Peptide-conjugated antisense therapeutic agents that modulate precursor mRNA splicing for treatment of disease

Abstract

The present disclosure generally relates to splicing modulation therapies conjugated with DG9 peptides for the treatment of Duchenne muscular dystrophy and spinal muscular atrophy.

Description

[0001] This application claims priority to U.S. Provisional Application Serial No. 63 / 303,577, filed on January 27, 2022, the entire contents of which are incorporated herein by reference. Technical Field

[0002] The present invention generally relates to peptide-conjugated antisense therapeutics that regulate pre-mRNA splicing for the treatment of diseases, and in particular, peptide-conjugated antisense therapeutics for the treatment of Duchenne muscular dystrophy (DMD) and spinal muscular atrophy (SMA). Background Art

[0003] Antisense therapeutics, which modulate pre-mRNA splicing by inducing exon splicing or inhibiting exon splicing function by binding to pre-mRNA, have been approved for the treatment of various diseases, including Duchenne muscular dystrophy and spinal muscular atrophy.

[0004] Duchenne muscular dystrophy (DMD) is a fatal X-linked recessive disorder caused by mutations in the DMD gene, which results in a lack of dystrophin in the muscle. Dystrophin stabilizes the sarcolemma by forming a membrane-associated glycoprotein complex that bridges the cytoskeletal actin to the extracellular matrix [1,2]. Loss of dystrophin leads to progressive muscle degeneration throughout the body, loss of the ability to walk before the teenage years, cardiopulmonary dysfunction in the twenties, and usually death [3]. DMD affects 19.8 per 100,000 male newborns, making it the most common inherited neuromuscular disorder worldwide [4].

[0005] Most patients (approximately 70%) have large out-of-frame deletions in DMD [5]. Exon skipping-based therapeutics are based on the observation that at least about 90% of the time, in-frame mutations in DMD produce a milder phenotype, as found in Becker muscular dystrophy (BMD) [5, 6]. By using antisense oligonucleotides to exclude out-of-frame exons from DMD transcripts, exon skipping converts out-of-frame mutations to in-frame mutations, resulting in a truncated but partially functional dystrophin protein. Four exon skipping therapeutics have been approved by the U.S. FDA: eteplirsen / Exondys 51 (Sarepta) [7], golodirsen / Vyondys 53 (Sarepta) [8], viltolarsen / Viltepso (NS Pharma) [9], and casimer sen / Amondys45 (Sarepta)

[10] . All are phosphorodiamidate morpholino oligomer (PMO) antisense oligonucleotides.

[0006] However, due to the mutation specificity of DMD, the applicability of single exon skipping is limited. The above therapies can only treat 8-13% of all patients at best

[11] . Multi-exon skipping overcomes this problem, especially skipping exons 45-55. Exons 45-55 are mutation hotspots in the DMD gene, with 66% of patients having large (≥1 exon) deletions and 15% having large duplications (5). In theory, exon 45-55 skipping could treat more than 40% of all DMD patients

[12] .

[0007] Deletions of exons 45–55 are also commonly associated with an asymptomatic to mild phenotype. In the Leiden DMD database, 90% of patients with deletions of exons 45–55 had BMD; in other databases, including UMD-TREAT-NMD and clinical studies, deletions were associated with BMD or asymptomatic individuals in all cases examined [12–15].

[0008] An exon 45-55 skipping cocktail has been developed that restores dystrophin synthesis in dystrophic mouse muscle

[16] . A cocktail of PMOs has been developed that skips human DMD exons 45-55 in immortalized patient myotubes and humanized DMD mice [13, 17]. Average skipping efficiencies observed were 27-61% and 15-22%, respectively, and treatment produced up to 14% of normal dystrophin levels in vitro [13, 17]. However, this cocktail uses one PMO per exon (except for exon 48, which requires two) to skip exons 45-55. Because all PMOs must be present in the same nucleus to induce skipping of exons 45-55, efficacy is reduced and off-target effects are increased.

[0009] The efficacy of PMO-based exon skipping therapies is hampered by their rapid clearance from the blood, poor muscle absorption, and inability to escape from endosomal structures.[19,20] For example, etepirrsen restored only 0.93% of normal dystrophin levels in patients treated with 30 or 50 mg / kg / week for 180 weeks.[7]

[0010] Therefore, improved exon skipping therapies are needed to treat Duchenne muscular dystrophy.

