector comprises a saccharomyces cerevisiae protein expression vector and a protamine encoding gene inserted into the saccharomyces cerevisiae protein expression vector.

[0007] Preferably, the transfection method includes electroporation.

[0008] Preferably, the concentration of ionomycin is 5-10 μM; and the activation time is 5-10 min.

[0009] Preferably, the concentration of 6-dimethylaminopurine is 2-4 mM; and the incubation time is 5-6 h.

[0010] Preferably, the method of gene editing the bovine haploid stem cells comprises introducing a gene editing system into the bovine haploid stem cells; The gene editing system includes a basic vector and a guide editor and a fusion protein introduced into the basic vector; the guide editor includes a guide RNA, a primer sequence and a transcription template sequence of the gene to be edited; the guide RNA includes a spacer sequence of the gene to be edited; The fusion protein includes a Cas9 protein in the H840A gap form and a reverse transcriptase.

[0011] Preferably, the gene editing of bovine haploid stem cells comprises: MSTN Gene editing.

[0012] Preferably, for positioning the MSTN The nucleotide sequence of the spacer sequence of the gene is shown in SEQ ID NO.4.

[0013] The present invention also provides the application of the method described in the above technical scheme in preparing gene-edited cattle.

[0014] Preferably, the application comprises: culturing the obtained bovine Pro-iCHI embryos, obtaining gene-edited blastocysts, performing embryo transplantation, and obtaining gene-edited cattle.

[0015] Beneficial effects: The present invention provides a method for editing cattle genes based on Pro-iCHI, comprising the following steps: gene editing of cattle haploid stem cells to obtain gene-edited cattle AG-haESCs; transiently expressing protamine in the gene-edited cattle AG-haESCs, injecting into mature oocytes, obtaining reconstructed embryos; activating the reconstructed embryos with ionomycin, incubating with 6-dimethylaminopurine, obtaining cattle Pro-iCHI embryos. The transient expression of protamine in the present invention can remove abnormal DNA methylation in reconstructed embryos produced by oocyte cytoplasmic injection of haploid stem cells, specifically remove abnormal modifications of histone H3 4th lysine residue trimethylation, histone H3 9th lysine residue trimethylation and histone H3 27th lysine residue trimethylation in iCHI embryos, and compress the cell nucleus into a sperm-like structure. The results of the embodiment show that the cattle Pro-iCHI embryos obtained after transient expression of protamine can develop smoothly into blastocysts, which is comparable to the blastocyst ratio obtained by in vitro fertilization.

[0016] Furthermore, the present invention inserts the protamine encoding gene fragment into the protamine expression vector and then transiently expresses it in the gene-edited bovine AG-haESCs, thereby ensuring that the protamine only plays a role in erasing abnormal DNA methylation and will not be integrated into the genome to cause the insertion of exogenous genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0018] Figure 1 Flow chart for preparing bovine iCHI embryos; Figure 2 This is the immunofluorescence result of bovine iCHI embryo prepared in Comparative Example 1; wherein the scale bar is 100 μm; Figure 3 The statistical diagram of histone modifications of reconstructed embryos obtained by different treatments; Figure 4 The blastocyst images of preimplantation embryos obtained by different treatments; the scale bar is 100 μm; Figure 5 It is a line graph of the development rate of embryos obtained by different treatments; Figure 6 The immunostaining results of H3K4me3, H3K9me3 and H3K27me3 in test example 1 are shown in FIG. 1 , wherein the scale bar is 20 μm; Figure 7 To use the ePE system MSTN Schematic diagram of how genes are edited; Figure 8For bovine AG-haESCs MSTN Figure 1. Sanger sequencing results of gene targeting sites. Fig. 9 For wild-type bovine AG-haESCs and MSTN Western blot analysis results of MSTN protein in bovine AG-haESCs after editing; Fig.10 For wild-type live cattle and MSTN + / - Representative images of live cattle; Fig.11 For wild-type live cattle and MSTN + / - Western blot analysis results of MSTN protein in living cattle; Fig.12 In wild-type live cattle and MSTN + / - Figure 3. Sanger sequencing results of targeted sites in live cattle. DETAILED DESCRIPTION

[0019] The present invention provides a method for editing cattle genes based on Pro-iCHI, comprising the following steps: Gene-editing of bovine haploid stem cells to obtain gene-edited bovine AG-haESCs; transiently expressing protamine in the gene-edited bovine AG-haESCs to obtain gene-edited bovine Pro-AG-haESCs; Injecting the gene-edited bovine Pro-AG-haESCs into mature oocytes to obtain reconstructed embryos; The reconstructed embryos were activated with ionomycin and then incubated with 6-dimethylaminopurine to obtain bovine Pro-iCHI embryos.

