A method for whole cell transformation synthesis of cyanidin
By using the whole-cell transformation method of recombinant Escherichia coli and catalyzing the synthesis of qingxin ketone using the Hped and HpaBC genes, the problems of material waste and toxicity in the production of qingxin ketone in the existing technology have been solved, and low-cost, environmentally friendly and efficient production has been achieved.
Patent Information
- Application Number
- CN202411247806.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-06
- Publication Date
- 2026-01-13
- Estimated Expiration
- 2044-09-06
AI Technical Summary
Existing methods for obtaining quinone suffer from several drawbacks: natural extraction methods result in significant material waste, unstable yields, and high costs; while chemical synthesis methods involve highly toxic reagents and difficult product separation, making it challenging to achieve efficient and environmentally friendly production.
The whole-cell transformation method of recombinant Escherichia coli was adopted. By constructing plasmids containing Hped and HpaBC genes, 1-(4-hydroxyphenol)-ethanol or 4-hydroxyacetophenone was converted into qingxin ketone by recombinant strain S2 or S1 at room temperature and pressure. Qingxin ketone was then synthesized by E. coli's own enzyme protein.
This method achieves the synthesis of cinnamone under mild reaction conditions, with low production costs and environmental friendliness, replacing chemical synthesis and natural extraction methods. It also features high product yield and a simple separation process.
Smart Images

Figure CN119120598B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, specifically relating to a method for the whole-cell conversion and synthesis of qingxin ketone. Background Technology
[0002] 3,4-dihydroxyacetophenone (DHAP), also known as 3,4-dihydroxyacetophenone, has significant effects such as dilating coronary arteries, reducing myocardial oxygen consumption, improving microcirculation, enhancing myocardial nutritional blood flow, and dilating cerebral blood vessels. At the same time, it also has anti-platelet aggregation, anti-inflammatory, antioxidant, and anti-melanin production effects, and has a certain therapeutic effect on gestational hypertension in clinical practice.
[0003] Currently, methods for obtaining pentansone include natural extraction and chemical synthesis. Natural extraction involves isolating and purifying pentansone from the leaves of plants such as *Ilex cornuta*. However, this method faces several insurmountable difficulties in practice. For example, different extraction methods lack universal applicability to the plant materials used for pentansone extraction, and some require specialized equipment and processing conditions, significantly increasing extraction costs and complexity. Furthermore, the raw materials used in natural extraction often have low pentansone content, and pentansone is highly volatile, with its content decreasing significantly over time. This results in drawbacks such as large material processing volumes, significant material waste, unstable yields, and susceptibility to limitations imposed by natural resources.
[0004] Currently disclosed chemical synthesis methods include: using anhydrous aluminum trichloride as a catalyst and carbon disulfide as the reaction medium, preparing quinone by heating and reflux, with a final yield of 37%; and using acetic acid as the acetylation reagent, boron trifluoride as a catalyst, and diethyl ether as the reaction medium, reacting at 80°C for 4 hours to prepare quinone, with a final yield of 66.7%. Chemical synthesis is currently the main method for obtaining quinone, but it has problems such as toxic reagents, difficulty in separating reaction products, numerous reaction byproducts, and difficulty in treating reaction waste. Summary of the Invention
[0005] The purpose of this invention is to provide a biotransformation method that can replace chemical synthesis and natural extraction methods for synthesizing ketone. It utilizes recombinant Escherichia coli to convert 1-(4-hydroxyphenol)-ethanol / 4-hydroxyacetophenone into ketone, which has the advantages of mild reaction conditions, low production cost, and environmental friendliness.
[0006] To achieve the above objectives, the present invention provides a method for whole-cell transformation to synthesize qingxin ketone, characterized in that the method includes: inducing and culturing recombinant strain S2; and inoculating the induced bacterial cells into a culture medium containing the substrate 1-(4-hydroxyphenol)-ethanol for whole-cell transformation to synthesize the qingxin ketone, wherein the recombinant strain S2 is obtained by transforming plasmids containing the Hped gene and the HpaBC gene into Escherichia coli.
[0007] In one specific embodiment, the nucleotide sequence of the Hped gene is shown in SEQ ID NO:1, and the nucleotide sequence of the HpaBC gene is shown in SEQ ID NO:2.
[0008] In one specific implementation, the conditions for the induction culture include: when OD 600 Induction was performed when the pH value was 0.4–0.8, using isopropyl thiogalactoside as the inducer, and the final concentration of the inducer was 0.05–1.0 mmol·L⁻¹. -1 .
[0009] In one specific embodiment, the induction culture conditions further include: an induction temperature of 15–35°C and an induction time of 12–20 h.
[0010] In one specific embodiment, the concentration of the substrate 1-(4-hydroxyphenol)-ethanol is 5–15 mmol·L⁻¹. -1 The transformation temperature for whole-cell transformation is 25–45°C.
[0011] In one specific embodiment, the recombinant strain S2 is constructed using the following method:
[0012] Construction of pET-28a-Hped plasmid: Using the Hped gene as a template, PCR amplification was performed using the upstream primer P-Hped-F shown in SEQ ID NO:3 and the downstream primer P-Hped-R shown in SEQ ID NO:4 to obtain the Hped gene fragment; First, the Hped gene fragment was recovered, and then the fragment and pET-28a expression vector were simultaneously digested with NcoI and XhoI. Finally, the two digested fragments were ligated into the pET-28a expression vector using T4 DNA ligase to obtain the pET-28a-Hped plasmid;
[0013] Construction of pET-28a-HpaBC plasmid: Using the HpaBC gene as a template, PCR amplification was performed using the upstream primer P-HpaBC-F shown in SEQ ID NO:5 and the downstream primer P-HpaBC-R shown in SEQ ID NO:6 to obtain the HpaBC gene fragment; First, the HpaBC gene fragment was recovered, and then the fragment and pET-28a expression vector were simultaneously digested with NcoI and XhoI. Finally, the two digested fragments were ligated into the pET-28a expression vector using T4 DNA ligase to obtain the pET-28a-HpaBC plasmid.
[0014] The pET-28a-Hped plasmid was digested with BamHI and XhoI, and the pET-28a-HpaBC plasmid was also digested with BglII and XhoI to obtain the HpaBC fragment containing the T7 promoter. The HpaBC fragment was then ligated to the pET-28a-Hped plasmid to obtain the pet-28a-Hped-HpaBC plasmid in a pseudooperon configuration.