[0011] Spinal muscular atrophy (SMA) is a devastating neurodegenerative disorder that affects the motor neurons in the anterior horn of the spinal cord

[45] . SMA can lead to progressive muscle weakness, respiratory distress, and even paralysis, and is one of the leading genetic causes of infant mortality

[46] . SMA is characterized by a survival mutation in the telomeric motor neuron 1 (SMN1) gene, resulting in its homozygous deletion

[47] . Complete loss of the SMN protein is embryonically lethal [48, 49]. Humans possess a paralog of SMN1, SMN2, which enables the birth of affected individuals [47, 50]. However, SMN2 cannot fully compensate for the loss of SMN1 due to a C to T transition in exon 7, resulting in its exclusion.

[0012] While full-length SMN2 (FL-SMN2) transcripts can produce stable functional proteins (approximately 10%), transcripts without exon 7 (Δ7SMN2) are unstable and the resulting protein is rapidly degraded (approximately 90%)

[51] . Exclusion of SMN2 exon 7 is due to ISS-N1 (intronic splicing silencer N1) binding to the repressor protein hnRNP A1 (heterogeneous nuclear ribonucleoprotein A1) [52-54].

[0013] All SMA patients lack a functional SMN1 gene and are therefore dependent on the SMN2 gene to produce the SMN protein required for survival. Therefore, the copy number of SMN2 is a potent genetic modifier of SMA, with its copy number inversely correlated with the severity of SMA [55,56]. The inability of SMN2 to compensate for the loss of SMN1 accounts for the preferential degeneration of motor neurons [51,57]. Although the pathological hallmark of SMA is motor neuron degeneration, recent studies have highlighted defects in peripheral tissues [58-60]. In addition, in vivo mouse studies have reported bradycardia and dilated cardiomyopathy that improve with restoration of SMN levels [61-63]. Although the reason is unclear, motor neurons are particularly susceptible to loss of SMN

[64] .

[0014] Currently, three SMA-modifying therapies have been approved by the US Food and Drug Administration (FDA): nusinersen (trade name Spinraza), onasemnogene abeparvovec (trade name Zolgensma), and risdiplam (trade name Evrysdi). However, there are several issues associated with these three drugs. Onasemnogene abeparvovec is a gene therapy drug that is only approved for use in patients under 2 years of age

[65] . Risdiplam is an oral small molecule drug. However, there are safety concerns due to its related off-target effects on pre-mRNA splicing

[66] .

[0015] Nusinersen is a splice-switching antisense oligonucleotide (AO) with 2'-O-methoxyethyl (MOE) phosphorothioate chemistry. It modulates SMN2 splicing by targeting ISS-N1 and promoting inclusion of exon 7. Because nusinersen cannot cross the blood-brain barrier (BBB), repeated intrathecal administration is required to ensure robust restoration of SMN protein primarily to central nervous system (CNS) tissues

[67] . Despite the safety profile, nearly one-third of treated patients developed scoliosis, persistent lumbar leaks, thrombocytopenia, and other coagulation defects [68,69].

[0016] To overcome the problems associated with intrathecal administration, several AO chemistries and modifications have been investigated, such as phosphorodiamidate morpholino oligomers (PMOs), locked nucleic acids (LNAs), and constrained ethyl groups (c-Et)

[70] . The uncharged backbone, low protein binding affinity, and nuclease stability make PMO chemistries ideal candidates, as multiple studies have shown that multiple high-dose administrations can be achieved with minimal toxicity [70,71]. However, the major drawback associated with PMOs is low efficacy, which is related to their rapid clearance from the blood, poor uptake in tissues such as skeletal muscle, and endosomal capture [72,73]. To improve the delivery of PMOs to the nucleus in target tissues and reduce the administered dose, a number of cell-penetrating peptide (CPP)-conjugated PMOs are being investigated. Some of these peptides facilitate PMOs to cross the BBB, thereby ensuring the possibility of non-invasive administration to treat neuronal disorders

[74] . Hammond et al. showed that systemic administration of the peptide Pip6a from the PMO internalization peptide (Pip) family to adult mice increased the expression of FL-SMN2 in peripheral and CNS tissues

[71] . However, the localization and distribution of AO in the CNS remain unknown. In addition, Pip peptides are known to be highly toxic

[74] .