[0020] As an embodiment, the present invention prepares bovine androgenic embryos. As an embodiment, the method for preparing bovine androgenic embryos of the present invention may be an injection method or a removal method. As an embodiment, the steps of the injection method of the present invention include: after removing the spindle of the mature oocyte, injecting sperm into the mature oocyte to obtain a reconstructed embryo; after activating the reconstructed embryo with ionomycin, incubating with 6-dimethylaminopurine, culturing in G1 culture medium for 3 days, and then transferring to G2 culture medium for 4.5 days to obtain a bovine androgenic embryo. As an embodiment, the steps of the removal method of the present invention include: preparing a bovine fertilized egg by in vitro fertilization, removing the female pronucleus of the bovine fertilized egg, culturing in G1 culture medium for 3 days, and then transferring to G2 culture medium for 4.5 days to obtain a bovine androgenic embryo.

[0021] After obtaining the bovine androgenic embryo, as an embodiment, the present invention removes the zona pellucida of the bovine androgenic embryo and cultures it to obtain bovine androgenic haploid stem cells. As an embodiment, the proportion of haploid cells is maintained by sorting by flow cytometry every 5 generations of culture.

[0022] After obtaining the bovine haploid stem cells, the present invention performs gene editing on the bovine haploid stem cells to obtain gene-edited bovine AG-haESCs. As an embodiment, the method of gene editing on the bovine haploid stem cells includes introducing a gene editing system into the bovine haploid stem cells; as an embodiment, the gene editing system includes a basic vector and a guide editor and a fusion protein introduced into the basic vector; the guide editor includes a guide RNA, a primer sequence and a transcription template sequence of the gene to be edited; the guide RNA includes a spacer sequence of the gene to be edited; the fusion protein includes a Cas9 protein in the form of a H840A gap and a reverse transcriptase; the guide RNA of the gene to be edited guides the Cas9 protein in the form of a H840A gap to cut the single-stranded DNA of the gene to be edited, the primer sequence recognizes the complementary sequence before the cutting site, and the reverse transcriptase performs reverse transcription using the transcription template sequence as a template, and polymerizes the transcription template sequence to the nicked DNA chain. As an embodiment, the gene editing on the bovine haploid stem cells includes: MSTN Gene editing is performed on the gene. As an embodiment, for locating the MSTN The nucleotide sequence of the spacer sequence of the gene is shown in SEQ ID NO.4; as an embodiment, it is used to locate the MSTN The nucleotide sequence of the guide editor of the gene is shown in SEQ ID NO.3. MSTN The gene is used as an example for explanation, and it should not be understood as the entire protection scope of the present invention.

[0023] After obtaining gene-edited bovine AG-haESCs, the present invention transiently expresses protamine in the gene-edited bovine AG-haESCs to obtain gene-edited bovine Pro-AG-haESCs. As an embodiment, the method for transiently expressing protamine in the gene-edited bovine AG-haESCs includes: transfecting the gene-edited bovine AG-haESCs with a recombinant vector; the recombinant vector includes a saccharomyces cerevisiae protein expression vector and a protamine encoding gene inserted into the saccharomyces cerevisiae protein expression vector. As an embodiment, the transfection method includes electrotransfection. After the protamine encoding gene is inserted into a non-integrating expression vector, the present invention transiently expresses it in the gene-edited bovine AG-haESCs, ensuring that the protamine only plays a role in erasing abnormal DNA methylation, and will not be integrated into the genome to cause the insertion of exogenous genes.

[0024] After obtaining gene-edited bovine Pro-AG-haESCs, the present invention injects the gene-edited bovine Pro-AG-haESCs into mature oocytes to obtain reconstructed embryos. As an embodiment, the ratio of the number of bovine Pro-AG-haESCs to mature oocytes is 1:1.