[0015] The pet-28a-Hped-HpaBC plasmid was introduced into E. coli BL21(DE3) competent cells to obtain the recombinant strain S2.
[0016] The present invention also provides a method for whole-cell transformation to synthesize qingxin ketone, the method comprising: inducing culture of recombinant strain S1; and inoculating the cells obtained by induction culture into a culture medium containing substrate 4-hydroxyacetophenone for whole-cell transformation to synthesize qingxin ketone, wherein the recombinant strain S1 is obtained by transforming a plasmid containing the HpaBC gene into Escherichia coli.
[0017] In one specific implementation scheme, when OD 600 Induction was performed when the pH value was 0.4–0.8, using isopropyl thiogalactoside as the inducer, and the final concentration of the inducer was 0.05–1.0 mmol·L⁻¹. -1 ;
[0018] In one specific implementation, the induction culture conditions further include: an induction temperature of 15–35°C and an induction time of 12–20 h.
[0019] In one specific embodiment, the concentration of the substrate 4-hydroxyacetophenone is 5–15 mmol·L⁻¹. -1 The transformation temperature for whole-cell transformation is 25–45°C.
[0020] The beneficial effects of the present invention include at least the following:
[0021] I. This invention provides a method for whole-cell transformation to synthesize qingxin ketone. The method includes: inducing and culturing a recombinant bacterial strain S2; and inoculating the induced bacterial cells into a culture medium containing the substrate 1-(4-hydroxyphenol)-ethanol for whole-cell transformation to synthesize the qingxin ketone. The recombinant bacterial strain S2 is obtained by transferring a plasmid containing the Hped gene and the HpaBC gene into *E. coli*. Alternatively, the method may involve: inducing and culturing a recombinant bacterial strain S1; and inoculating the induced bacterial cells into a culture medium containing the substrate 4-hydroxyacetophenone for whole-cell transformation to synthesize the qingxin ketone. The recombinant bacterial strain S1 is obtained by transferring a plasmid containing the HpaBC gene into *E. coli*. The whole-cell transformation method for synthesizing qingxin ketone provided by this invention can replace chemical synthesis and natural extraction methods for qingxin ketone synthesis, overcoming the shortcomings of existing qingxin ketone production technologies, and has advantages such as mild reaction conditions (room temperature and pressure), low production cost, and environmental friendliness.
[0022] II. Using *Escherichia coli* (E. coli) for the expression of the Hped and HpaBC genes has several advantages. Firstly, the HpaBC enzyme protein originates from *E. coli* itself, and since both *E. coli* and strain EbN1 are bacteria, they share similar gene expression environments, which is conducive to the expression of active Hped and HpaBC enzyme proteins by *E. coli*. Secondly, *E. coli* has a complete genome, simple molecular manipulation, a short growth cycle, does not require harsh culture conditions, and the transformed products are easy to isolate, thus facilitating further genetic modification and industrial production. Attached Figure Description
[0023] Figure 1 This is a route map for the synthesis of cinnamone from 1-(4-hydroxyphenol)-ethanol via whole-cell transformation of recombinant strain S2. Figure 1 China P T7 O, RBS, and T7ter represent the T7 promoter, operon, ribosome binding site, and transcription terminator, respectively.
[0024] Figure 2 The identification results of the S2 enzyme protein of the recombinant strain provided in Example 2;
[0025] Figure 3 The liquid chromatogram of the cyanidin synthesized in Example 2 is shown below.
[0026] Figure 4 This is a bar chart showing the relationship between different conversion times and the yield of cyanone during the synthesis of cyanone in Example 2;
[0027] Figure 5 The identification results of the S1 enzyme protein of the recombinant strain provided in Example 13;
[0028] Figure 6 The liquid chromatogram of the cyanidin synthesized in Example 13 is shown below.
[0029] Figure 7 The mass spectrometry analysis results of the cyanidin synthesized in Example 13 are shown below.
[0030] Figure 8 This is a bar chart showing the relationship between different conversion times and the yield of cyanone during the synthesis of cyanone in Example 13. Detailed Implementation
[0031] The present invention will now be described in detail with reference to the accompanying drawings and embodiments. However, the present invention may be implemented in many different ways as limited and covered by the claims.
[0032] Please refer to the following: Figure 1 The present invention provides a method for whole-cell transformation to synthesize qingxin ketone, the method comprising: inducing culture of recombinant strain S2; and inoculating the cells obtained by induction culture into a culture medium containing substrate 1-(4-hydroxyphenol)-ethanol for whole-cell transformation to synthesize qingxin ketone, wherein the recombinant strain S2 is obtained by transforming plasmids containing Hped gene and HpaBC gene into Escherichia coli.
[0033] In this invention, the Escherichia coli is E. coli BL21(DE3).
[0034] In this invention, the nucleotide sequence of the Hped gene is shown in SEQ ID NO:1, and the nucleotide sequence of the HpaBC gene is shown in SEQ ID NO:2.
[0035] Among them, SEQ ID NO.1:
[0036] ATGCTGCTGGAAGGCAAAACCGCGCTGGTTACCGGCGCGGGCAACGGCATCGGTCGTACCATTGCGCTGACCTACGCAGCTGAAGGCGCTAATGTTGTAGTGTCTGATATCTCTGACGAATGGGGTCGTGAAACTCTGGCACTGATTGAAGGTAAAGGTGGCAAAGCTGTTTTTCAGCACGCGGATACCGCTCACCCGGAAGATCACGATGAACTGATCGCAGCGGCGAAACGTGCCTTCGGTCGCCTGGATATCGCGTGTAACAACGCTGGTATTTCGGGTGAATTTACCCCGACCGCGGAAACCACTGATGCCCAGTGGCAGCGCGTTATTGGTATTAACCTGTCCGGTGTTTTCTACGGTGTTCGCGCGCAGATCCGTGCTATGCTGGAAACCGGTGGTGGCGCAATCGTCAACATCTCCAGCATTGCTGGTCAGATCGGTATTGAAGGTATCACCCCGTACACTGCTGCCAAGCACGGTGTAGTTGGTCTGACCAAAACGGTGGCGTGGGAATACGGCTCTAAAGGTATCCGTATCAACTCTGTAGGCCCGGCGTTCATTAATACCACTCTGGTGCAGAACGTTCCGCTGGAAACCCGTCGTCAGCTGGAACAGATGCATGCCCTGCGCCGTCTGGGTGAAACCGAAGAAGTTGCGAACCTGGTAGCATGGCTGTCCAGCGACAAAGCTTCCTT
[0037] CGTTACCGGTAGCTACTACGCGGTTGACGGCGGCTA
[0038] CTTAGCGCGCTAA
[0039] SEQ ID NO:2:
[0040]
[0041] Preferably, the recombinant strain S2 is obtained by transforming the pet-28a-Hped-HpaBC plasmid into E. coli BL21(DE3).