[0017] Therefore, improved splicing regulatory therapies are needed to treat SMA. Summary of the invention

[0018] The present invention provides peptide-conjugated antisense therapeutics that regulate pre-mRNA splicing for the treatment of diseases.

[0019] In one aspect of the present invention, a conjugate is provided, comprising an antisense oligonucleotide capable of regulating exon splicing of pre-mRNA attached to a cell penetrating peptide (CPP), the cell penetrating peptide comprising the following amino acid sequence:

[0020] YArVRRrGPRGYArVRRrGPRr;

[0021] Uppercase: L-amino acid, lowercase: D-amino acid.

[0022] In another aspect of the present invention, a conjugate is provided, comprising an antisense oligonucleotide capable of inducing exon skipping in human dystrophin covalently attached to a cell penetrating peptide (CPP), the cell penetrating peptide comprising the following amino acid sequence:

[0023] YArVRRrGPRGYArVRRrGPRr;

[0024] Uppercase: L-amino acid, lowercase: D-amino acid.

[0025] In some embodiments, the conjugate capable of inducing exon skipping in human dystrophin has an antisense oligonucleotide that binds to a target in exon 44, exon 45, exon 46, exon 47, exon 48, exon 49, exon 50, exon 51, exon 52, exon 53, exon 54 and / or exon 55 of human dystrophin pre-mRNA.

[0026] In some embodiments, the conjugate capable of inducing exon skipping in human dystrophin has an antisense oligonucleotide comprising or consisting of any of the following oligonucleotides:

[0027] 5′-AAAACGCCGCCATTTCTCAACAGATCTGTC-3′,

[0028] 5′-GACAACAGTTTGCCGCTGCCCAAATGCCATC-3′,

[0029] 5′-AGTTGCTGCTCTTTTCCAGGTTCAAGTGGG-3′,

[0030] 5′-GTTTGAGAATTCCCTGGCCGCAGGGGCAACT-3′,

[0031] 5′-CAATTTCTCCTTGTTTCTCAGGTAAAGCTC-3′,

[0032] 5′-CAGATGATTTAACTGCTCTTCAAGGTCTTC-3′,

[0033] 5′-ATCTCTTCCACATCCGGTTGTTTAGCTTGA-3′,

[0034] 5′-GTAAACGGTTTACCGCCTTCCACTCAGAGC-3′,

[0035] 5′-GTGTCACCAGAGTAACAGTCTGAGTAGGAG-3′,

[0036] 5′-GGTAATGAGTTCTCCAACTGGGGACGCCT-3′,

[0037] 5′-CCTCCGGGTTCTGAAGGTGTTCTTGTACTTC-3′,

[0038] 5′-GAGAAGTTTCAGGGCCAAGTCATTTGCCAC-3′ and

[0039] 5′-TCTTCCAAAGCAGCCTCTCGCTCACTCACC-3′.

[0040] According to another aspect of the present invention, there is provided a composition comprising a first conjugate comprising a first antisense oligonucleotide capable of inducing exon skipping in human dystrophin covalently attached to a cell penetrating peptide (CPP), wherein the cell penetrating peptide comprises the following amino acid sequence:

[0041] YArVRRrGPRGYArVRRrGPRr;

[0042] Upper case: L-amino acid, lower case: D-amino acid, and a second conjugate comprising a second antisense oligonucleotide capable of inducing exon skipping in human dystrophin covalently attached to a cell penetrating peptide (CPP).

[0043] In some embodiments, the composition further comprises at least one additional conjugate comprising another antisense oligonucleotide capable of inducing exon skipping in human dystrophin covalently attached to a cell penetrating peptide (CPP).