[0025] After obtaining the reconstructed embryo, the present invention activates the reconstructed embryo with ionomycin, and then incubates it with 6-dimethylaminopurine to obtain bovine Pro-iCHI embryos. As an embodiment, the concentration of ionomycin is 5~10 μM; as another embodiment, the concentration of ionomycin is 5 μM. As an embodiment, the activation time is 5~10min; as another embodiment, the activation time is 5 min. As an embodiment, the concentration of 6-dimethylaminopurine is 2~4 mM; as another embodiment, the concentration of 6-dimethylaminopurine is 2 mM; as an embodiment, the incubation time is 5~6 h; as another embodiment, the incubation time is 5 h.

[0026] The present invention also provides an application of the method described in the above technical solution in preparing gene-edited cattle. As an embodiment, the application includes: culturing the cattle Pro-iCHI embryo obtained by the method described in the above technical solution, obtaining gene-edited blastocysts and then performing embryo transplantation to obtain gene-edited cattle. As an embodiment, the culture includes a first culture and a second culture; the culture medium used in the first culture is a G1 culture medium, and the culture time of the first culture is 72h; the culture medium used in the second culture is a G2 culture medium.

[0027] The present invention transiently expresses protamine in bovine AG-haESCs after gene editing, which can remove abnormal DNA methylation of embryos produced by oocyte cytoplasmic injection of haploid stem cell technology, specifically remove abnormal modifications of histone H3 lysine residue 4 trimethylation, histone H3 lysine residue 9 trimethylation and histone H3 lysine residue 27 trimethylation in iCHI embryos, and compress the cell nucleus into a sperm-like structure. The results of the embodiment show that the bovine Pro-iCHI embryos obtained after transient expression of protamine can develop smoothly into blastocysts, which is comparable to the blastocyst ratio obtained by in vitro fertilization.

[0028] In order to further illustrate the present invention, a method for editing cattle genes based on Pro-iCHI provided by the present invention is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0029] The reagent compositions and sources used in the embodiments of the present invention are as follows: Hoechst 33342 staining solution: purchased from Sigma; M2 in vitro operating solution: purchased from Beijing Yihe Technology Co., Ltd.; G1 culture medium: purchased from Vitrolife; G2 culture medium: purchased from Vitrolife; mTeSR1 culture medium: purchased from Stemcell; KSOM-AA culture medium: purchased from Beijing Yihe Technology Co., Ltd.

[0030] Example 1 1. Preparation of bovine male embryos - injection method After the bovine ovaries obtained from the slaughterhouse were brought back to the laboratory, the oocytes were obtained by aspiration. After the oocytes were matured in vitro, the oocytes with the first polar body were obtained and stained with 5μg / mL Hoechst 33342 staining solution for 10 minutes. The position of the spindle was determined by briefly irradiating with ultraviolet light for 1-2 seconds. Using a Nikon inverted microscope with a 37°C hot stage, the spindle was removed in M2 in vitro operating solution containing 5μg / mL cytochalasin B (CB), and a sperm was injected into the cytoplasm. The reconstructed embryos were then activated in 5μM ionomycin solution for 5 minutes, and then placed in 2 mM 6-dimethylaminopurine at 38.5°C and 5% CO 2 The cells were incubated under saturated humidity for 5 h, cultured in G1 culture medium for 3 days, and then transferred to G2 culture medium for 4.5 days to obtain bovine male embryos.

[0031] 2. Preparation of bovine male embryos - removal The bovine ovaries obtained from the slaughterhouse were brought back to the laboratory, and the oocytes were obtained by aspiration. After the oocytes were matured in vitro, the oocytes discharged from the first polar body were obtained, and the mature oocytes discharged from the first polar body were fertilized in vitro to obtain fertilized eggs; the fertilized eggs were stained with 5μg / mL Hoechst 33342 staining solution for 10 minutes in G1 culture medium, and the positions of male and female pronuclei were determined by brief ultraviolet irradiation for 1-2 seconds, and the female pronucleus was removed by micromanipulation, and then continued to be cultured in G1 culture medium for 3 days, and then transferred to G2 culture medium and incubated at 38.5℃ and 5% CO 2 After culturing for about 4.5 days under saturated humidity conditions, bovine male embryos were obtained.