[0042] Preferably, the recombinant strain S2 is constructed using the following method:
[0043] Step (1) Construction of pET-28a-Hped plasmid: Using the Hped gene as a template, PCR amplification was performed using the upstream primer P-Hped-F shown in SEQ ID NO:3 and the downstream primer P-Hped-R shown in SEQ ID NO:4 to obtain the Hped gene fragment; First, the Hped gene fragment was recovered, and then the fragment and the pET-28a expression vector were simultaneously digested with NcoI and XhoI. Finally, the two digested fragments were ligated into the pET-28a expression vector using T4 DNA ligase to obtain the pET-28a-Hped plasmid.
[0044] Preferably, the PCR amplification reaction system is 50 μL, containing 1 μL template, 5 μL 10×PCR Buffer, and 10 mmol·L⁻¹. - 1 dNTP Mix 1 μL, 10 mmol·L -1 F and 10 mmol·L -1 2 μL each of R primers, 0.5 μL of pfu DNA polymerase, and 38.5 μL of sterile deionized water.
[0045] Preferably, the PCR amplification reaction conditions are: 94℃ pre-denaturation for 3 min, 35 cycles (94℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min), and 72℃ extension for 5 min.
[0046] Among them, SEQ ID NO.3: 5'-CATG CCATGG GAATGCTGCTGGA AGGC-3'
[0047] SEQ ID NO:4: 5'-CCGCTCGAGTTAGGATCCTTAGCGCGCTAAGTAGCC-3'
[0048] It should be noted that the underlined part represents the restriction enzyme site: CCATGG is Nco I, CTCGAG is Xho I, and GGATCC is BamHI.
[0049] Step (2) Construction of pET-28a-HpaBC plasmid: Using the HpaBC gene as a template, PCR amplification was performed using the upstream primer P-HpaBC-F shown in SEQ ID NO:5 and the downstream primer P-HpaBC-R shown in SEQ ID NO:6 to obtain the HpaBC gene fragment; First, the HpaBC gene fragment was recovered, and then the fragment and the pET-28a expression vector were simultaneously digested with NcoI and XhoI. Finally, the two digested fragments were ligated into the pET-28a expression vector using T4 DNA ligase to obtain the pET-28a-HpaBC plasmid.
[0050] Preferably, the PCR amplification reaction system is 50 μL, containing 1 μL template, 5 μL 10×PCR Buffer, and 10 mmol·L⁻¹. - 1 dNTP Mix 1 μL, 10 mmol·L -1 Upstream primer P-HpaBC-F and 10 mmol·L -1 2 μL each of downstream primers P-HpaBC-R, 0.5 μL of pfu DNA polymerase, and 38.5 μL of sterile deionized water.
[0051] Preferably, the PCR amplification reaction conditions are: 94℃ pre-denaturation for 3 min, 35 cycles (94℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min), and 72℃ extension for 5 min.
[0052] Among them, SEQ ID NO.5: 5'-CATG CCATGG GCATGAAGCAGAATCTG-3'
[0053] SEQ ID NO:6: 5'-CCG CTCGAG TCAACTAATGGTCATACC-3'
[0054] It should be noted that the underlined part represents the restriction enzyme site; CCATGG is Nco I, and CTCGAG is Xho I.
[0055] It should be noted that in this invention, there is no sequential relationship between steps (1) and (2).
[0056] Step (3): Digest pET-28a-Hped plasmid with BamHI and XhoI, and simultaneously digest pET-28a-HpaBC plasmid with BglII and XhoI to obtain HpaBC fragment containing T7 promoter. Then, ligate HpaBC fragment to pET-28a-Hped plasmid to obtain pet-28a-Hped-HpaBC plasmid with pseudooperon conformation.
[0057] Step (4): The pet-28a-Hped-HpaBC plasmid was introduced into E. coli BL21(DE3) competent cells to obtain the recombinant strain S2.
[0058] The induction culture includes: first, inoculating the recombinant strain S2 into LB liquid medium containing kanamycin and shaking it overnight; then, inoculating the bacterial culture into fresh LB liquid medium and shaking it until the OD... 600 When the value is 0.4 to 0.8, an inducer is added to the bacterial culture for induction culture.
[0059] Preferably, the conditions for the induction culture include: when OD 600 Induction was performed when the pH value was 0.4–0.8, using isopropyl thiogalactoside (IPTG) as the inducer, with a final concentration of 0.05–1.0 mmol·L⁻¹. -1 .
[0060] IPTG, as an inducer, can promote enzyme protein expression with increasing concentration, but its cytotoxicity also increases accordingly. When the final concentration is between 0.05 and 1.0 mmol / L... -1 At this concentration, the induction effect can be good without affecting the growth of the bacteria due to high concentration.
[0061] Preferably, the conditions for induction culture further include: an induction temperature of 15–35°C and an induction time of 12–20 h.
[0062] The induction temperature determines the quantity and quality of enzyme protein expression. When the induction temperature increases within a certain range, the enzyme gene expression rate accelerates, and the number of encoded enzyme proteins also increases. However, because they do not have enough time to fold, they often form a large number of inclusion bodies within the cell. Conversely, when the induction temperature decreases within a certain range, the enzyme gene expression rate slows down, the time available for enzyme protein folding increases, but the number of enzyme proteins decreases, ultimately leading to a reduction in product yield.
[0063] More preferably, the conditions for the induction culture include: when OD 600 Induction was performed when the value was 0.6, and the final concentration of the inducer was 0.1 mmol·L⁻¹. -1 The induction temperature was 25℃ and the induction time was 16h.