[0044] In some embodiments, the composition capable of inducing multi-exon skipping in human dystrophin comprises a peptide-conjugated antisense oligonucleotide targeting exon 45, a peptide-conjugated antisense oligonucleotide targeting exon 46, a peptide-conjugated antisense oligonucleotide targeting exon 47, a peptide-conjugated antisense oligonucleotide targeting exon 48, a peptide-conjugated antisense oligonucleotide targeting exon 49, a peptide-conjugated antisense oligonucleotide targeting exon 50, a peptide-conjugated antisense oligonucleotide targeting exon 51, a peptide-conjugated antisense oligonucleotide targeting exon 52, a peptide-conjugated antisense oligonucleotide targeting exon 53, a peptide-conjugated antisense oligonucleotide targeting exon 54, and a peptide-conjugated antisense oligonucleotide targeting exon 55.

[0045] In some embodiments, the composition capable of inducing multi-exon skipping in human dystrophin comprises a peptide-conjugated antisense oligonucleotide targeting exon 45, a peptide-conjugated antisense oligonucleotide targeting exon 47, a peptide-conjugated antisense oligonucleotide targeting exon 49, a peptide-conjugated antisense oligonucleotide targeting exon 51, a peptide-conjugated antisense oligonucleotide targeting exon 53, and a peptide-conjugated antisense oligonucleotide targeting exon 55.

[0046] In some embodiments, the composition capable of inducing multi-exon skipping in human dystrophin comprises a peptide-conjugated antisense oligonucleotide targeting exon 45, a peptide-conjugated antisense oligonucleotide targeting exon 47, and a peptide-conjugated antisense oligonucleotide targeting exon 53.

[0047] According to one aspect of the present invention, there is provided a method of treating a subject suffering from DMD, comprising administering a therapeutically effective amount of one or more peptide conjugates of the present invention capable of inducing exon skipping in human dystrophin.

[0048] According to another aspect of the present invention, there is provided a conjugate comprising an antisense oligonucleotide capable of inducing exon inclusion in the human SMN2 gene covalently attached to a cell penetrating peptide (CPP), the cell penetrating peptide comprising the following amino acid sequence:

[0049] YArVRRrGPRGYArVRRrGPRr;

[0050] Uppercase: L-amino acid, lowercase: D-amino acid.

[0051] In some embodiments, a conjugate comprising an antisense oligonucleotide capable of inducing exon inclusion in the human SMN2 gene binds to the intronic splicing silencer N1 of the SMN2 pre-mRNA.

[0052] In some embodiments, the conjugate comprising an antisense oligonucleotide capable of inducing exon inclusion in the human SMN2 gene comprises an antisense oligonucleotide comprising or consisting of the sequence 5′-TCACTTTCATAATGCTGG-3′, and wherein thymine is optionally replaced by uracil, optionally wherein the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer.

[0053] According to another aspect of the present invention, there is provided a method for treating spinal muscular atrophy (SMA) in a subject, comprising administering a therapeutically effective amount of a conjugate of the present invention comprising an antisense oligonucleotide capable of inducing exon inclusion in a human SMN2 gene.

[0054] According to another aspect of the present invention, there is provided a pharmaceutical composition comprising one or more peptide conjugates of the present invention and a pharmaceutically acceptable excipient. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Embodiments of the present invention will now be described, by way of example only, with reference to the accompanying drawings.

[0056] Figure 1 Shown is testing of a minimized exon 45-55 skipping mix in immortalized patient myotubes. (A) DMD exons targeted by the "full" mix and its derivatives are indicated by circles. (B) Culture scheme for PMO transfection in immortalized patient myotubes. (C) RT-PCR exon 45-55 skipping efficiency results after transfection of the PMO mix in KM155, KM571, 6594, and 6311 myotubes. Black (upper) arrows indicate native / unskipped bands, and blue (lower) arrows indicate exon 45-55 skipped bands. GAPDH is shown below as a control. Quantification is shown at the bottom. (D) Western blotting of dystrophin in PMO-treated and untreated (NT) KM571 myotubes using various antibodies (ab15277, DYS1, MANEX45A, MANEX4850E). Protein extracts were loaded at 40 μg for treated and NT samples and at the indicated percentages for wild-type KM155 samples (WT). Desmin was detected as a loading control. (E) Quantification of DYS1 signal relative to 12.5% ​​WT band intensity in (D). (n=3 for CE) Error: SEM *p<0.05, **p<0.005, ***p<0.001 One-way ANOVA and Dunnett's test, compared to mock, One-way ANOVA and Dunnett's test, compared with "full".