[0032] 3. Cultivation of Bovine Haploid Stem Cells (1) Since the blastocyst rates of bovine haploid embryos obtained by step 1 and step 2 are similar, namely 31.16% and 30.21% respectively, both methods can be used for the preparation and culture of bovine haploid stem cells.

[0033] In this step, the zona pellucida of the bovine male blastocysts obtained in step 1 is removed in 0.25wt.% pronase, and then cultured in FACE culture medium until stem cell colonies grow out. The FACE culture medium is based on mTeSR1 culture medium, and 2.5μM IWR1-1-endo, 10ng / mL fibroblast growth factor 2 (FGF2), 3μM CHIR99021, and 10ng / mL Activin A are added to each 500 mL of mTeSR1 culture medium.

[0034] (2) Since bovine haploid stem cells (AG-haESCs) spontaneously diploidize during the culture process, in order to maintain the proportion of haploid cells, they are continuously sorted by flow cytometry during the culture process in step 3. The specific steps are as follows: At 37°C, the stem cells cultured for 5 generations are incubated with 10μg / mL Hoechst 33342 staining solution for 30 minutes. Every 10 minutes, the cells are gently mixed to ensure uniform staining. The haploid stem cell population is selected for collection, the spontaneous diploid stem cells are removed, and the stem cells are purified. The results show that the proportion of bovine AG-haESCs can reach 20% after the initial sorting. As the number of sorting increases, the proportion can eventually reach 80%.

[0035] Example 2 1. Construction of episomal-prm1 vector (1) Using the #138320 vector (pCW57-MCS1-P2A-MCS2-mDux) purchased from the Addgene website as the backbone, Nhe I and Mlu I was used for double digestion to obtain two fragments of 2184 bp and 7847 bp. The 7847 bp fragment was recovered by agarose gel DNA recovery kit (Tiangen). Nhe I and Mlu Mouse origin Prm1 gene and enhanced green fluorescent protein ( EGFP ) gene, and the two fragments are linked together by DNA ligase to form the Prm1 plasmid. Not I restriction site for single enzyme digestion to obtain enzyme-digested fragments.

[0036] (2) Using the #84031 vector (pCRISPR-S12) purchased from the addgene website as the backbone, PCR amplification was performed using PCR amplification primers (episomal-F: 5'-ACCACCGCACAGCAAAACGGGTAGCATATGCTTC-3', SEQ ID NO: 1; episomal-R: 5'-CAGGTCTGAAGATCAATGTCTGACGAGGGGCCAG-3', SEQ ID NO: 2) to obtain a PCR product of 4047 bp.

[0037] (3) The restriction fragment obtained in step (1) and the PCR product obtained in step (2) were homologously recombined using a one-step cloning kit (purchased from Nanjing Novozymes Biotechnology Co., Ltd.), and finally an episomal-prm1 vector was obtained. The episomal vector element in the vector enables protamine to exert its effect and is not integrated into the genome.

[0038] 2. The episomal-prm1 vector obtained in step 1 was transfected into the bovine AG-haESCs obtained in Example 1 by electroporation to transiently express protamine (Protamine, Pro) in the bovine AG-haESCs to obtain bovine Pro-AG-haESCs.

[0039] Comparative Example 1 Referring to the steps of Example 1, bovine oocytes were prepared and injected with haploid stem cells (iCHI) using oocyte intracytoplasmic haSCs injection (iCHI). Figure 1Process The bovine AG-haESCs obtained in Example 1 were injected into mature bovine oocytes instead of sperm to prepare bovine iCHI embryos. The specific steps are as follows: Using a Nikon inverted microscope with a 37°C hot stage, a mature bovine oocyte was injected with bovine AG-haESCs obtained in Example 1 in M2 in vitro operation solution containing 5 μg / mL cytochalasin B. The reconstructed embryo was then activated in 5 μM ionomycin solution for 5 min and then placed in 2 mM 6-dimethylaminopurine at 38.5°C and 5% CO. 2 The bovine iCHI embryos were obtained by incubating for 5 h under saturated humidity. The entire operation was performed on a Nikon inverted microscope with a 37°C hot stage and operating arm, and the pronuclear formation and polar body formation were observed. Figure 2 As shown, PB is the polar body; PPB is the pseudopolar body; scale bar, 100 μm.