[0064] The induction culture specifically involves inoculating the recombinant strain S2 into 5 mL of solution containing 10 mg·L⁻¹. -1 In LB liquid medium containing kanamycin, at 37°C and 225 rpm... -1The culture was shaken overnight under the specified conditions; the next day, the bacterial suspension was inoculated into 50 mL of fresh LB liquid medium at a ratio of 1:50 and incubated at 37°C and 225 rpm. -1 Under shaking conditions; when the bacterial culture OD 600 When the concentration is 0.4–0.8, the inducer IPTG is added to the bacterial culture to bring the final concentration of the inducer to 0.05–1.0 mmol·L⁻¹. -1 And at 15–35℃ and 225 r·min -1 Under the specified conditions, induction culture was carried out, and the bacterial cells were collected after 12-20 hours of induction culture.
[0065] In this invention, the bacterial culture obtained after induction culture is subjected to 5000 r·min -1 Centrifuge for 10 minutes and collect the bacterial cells.
[0066] Preferably, the concentration of the substrate 1-(4-hydroxyphenol)-ethanol is 5–15 mmol·L⁻¹. -1 .
[0067] Preferably, the conditions for whole-cell transformation include: a transformation temperature of 25–45°C and a transformation time of 1–60 h; more preferably, the conditions for whole-cell transformation include: a transformation temperature of 35°C and a transformation time of 60 h.
[0068] In this invention, both excessively high and low conversion temperatures during whole-cell transformation will affect the catalytic activity of the enzyme protein. When the conversion temperature range is 47.5–60°C, the Hped enzyme protein will be inactivated.
[0069] Preferably, the conditions for whole-cell transformation further include: after the bacterial cells are inoculated into the culture medium containing the substrate 1-(4-hydroxyphenol)-ethanol, the OD of the bacterial cells is adjusted. 600 The value is 1.
[0070] Preferably, the conditions for whole-cell transformation further include: a rotation speed of 200 r / min. -1 ~300r·min -1 More preferably, the rotational speed is 225 r·min -1 .
[0071] The whole-cell transformation specifically involves: using a solution containing 5–15 mmol·L⁻¹ -1 The bacterial cells were suspended in 50 mL of M9Y medium containing 1-(4-hydroxyphenol)-ethanol, and the bacterial cells were oxidized to an OD value of 1-(4-hydroxyphenol)-ethanol. 600 The value is adjusted to 1, at 25–45℃ and 200–300 r·min. -1 Under the conditions of conversion for 1–60 h, a fermentation broth containing the aforementioned cyanone was obtained.
[0072] The fermentation broth was subjected to a flow rate of 3000 r·min -1 After centrifugation for 15 minutes, the supernatant was collected, which included cyanidin.
[0073] The present invention also provides a method for whole-cell transformation to synthesize qingxin ketone, the method comprising: inducing culture of recombinant strain S1; and inoculating the cells obtained by induction culture into a culture medium containing substrate 4-hydroxyacetophenone for whole-cell transformation to synthesize qingxin ketone, wherein the recombinant strain S1 is obtained by transforming a plasmid containing the HpaBC gene into Escherichia coli.
[0074] In this invention, the nucleotide sequence of the HpaBC gene is shown in SEQ ID NO:2.
[0075] Preferably, the recombinant strain S1 is obtained by transforming the pET-28a-HpaBC plasmid into E. coli BL21(DE3).
[0076] Preferably, the recombinant strain S1 is constructed using the following method:
[0077] Step (1): Using the HpaBC gene as a template, PCR amplification was performed using the upstream primer P-HpaBC-F shown in SEQ ID NO:5 and the downstream primer P-HpaBC-R shown in SEQ ID NO:6 to obtain the HpaBC gene fragment.
[0078] Preferably, the PCR amplification reaction system is 50 μL, containing 1 μL template, 5 μL 10×PCR Buffer, and 10 mmol·L⁻¹. - 1 dNTP Mix 1 μL, 10 mmol·L -1 Upstream primer P-HpaBC-F and 10 mmol·L -1 2 μL each of P-HpaBC-R primers, 0.5 μL of pfu DNA polymerase, and 38.5 μL of sterile deionized water.
[0079] Preferably, the PCR reaction conditions are: 94℃ pre-denaturation for 3 min, 35 cycles (94℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min), and 72℃ extension for 5 min.
[0080] Step (2): First, the HpaBC gene fragment is recovered. Then, the fragment and the pET-28a expression vector are digested simultaneously with NcoI and XhoI. Finally, the two digested fragments are ligated into the pET-28a expression vector using T4 DNA ligase to obtain the pET-28a-HpaBC plasmid.
[0081] Step (3) The overnight ligated pET-28a-HpaBC plasmid was transformed into E. coli BL21(DE3) competent cells by heat shock, and then treated with a solution containing 10 mg·L⁻¹. -1 Recombinant E. coli resistant to kanamycin were screened on LB solid plates to obtain the recombinant strain S1.
[0082] The induction culture includes: first, inoculating the recombinant strain S1 into LB liquid medium containing kanamycin and shaking it overnight; then, inoculating the bacterial culture into fresh LB liquid medium and shaking it; when OD... 600 When the value is 0.4 to 0.8, an inducer is added to the bacterial culture for induction culture.
[0083] Preferably, the conditions for the induction culture include: when OD 600 Induction was performed when the pH value was 0.4–0.8, using isopropyl thiogalactoside (IPTG) as the inducer, with a final concentration of 0.05–1.0 mmol·L⁻¹. -1 .
[0084] IPTG, as an inducer, can promote enzyme protein expression with increasing concentration, but its cytotoxicity also increases accordingly. When the final concentration is between 0.05 and 1.0 mmol / L... -1 At this concentration, the induction effect can be good without affecting the growth of the bacteria due to high concentration.
[0085] Preferably, the conditions for induction culture further include: an induction temperature of 15–35°C and an induction time of 12–20 h.
[0086] The induction temperature determines the quantity and quality of enzyme protein expression. When the induction temperature increases within a certain range, the enzyme gene expression rate accelerates, and the number of encoded enzyme proteins also increases. However, because they do not have enough time to fold, they often form a large number of inclusion bodies within the cell. Conversely, when the induction temperature decreases within a certain range, the enzyme gene expression rate slows down, the time available for enzyme protein folding increases, but the number of enzyme proteins decreases, ultimately leading to a reduction in product yield.
[0087] More preferably, the conditions for the induction culture include: when OD 600 Induction was performed when the value was 0.6, and the final concentration of the inducer was 0.1 mmol·L⁻¹. -1 The induction temperature was 25℃ and the induction time was 16h.
[0088] The induction culture specifically involves inoculating the recombinant strain S1 into 5 mL of solution containing 10 mg·L⁻¹. -1 In LB liquid medium containing kanamycin, at 37°C and 225 rpm...-1 The culture was shaken overnight under the specified conditions; the next day, the bacterial suspension was inoculated into 50 mL of fresh LB liquid medium at a ratio of 1:50 and incubated at 37°C and 225 rpm. -1 Under shaking conditions; when OD 600 When the concentration is 0.4–0.8, the inducer IPTG is added to the bacterial culture to bring the final concentration of the inducer to 0.05–1.0 mmol·L⁻¹. -1 And at 15–35℃ and 200–300 r·min -1 Under the specified conditions, induction culture was carried out, and the bacterial cells were collected after 12-20 hours of induction culture.
[0089] In this invention, the bacterial culture obtained after induction culture is subjected to 5000 r·min -1 Centrifuge for 10 minutes and collect the bacterial cells.
[0090] Preferably, the concentration of the substrate 4-hydroxyacetophenone is 5–15 mmol·L⁻¹. -1 .
[0091] Preferably, the conditions for whole-cell transformation include: a transformation temperature of 25–45°C and a transformation time of 1–60 h; more preferably, the conditions for whole-cell transformation include: a transformation temperature of 35°C and a transformation time of 60 h.
[0092] In this invention, both excessively high and low conversion temperatures during whole-cell transformation will affect the catalytic activity of the enzyme protein. When the conversion temperature range is 47.5–60°C, the Hped enzyme protein will be inactivated.
[0093] Preferably, the conditions for whole-cell transformation further include: after the bacterial cells are inoculated into the culture medium containing the substrate 4-hydroxyacetophenone, adjusting the OD of the bacterial cells. 600 The value is 1.
[0094] Preferably, the conditions for whole-cell transformation further include: a rotation speed of 200 r / min. -1 ~300r·min -1 More preferably, the rotational speed is 225 r·min -1 .
[0095] The whole-cell transformation specifically involves: using a solution containing 5–15 mmol·L⁻¹ -1 The bacterial cells were suspended in 50 mL of M9Y medium containing 4-hydroxyacetophenone, and the OD was adjusted. 600 The value is 1, at 25–45℃ and 200 r·min -1 ~300r·min -1 Under the conditions of conversion for 1–60 h, a fermentation broth containing the aforementioned cyanone was obtained.
[0096] The fermentation broth was subjected to a flow rate of 3000 r·min -1 After centrifugation for 15 minutes, the supernatant was collected, which included cyanidin.
[0097] Example
[0098] 1. Materials and Reagents Instructions
[0099] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Specifically: PFU DNA polymerase, 200bp DNA ladder, agarose gel DNA recovery kit, protein molecular weight standard (MP171211), and plasmid extraction kit were purchased from TIANGEN; restriction endonucleases NcoⅠ, XhoⅠ, BamHI, and T4 DNA ligase were purchased from Thermo Scientific; SDS-PAGE kit and isopropyl β-D-thiogalactoside (IPTG) were purchased from Shanghai Sangon Biotech Co., Ltd.; and kanamycin (Kana) was purchased from Hefei Bomei Biotechnology Co., Ltd.
[0100] 2. Description of bacterial strains and plasmids
[0101] The strains and plasmids used in the examples are detailed in Table 1.
[0102] Table 1 shows the sources of the strains and plasmids used in the examples.
[0103] strain / plasmid characteristic source strain BL21(DE3) F-,ompT,hsdS(rBB-mB-),gal,dcm(DE3) This laboratory preserves Recombinant strain S1 BL21(DE3) containing the pet-28a-HpaBC plasmid This study constructs Recombinant strain S2 BL21(DE3) containing the pet-28a-Hped-HpaBC plasmid This study constructs Control strain S3 BL21(DE3) containing the pet-28a plasmid This study constructs plasmid pet-28a-Hped <![CDATA[Plasmid containing the Hped gene, Kana R > This study constructs PET-28A-HPABC <![CDATA[Plasmid containing the HpaBC gene, Kana R > This study constructs pet-28a-Hped-HpaBC <![CDATA[Plasmid containing the Hped and HpaBC genes, Kana R > This study constructs PET-28A <![CDATA[Empty gene expression plasmid, Kana R > This laboratory preserves
[0104] 3. Culture medium instructions
[0105] Luria-Bertani (LB) medium is used for plasmid amplification, strain preparation, and protein induction expression.
[0106] LB medium consists of: 5 g·L -1 Yeast extract, 10 g·L -1 trypsin and 10 g·L -1 NaCl.
[0107] M9Y medium was used for whole-cell transformation experiments.
[0108] M9Y culture medium contains: 17.1 g·L -1 Na2HPO4·12H2O, 3g·L -1 KH2PO4, 0.5 g·L -1 NaCl, 1 g·L -1 NH4Cl, 2 g·L -1 Glucose, 7 g·L-1 Yeast extract, 2 g·L -1 Tryptone, 1 mM MgSO4, 0.1 mM CaCl2.
[0109] Example 1
[0110] Construction of recombinant bacterial genome S2
[0111] Step 1.1: Using the Hped gene as a template, PCR amplification was performed using the upstream primer P-Hped-F shown in SEQ ID NO:3 and the downstream primer P-Hped-R shown in SEQ ID NO:4. The PCR amplification reaction system was 50 μL, containing 1 μL of template, 5 μL of 10×PCR Buffer, and 10 mmol·L⁻¹. -1 dNTP Mix 1 μL, 10 mmol·L -1 P-Hped-F and 10 mmol·L -1 2 μL each of P-Hped-R primers, 0.5 μL of pfu DNA polymerase, and 38.5 μL of sterile deionized water; PCR reaction conditions were: 94℃ pre-denaturation for 3 min, 35 cycles (94℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min), and 72℃ extension for 5 min.
[0112] The amplified Hped gene fragment was first recovered using an agarose gel DNA recovery kit, and then the fragment and pET-28a expression vector were simultaneously digested with NcoI and XhoI. Finally, the two digested fragments were ligated into the pET-28a expression vector using T4 DNA ligase to obtain the pET-28a-Hped plasmid.