[0040] Comparative Example 2 In vitro fertilization (IVF) embryo preparation After in vitro maturation of the oocytes obtained from the ovaries, they are placed in fertilization fluid and sperm is added at a sperm-egg ratio of 500: 1. Six hours after fertilization, the sperm is washed away and placed in G1 culture medium for 3 days, then switched to G2 culture medium for 4 days until the blastocyst stage.

[0041] Example 3 Referring to the steps of Comparative Example 1, the bovine Pro-AG-haESCs obtained in Example 2 were injected into mature bovine oocytes instead of sperm to prepare bovine Pro-iCHI embryos.

[0042] Test Example 1 The development of the bovine iCHI embryos obtained in Comparative Example 1, the IVF embryos obtained in Comparative Example 2, and the bovine Pro-iCHI embryos obtained in Example 3 were counted, and the cell ratios at different stages were counted. The results are as follows: Figure 3~Figure 5 And as shown in Table 1.

[0043] Table 1 Development of different embryos

[0044] Note:* P <0.05,** P <0.01,*** P <0.001, two-tailed t test was used; 2-cell cleavage rate = (number of 2-cells / number of embryonic cells) × 100%; ratio of other cleavage periods = (number of cleavages / number of 2-cell cleavages) × 100%.

[0045] according to Figure 3~Figure 5As can be seen from Table 1, the blastocyst rate of bovine iCHI embryos obtained in Comparative Example 1 is significantly lower than that of IVF embryos, and there are abnormalities in the embryonic development stage, resulting in the inability to develop into blastocysts. Abnormal methylation modification is the main cause of embryonic development obstruction, mainly including abnormalities in histone H3 trimethylated at lysine 4 (H3K4me3), histone H3 trimethylated at lysine 9 (H3K9me3), and histone H3 trimethylated at lysine 27 (H3K27me3). However, the development rate of Pro-iCHI embryos is similar to that of IVF embryos, which means that transient expression Prm1 Abnormal methylation modification can be effectively erased, so that Pro-iCHI is restored to IVF levels. The ratio of bovine Pro-iCHI embryos obtained in Example 3 is comparable to that of blastocysts obtained by in vitro fertilization (IVF) in Comparative Example 2. The present invention improves the iCHI technology to obtain Pro-iCHI embryos for use in cattle, ensuring the feasibility of subsequent semi-cloned animal preparation.

[0046] For transient expression Prm1 The bovine AG-haESCs were validated by immunofluorescence. Figure 6 As shown. Figure 6 It can be seen that transient expression of protamine in bovine AG-haESCs in a non-integrating manner can remove abnormal H3K4me3, H3K9me3, and H3K27me3 modifications in bovine iCHI embryos and compact the cell nucleus into a sperm-like structure.

[0047] Example 4 (1) Myostatin (MSTN) is a member of the transforming growth factor β (TGFβ) superfamily. It is mainly expressed in skeletal muscle and secreted into the extracellular space. It is transported to various tissues and organs through the blood circulation, thereby playing a regulatory role. MSTN Gene mutations can cause significant changes in the animal's muscle phenotype, resulting in a "double muscle" phenomenon. MSTN Genes were selected as the target of gene editing, and Prime Editors (PE) were selected to edit the bovine AG-haESCs obtained in Example 1. MSTN Gene editing; the editing principle of the guide editor is as follows Figure 7As shown: Under the guidance of the spacer sequence on the guide RNA (pegRNA), nCas9 cuts the single-stranded DNA with the nickase, the PBS sequence (primer sequence) recognizes the complementary sequence before the cleavage site, and reverse transcription is performed using the RTT sequence (transcription template sequence) as a template to polymerize the target sequence onto the nicked DNA chain.

[0048] The guide editor used in this embodiment is composed of a gRNA scaffold, RTT and PBS, and the specific nucleotide sequence is 5'-acgacagcatcgagattctggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctgtgacagaatctcgatgctgt-3' (SEQ ID NO.3), which is recorded as bGHpoly-gRNA scaffold; wherein the spacer sequence in the gRNA scaffold is: 5'-acgacagcatcgagattctg-3' (SEQ ID NO.4); the gRNA scaffold sequence is: 5'-gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc-3' (SEQ ID NO.5); RTT sequence: 5'-tgtgacag-3'; PBS sequence: 5'-aatctcgatgctgt-3' (SEQ ID NO.6).

[0049] (2) Using the #132776 vector (pCMV-PE2-P2A-GFP) purchased from the addgene website as the backbone, S I and Pme I was double digested, the target fragment was obtained by DNA gel electrophoresis, and the target fragment was recovered using a gel recovery kit (Tiangen) to obtain a recovered fragment; the bGH poly-gRNA scaffold sequence fragment of step (1) was synthesized in Shanghai Bioengineering, and the two fragments were integrated together using the ClonExpress Ultra One-Step Cloning Kit V2 (Vazyme). The #84031 vector (pCRISPR-S12) purchased from the addgene website was used as the backbone. Bm I and Pac I was used for double restriction digestion, and homologous recombination was performed again with the integration fragment in the previous step to obtain a non-integration guide editor (episomal plasmid-based, ePE) plasmid.

[0050] (4) The ePE obtained in step (3) was transfected into the bovine AG-haESCs obtained in Example 1 through a transfection experiment. After culture, DNA was extracted from the bovine AG-haESCs, and the DNA in the bovine AG-haESCs was detected by the dideoxy sequencing method (Sanger sequencing method). MSTN The results show that MSTN There is an 11 bp deletion in exon 2 of the locus ( Figure 8 ).

[0051] (5) After transfection in step (4), wild-type bovine AG-haESCs (denoted as WT) and MSTN The culture medium of bovine AG-haESCs (denoted as △11bp) with an 11bp deletion in exon 2 of the locus was discarded, and Tryple (Gibco) was added to digest the cells for 3 minutes. The cell suspension was collected, centrifuged and the liquid was discarded. 1mL of cell lysis buffer (phenylmethylsulfonyl fluoride: RIPA lysis buffer volume ratio of 1:99) was added to the cell pellet to reselect the cells. Let it stand at 4℃ for 20 minutes, put it in a 4℃ centrifuge, centrifuge at 12000rmp for 20 minutes, and aspirate the supernatant to obtain the protein. Using TUBB protein as an internal reference, a protein blotting experiment (Western Blot) was performed at the protein level. MSTN The results showed that bovine AG-haESC also showed MSTN knockout at the protein level ( Fig. 9 ).

[0052] Example 5 (1) The obtained samples from Example 4 were electroporated MSTN The knockout bovine AG-haESCs were transfected with the episomal-prm1 vector obtained in Example 2. MSTN MSTN was obtained by transiently expressing protamine in bovine AG-haESCs knocked out + / - Bovine Pro-AG-haESCs.

[0053] (2) Referring to the steps of Comparative Example 1, MSTN + / - Bovine Pro-AG-haESCs were injected into mature bovine oocytes instead of sperm to produce MSTN + / - Bovine Pro-iCHI embryos.

[0054] Test Example 2 The Pro-iCHI embryos (wild type) prepared in Example 3 and the MSTN obtained in Example 5 were counted respectively. + / - The development of bovine Pro-iCHI embryos, and the cell proportions at different stages were statistically analyzed. The results are shown in Table 2.

[0055] Table 2 Development of different embryos

[0056] From Table 2, we can see that MSTN Gene editing did not affect the blastocyst rate of Pro-iCHI embryos, and there was no significant difference between the two.

[0057] Example 6 (1) The bovine Pro-iCHI embryos (wild type) obtained in Example 3 and the MSTN obtained in Example 5 + / - The bovine Pro-iCHI embryos were cultured in G1 medium and G2 medium for 7-8 days to obtain blastocysts for subsequent embryo transfer. The specific steps are as follows: Using a Nikon inverted microscope with a 37°C hot stage, mature bovine oocytes were injected with bovine Pro-iCHI embryos (wild type) obtained in Example 3 and MSTN obtained in Example 5 in M2 in vitro manipulation solution containing 5 μg / mL cytochalasin B (CB). + / - Bovine Pro-iCHI embryos, the reconstructed embryos were then placed in KSOM-AA embryo culture medium for 1 hour, activated with 5 μM ionomycin (I) for 5 minutes, and then placed in 10 μg / mL cycloheximide (CHX) for 5 hours. After culturing in G1 culture medium for 72 hours, they were transferred to G2 culture until blastocysts.