[0113] Step 1.2: Using the HpaBC gene as a template, PCR amplification was performed using the upstream primer P-HpaBC-F shown in SEQ ID NO:5 and the downstream primer P-HpaBC-R shown in SEQ ID NO:6. The PCR amplification reaction system was 50 μL, containing 1 μL of template, 5 μL of 10×PCR Buffer, and 10 mmol·L⁻¹. -1 dNTP Mix 1 μL, 10 mmol·L -1 P-HpaBC-F and 10 mmol·L -1 2 μL each of P-HpaBC-R primers, 0.5 μL of pfu DNA polymerase, and 38.5 μL of sterile deionized water; PCR reaction conditions were: 94℃ pre-denaturation for 3 min, 35 cycles (94℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min), and 72℃ extension for 5 min.
[0114] The amplified gene fragments were first recovered using an agarose gel DNA recovery kit, and then the fragments and pET-28a expression vector were simultaneously digested with NcoI and XhoI. Finally, the two digested fragments were ligated into the pET-28a expression vector using T4 DNA ligase to obtain the pet-28a-HpaBC plasmid.
[0115] Step 1.3: Digest the pET-28a-Hped plasmid with BamHI and XhoI, and simultaneously digest the pET-28a-HpaBC plasmid with BglII and XhoI to obtain the HpaBC fragment containing the T7 promoter; since BamHI and BglII are isosinetases, ligate HpaBC with pET-28a-Hped to obtain the pet-28a-Hped-HpaBC plasmid with a pseudooperon conformation.
[0116] Step 1.4: The pet-28a-Hped-HpaBC plasmid was introduced into E. coli BL21(DE3) competent cells to obtain recombinant strain S2.
[0117] Example 2
[0118] Recombinant strain S2 was used for whole-cell transformation to synthesize qingxin ketone.
[0119] 2.1 Expression of S2 enzyme protein in recombinant strain
[0120] Recombinant strain S2 was inoculated into a solution containing 10 mg·L⁻¹ -1 In LB liquid medium containing kanamycin, at 37°C and 225 rpm... -1 The culture was shaken overnight under the specified conditions; the next day, the bacterial suspension was inoculated into 50 mL of fresh LB liquid medium at a ratio of 1:50 and incubated at 37°C and 225 rpm. -1 Under shaking conditions; when OD 600 When the concentration is 0.6, the inducing agent IPTG is added to the bacterial culture to bring the final concentration to 0.5 mmol·L⁻¹. -1 At 15℃ and 225 r·min -1 Induction culture was performed under the specified conditions for 16 hours. 1 ml of bacterial culture was used for enzyme protein identification, while other bacterial cultures were subjected to 5000 rpm. -1 Collect the bacterial cells after centrifugation for 10 minutes.
[0121] 2.2 Enzyme Protein Identification
[0122] In this invention, the expression of enzyme proteins is identified by SDS-PAGE electrophoresis.
[0123] For detailed identification results, please see Figure 2 , Figure 2The results of prokaryotic expression of pet-28a-Hped-HpaBC are as follows. Figure 2 In lane M, the protein's relative molecular mass standard is used. Lanes 1 and 3 contain control strain S3 and recombinant strain S2, respectively, after treatment with 0.5 mmol·L⁻¹. -1 Results of IPTG induction at 0h: Lanes 2 and 4 were for control strain S3 and recombinant strain S2, respectively, induced by 0.5 mmol·L⁻¹. -1 Results after 16 hours of IPTG induction. From Figure 2 As can be seen, in addition to the expression band of HpaBC enzyme protein, there is also an expression band similar to the theoretical molecular weight of Hped enzyme protein (27.6 kDa) in the recombinant strain S2 cells, which proves that the recombinant strain S2 was successfully constructed.
[0124] Among them, the control group S3 was obtained by introducing the pET-28a vector into E.coli BL21(DE3) competent cells.
[0125] 2.3 Whole-cell conversion of qingxin ketone
[0126] Use 5 mmol·L -1 (690.8 mg·L) -1 The bacterial cells were suspended in 50 mL of M9Y medium containing 1-(4-hydroxyphenol)-ethanol, and their OD values were adjusted accordingly. 600 The value was adjusted to 1; at 35℃ and 225 r·min -1 Under the given conditions, the fermentation broth containing cyanidin was obtained after 60 hours of conversion.
[0127] 2.4 Detection of cyanidins
[0128] During whole-cell transformation, 5 mL of fermentation broth was aspirated from M9Y medium every 12 h and subjected to a reaction at 3000 r·min. -1 After centrifugation for 15 min, the supernatant was collected and freeze-dried. The freeze-dried product was then reconstituted with 2 mL of methanol and filtered through a 0.22 μm filter. 20 μL of the filtrate was passed through a C18 column (ZORBAX SB, 4.6 × 250 mm) equipped with a UV detector. 2 Qualitative and quantitative analysis was performed using high performance liquid chromatography (HPLC, Shimadzu, Japan) with a resolution of 5 μm.
[0129] The molecular weight of the target product in the filtrate was analyzed using a Xevo G2-XS QTof LC-MS / MS (Waters Corporation, USA). The mobile phase for HPLC analysis of recombinant strain A consisted of methanol: 0.1% phosphoric acid aqueous solution (10:90). The column temperature was maintained at 40℃, the flow rate at a constant 1 mL / min, and the target product was detected at 276 nm. For mass spectrometry analysis, positive ion mode was used, with a drying gas flow rate of 6 L / min, a nebulizer pressure of 40 Psig, a nebulizer gas temperature of 325℃, a sheath gas temperature of 350℃, a sheath gas flow rate of 12 L / min, a capillary voltage of 4000 V, and a mass spectrometry acquisition range of 50–1000 m / z.
[0130] The quantitative results of the conversion of Example 2 and Examples 3 to 11 below for 36 hours are detailed in Table 2.
[0131] For details of the qualitative analysis results of Example 6, please refer to [link / reference]. Figure 3 As shown, Figure 3 The image shows the liquid chromatogram of the qingxin ketone synthesized in Example 6. Standard represents the standard substances, where 1 is 1-(4-hydroxyphenol)-ethanol standard, 2 is qingxin ketone standard, and 3 is 4-hydroxyacetophenone standard; S2 is BL21(DE3) containing the pet-28a-Hped-HpaBC plasmid, and S3 is BL21(DE3) containing the pet-28a plasmid. The asterisks represent qingxin ketone generated from whole-cell transformation.
[0132] For details of the quantitative analysis results in Example 6, please refer to [link / reference]. Figure 4 As shown, Figure 4 This is a bar chart showing the relationship between different conversion times and the yield of cyanone during the synthesis of cyanone in Example 6. Figure 4 It can be seen that the yield of qingxin ketone is positively correlated with the conversion time.
[0133] Examples 3 to 11
[0134] Optimal conditions for whole-cell conversion and synthesis of qingxin ketone
[0135] Examples 3 to 11 synthesized qingxin ketone by changing the induction culture conditions and whole-cell transformation conditions, in order to investigate the effects of four factors on the yield of qingxin ketone: the concentration of the inducer, the induction temperature, the transformation temperature, and the substrate concentration.
[0136] The data corresponding to each factor in Examples 3 to 11 and the yield of quinone in each example are detailed in Table 2. It should be noted that the conversion time corresponding to the yield of quinone in Table 2 is 36 hours.
[0137] Table 2. Reaction conditions and results of Examples 2 to 11
[0138]
[0139] It should be noted that the concentration unit mM in the above text is mmol / L.
[0140] Analysis of range and variance revealed that the order of influence of each factor on the yield of cinnamyl ether was: conversion temperature > induction temperature > IPTG concentration > substrate concentration. The optimal conditions were: conversion temperature 35℃ and IPTG concentration 0.1 mmol·L⁻¹. -1 Induction temperature 25℃ and substrate concentration 10 mmol·L -1 .
[0141] Under the optimal combination of conditions (i.e., Example 6), the recombinant strain S2 can steadily convert 1-(4-hydroxyphenol)-ethanol to cinnamone within a selected time period, and the yield of cinnamone is 255 mg·L⁻¹ after 60 h of conversion. -1 The yield was 18.5% (see [link]). Figure 4 ).
[0142] Example 12
[0143] Construction of recombinant bacterial group S1
[0144] Step (a): Using the HpaBC gene as a template, PCR amplification was performed using the upstream primer P-HpaBC-F shown in SEQ ID NO:5 and the downstream primer P-HpaBC-R shown in SEQ ID NO:6. The PCR amplification reaction system was 50 μL, including 1 μL template, 5 μL 10×PCR Buffer, and 10 mmol·L⁻¹. -1 dNTP Mix 1 μL, 10 mmol·L -1 P-HpaBC-F and 10 mmol·L -1 2 μL each of P-HpaBC-R primers, 0.5 μL of pfu DNA polymerase, and 38.5 μL of sterile deionized water; PCR reaction conditions were: 94℃ pre-denaturation for 3 min, 35 cycles (94℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min), and 72℃ extension for 5 min.
[0145] Step (b): The HpaBC gene fragment was first recovered using an agarose gel DNA recovery kit. Then, the fragment and the pET-28a expression vector were simultaneously digested with NcoI and XhoI. Finally, the two digested fragments were ligated into the pET-28a expression vector using T4 DNA ligase to obtain the pet-28a-HpaBC plasmid.
[0146] Step (c): The pet-28a-HpaBC plasmid was introduced into E. coli BL21(DE3) competent cells to obtain recombinant strain S1.
[0147] Example 13
[0148] Recombinant strain S1 was used for whole-cell transformation to synthesize qingxin ketone.
[0149] 13.1 Expression of S1 enzyme protein in recombinant strain
[0150] Recombinant strain S1 was inoculated into a solution containing 10 mg·L⁻¹ -1 In LB liquid medium containing kanamycin, at 37°C and 225 rpm... -1 The culture was shaken overnight under the specified conditions; the next day, the bacterial suspension was inoculated into 50 mL of fresh LB liquid medium at a ratio of 1:50 and incubated at 37°C and 225 rpm. -1 Under shaking conditions; when OD 600 When the concentration is 0.6, the inducing agent IPTG is added to the bacterial culture to bring the final concentration to 0.5 mmol·L⁻¹. -1 At 16℃ and 225 r·min -1 Induction culture was performed under the specified conditions for 16 hours. 1 ml of bacterial culture was used for enzyme protein identification, while other bacterial cultures were subjected to 5000 rpm. -1 Collect the bacterial cells after centrifugation for 10 minutes.
[0151] 13.2 Enzyme Protein Identification
[0152] In this invention, the expression of enzyme proteins is identified by SDS-PAGE electrophoresis.
[0153] For detailed identification results, please see Figure 5 , Figure 5 The results show the prokaryotic expression of pet-28a-HpaBC. Figure 5 In lane M, the protein's relative molecular mass standard is used. Lanes 1 and 3 contain control strain S3 and recombinant strain S1, respectively, after treatment with 0.5 mmol·L⁻¹. -1 Results of IPTG induction at 0h: Lanes 2 and 4 were for control strain S3 and recombinant strain S1, respectively, induced with 0.5 mmol·L⁻¹. -1 Results after 16 hours of IPTG induction. From Figure 5 As can be seen, expression bands with molecular weights similar to the theoretical molecular weight of HpaBC enzyme protein appeared in the cells of recombinant strain S1, with the large subunit at 58.9 kDa and the small subunit at 18.5 kDa, which proves that the recombinant strain S1 was successfully constructed.
[0154] Among them, the control group S3 was obtained by introducing the pET-28a vector into E. coli BL21(DE3) competent cells, and its transformation and screening methods were the same as those of the recombinant strain S1.
[0155] 13.3 Whole-cell conversion of qingxin ketone
[0156] Use 5 mmol·L-1 (690.8 mg·L) -1 The bacterial cells were suspended in 50 mL of M9Y medium containing 1-(4-hydroxyphenol)-ethanol, and their OD values were adjusted accordingly. 600 The value was adjusted to 1; at 35℃ and 225 r·min -1 Under the given conditions, the fermentation broth containing cyanidin was obtained after 24 hours of conversion.