[0058] (2) The recipient cow was treated for estrus, and a progesterone vaginal plug (CIDR) was placed in the recipient cow. The vaginal plug was removed on day 7 and prostaglandin (PG) was injected. The estrus of the recipient cow was then observed and recorded. After 7 days of estrus, the blastocyst obtained in step (1) was transplanted into the recipient cow. The blastocyst for transplantation was stored in M199 culture medium supplemented with 15% fetal bovine serum, and the pregnancy status was determined by rectal ultrasound EVO scanner on the 35th day after transplantation.

[0059] In this example, 15 recipient cows were transplanted, with one embryo transplanted into each cow. After 287 days of gestation, 2 (13.3%, 2 / 15) MSTN cows with a "double muscle" phenotype were successfully born. + / - calf( Fig.10 and Table 3). Live samples were taken from the calved cows and Western Blot was used to verify the expression of MSTN at the protein level. + / - The calf obtained from the knockout blastocyst is MSTN + / - Gene-edited cattle have a double-muscle phenotype, and Sanger sequencing also shows MSTN There is an 11 bp deletion in the gene ( Fig.11 and Fig.12 ) Table 3 Transplantation and production of different embryos

[0060] Based on the above content, it can be seen that the technical solution provided by the present invention can remove the abnormal DNA methylation produced by the oocyte cytoplasmic injection of haploid stem cells, compress the cell nucleus into a sperm-like structure, and the obtained bovine Pro-iCHI embryo can successfully develop into a blastocyst, which is comparable to the blastocyst ratio obtained by in vitro fertilization.

[0061] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for bovine gene editing based on Pro-iCHI, characterized in that: The steps include: Gene-editing of bovine haploid stem cells to obtain gene-edited bovine AG-haESCs; transiently expressing protamine in the gene-edited bovine AG-haESCs to obtain gene-edited bovine Pro-AG-haESCs; Injecting the gene-edited bovine Pro-AG-haESCs into mature oocytes to obtain reconstructed embryos; The reconstructed embryos were activated with ionomycin and then incubated with 6-dimethylaminopurine to obtain bovine Pro-iCHI embryos.

2. The method according to claim 1, characterized in that: The method for transiently expressing protamine in the gene-edited bovine AG-haESCs comprises: transfecting the gene-edited bovine AG-haESCs with a recombinant vector; The recombinant vector comprises a saccharomyces cerevisiae protein expression vector and a protamine encoding gene inserted into the saccharomyces cerevisiae protein expression vector.

3. The method according to claim 2, characterized in that The transfection method includes electroporation.

4. The method according to claim 1, characterized in that: The concentration of ionomycin is 5-10 μM; the activation time is 5-10 min.

5. The method according to claim 1, characterized in that The concentration of 6-dimethylaminopurine is 2-4 mM; the incubation time is 5-6 h.

6. The method according to claim 1, characterized in that The method of gene editing the bovine haploid stem cells comprises introducing a gene editing system into the bovine haploid stem cells; The gene editing system includes a basic vector and a guide editor and a fusion protein introduced into the basic vector; the guide editor includes a guide RNA, a primer sequence and a transcription template sequence of the gene to be edited; the guide RNA includes a spacer sequence of the gene to be edited; The fusion protein includes a Cas9 protein in the H840A gap form and a reverse transcriptase.

7. The method according to any one of claims 1 to 6, characterized in that: The gene editing of the bovine haploid stem cells comprises: MSTN Gene editing.

8. The method according to claim 7, characterized in that For positioning the MSTN The nucleotide sequence of the spacer sequence of the gene is shown in SEQ ID NO.

4.

9. Use of the method according to any one of claims 1 to 8 in preparing gene-edited cattle.

10. The use according to claim 9, characterized in that: The application includes: culturing the obtained bovine Pro-iCHI embryos, obtaining gene-edited blastocysts, performing embryo transplantation, and obtaining gene-edited cattle.

Images