[0157] 13.4 Detection of cyanidins
[0158] During whole-cell transformation, 5 mL of fermentation broth was aspirated from M9Y medium every 12 h and subjected to a reaction at 3000 r·min. -1 After centrifugation for 15 min, the supernatant was collected and freeze-dried. The freeze-dried product was then reconstituted with 2 mL of methanol and filtered through a 0.22 μm filter. 20 μL of the filtrate was passed through a C18 column (ZORBAX SB, 4.6 × 250 mm) equipped with a UV detector. 2 Qualitative and quantitative analysis was performed using high performance liquid chromatography (HPLC, Shimadzu, Japan) with a resolution of 5 μm.
[0159] The molecular weight of the target product in the filtrate was analyzed using a Xevo G2-XS QTof LC-MS / MS (Waters Corporation, USA). The mobile phase for HPLC analysis of the recombinant strain S1 sample consisted of methanol: 0.1% phosphoric acid aqueous solution (10:90). The column temperature was maintained at 40℃, the flow rate at a constant 1 mL / min, and the target product was detected at 276 nm. For mass spectrometry analysis, positive ion mode was used, with a drying gas flow rate of 6 L / min, a nebulizer pressure of 40 Psig, a nebulizer gas temperature of 325℃, a sheath gas temperature of 350℃, a sheath gas flow rate of 12 L / min, a capillary voltage of 4000 V, and a mass spectrometry acquisition range of 50–1000 m / z.
[0160] For detailed qualitative analysis results, please refer to Figure 6 and Figure 7 As shown. Figure 6 The image shows the liquid chromatogram of the qingxin ketone synthesized in Example 13. Standard represents the standard, where 1 is the qingxin ketone standard and 2 is the 4-hydroxyacetophenone standard; S1 is BL21(DE3) containing the pet-28a-HpaBC plasmid, and S3 is BL21(DE3) containing the pet-28a plasmid. The asterisk represents the qingxin ketone generated by whole-cell transformation. Figure 7 The mass spectrometry analysis results of the qingxin ketone synthesized in Example 13 are shown below. A is the mass spectrum of the qingxin ketone standard; B is the mass spectrum of qingxin ketone generated by the transformation of recombinant strain S1; 153.05 represents the mass spectrum of qingxin ketone with H+. + m / z after that.
[0161] For detailed quantitative analysis results, please refer to Figure 8 As shown, Figure 8 This is a bar chart showing the relationship between different conversion times and ketone production during the synthesis of ketone in Example 13. Figure 8 It can be seen that the yield of qingxin ketone is positively correlated with the conversion time.
[0162] The foregoing description provides a further detailed explanation of the present invention in conjunction with specific preferred embodiments, but it should not be construed as limiting the specific implementation of the invention to these descriptions. For those skilled in the art, various simple deductions and substitutions can be made without departing from the inventive concept, and all such modifications and substitutions should be considered within the scope of protection of the present invention.
Claims
1. A method for whole cell transformation synthesis of cyanidin, characterized by, The method comprises: inducing culture of a recombinant strain S2; and inoculating the bacteria body obtained by the induction culture into a culture medium containing a substrate 1-(4-hydroxyphenol)-ethanol to perform whole-cell transformation to synthesize the cyanidol, wherein the recombinant strain S2 is obtained by introducing a plasmid containing an Hped gene and an HpaBC gene into E. coli; the nucleotide sequence of the Hped gene is shown as SEQ ID NO: 1, and the nucleotide sequence of the HpaBC gene is shown as SEQ ID NO: 2; specifically, the recombinant strain S2 is constructed by the following method: first, constructing a pET-28a-Hped plasmid and constructing a pET-28a-HpaBC plasmid, then obtaining a pET-28a-Hped-HpaBC plasmid in a pseudoperon configuration, and finally obtaining the recombinant strain S2.
2. The method of whole cell biotransformation synthesis of cyanidin according to claim 1, wherein, The conditions of the induction culture include: induction is carried out when the OD600 value is 0.4-0.8, the inducer is isopropylthio-galactoside, and the final concentration of the inducer is 0.05-1.0 mmol·L -1 .
3. The method of whole cell biotransformation synthesis of cyanidin according to claim 2, wherein, The induction culture conditions further comprise: an induction temperature of 15-35 DEG C, and an induction time of 12-20 h.
4. The method of whole cell biotransformation synthesis of cyanidin according to claim 1, wherein, The concentration of the substrate 1-(4-hydroxyphenol)-ethanol is 5-15 mmol·L -1 The transformation temperature of the whole cell transformation is 25-45℃.
5. The method of whole cell biotransformation synthesis of cyanidin according to claim 1, wherein, The recombinant strain S2 is constructed by the following method: The pET-28a-Hped plasmid is constructed by using the Hped gene as a template, using an upstream primer P-Hped-F shown as SEQ ID NO: 3 and a downstream primer P-Hped-R shown as SEQ ID NO: 4 to perform PCR amplification to obtain an Hped gene fragment; first, the Hped gene fragment is recovered, then the recovered Hped gene fragment and a pET-28a expression vector are simultaneously subjected to NcoI and XhoI enzyme digestion, and finally, the two enzyme-digested fragments are connected by using T4 DNA ligase to obtain the pET-28a-Hped plasmid; The pET-28a-HpaBC plasmid is constructed by using the HpaBC gene as a template, using an upstream primer P-HpaBC-F shown as SEQ ID NO: 5 and a downstream primer P-HpaBC-R shown as SEQ ID NO: 6 to perform PCR amplification to obtain an HpaBC gene fragment; first, the HpaBC gene fragment is recovered, then the recovered HpaBC gene fragment and a pET-28a expression vector are simultaneously subjected to NcoI and XhoI enzyme digestion, and finally, the two enzyme-digested fragments are connected by using T4 DNA ligase to obtain the pET-28a-HpaBC plasmid; The pET-28a-Hped plasmid is subjected to BamH I and Xho I enzyme digestion, and the pET-28a-HpaBC plasmid is simultaneously subjected to Bgl II and Xho I enzyme digestion to obtain an HpaBC fragment containing a T7 promoter, and the HpaBC fragment containing the T7 promoter is connected with the pET-28a-Hped plasmid to obtain the pET-28a-Hped-HpaBC plasmid in a pseudoperon configuration; The pET-28a-Hped-HpaBC plasmid is introduced into E. coli BL21(DE3) competent cells to obtain the recombinant strain S2.
Citation Information
Patent Citations
Recombinant escherichia coli for producing hydroxytyrosol and application thereof
CN112813013A