[0057] Figure 2Single-dose exon 51 skipping treatment with DG9-PMO is shown. (A) Male 3-month-old hDMDdel52;mdx mice were given a single retro-orbital injection of (1×ro) saline, 50 mg / kg PMO, or equimolar 64 mg / kg DG9-PMO for exon 51 skipping. Tissues were collected one week later. (B) RT-PCR exon 51 skipping efficiency results after treatment in various muscles, with quantification on the right. Gapdh is shown as a control. (C) Western blot of dystrophin (DYS1) with wild-type (WT) as reference. Protein extracts were loaded at 40 μg for saline-injected and treated muscles and at the indicated percentages for WT tibia anterior samples. Desmin and myosin heavy chain (MyHC) were used as loading controls. Quantification of dystrophin signal is shown relative to 5% WT band intensity. (D) Representative immunofluorescence images of dystrophin (DYS1, green) and nuclei (DAPI, blue) in various muscles and treatment conditions. Scale bar: 100 μm. (n=3 / group for BD) Error: SEM. *p<0.05, **p<0.005, ***p<0.001 one-way ANOVA and Tukey's test. TA / T, tibialis anterior; GAS / G, gastrocnemius; QUA / Q, quadriceps femoris; DIA / D, diaphragm; HRT / H, heart.

[0058] Figure 3Repeated dose exon 51 skipping treatment using DG9-PMO is shown. (A) Male 2-month-old hDMDdel52;mdx mice were injected retro-orbitally three times weekly with (3×ro) saline or 30 mg / kg DG9-PMO for exon 51 skipping. Purple arrows indicate functional tests. Tissues were collected 2 weeks later. (B) RT-PCR exon 51 skipping efficiency results after treatment in various muscles, with quantitative results on the right. Gapdh is shown as a control. (C) Western blot of dystrophin (DYS1) in various skeletal muscles or (D) heart, with the corresponding wild-type (WT) samples as reference. For saline-injected and treated muscles, the protein extracts were loaded at 40 μg, and for WT, at the indicated percentages. Desmin and myosin heavy chain (MyHC) were used as loading controls. Quantification of dystrophin signals is shown relative to 5% WT band intensity. (For BD, n=3 / group) Error: SEM. *p<0.05, ***p<0.001 for (B) to (D) unpaired two-tailed t-test. (E) Representative immunofluorescence images of dystrophin (DYS1, green) and nuclei (DAPI, blue) in various muscles and conditions. Scale bar: 100 μm. (n=3 / group) (F) Body weight of saline and DG9-PMO treated mice throughout the experiment. (G) Forelimb grip strength of saline and DG9-PMO treated mice, normalized to body weight. % change from baseline is on the right. (H) Similar to (G), but for whole-limb grip strength. (For FH, n=11-14, WT; n=4, saline; n=6, DG9-PMO) Error: SEM. *p<0.05, **p<0.005 for (G) to (H) one-way ANOVA and Tukey test. TA / T, tibialis anterior; QUA / Q, quadriceps femoris; DIA / D, diaphragm; HRT / H, heart.

[0059] Figure 4Local treatment with a minimized "block" DG9-PMO exon 45-55 skipping mix is ​​shown. (A) Male 5-6 month old hDMDdel52;mdx mice were injected with 5 μg / DG9-PMO of the DG9-conjugated "block" mix (total dose 25 μg) in the right tibia anterior (R) and saline in the left tibia anterior (L). Tissues were collected one week later. (B) RT-PCR exon 45-55 skipping efficiency results after treatment, with quantitative results on the right. Gapdh is shown as a control. (C) Western blot of dystrophin (DYS1) using wild-type (WT) and untreated (NT) tibia anterior samples as reference. Protein extracts were loaded at 40 μg for NT, saline, and DG9-PMO treated muscles and at the indicated percentages for WT. Desmin and myosin heavy chain (MyHC) were used as loading controls. Quantification of dystrophin signal is shown relative to 1% WT band intensity. (D) Representative immunofluorescence images of dystrophin (DYS1, green) and nuclei (DAPI, blue). Scale bar: 100 μm. (n=3, wild type; n=6, saline; n=6, DG9-PMO) Error: SEM. *p<0.05, ***p<0.001 unpaired two-tailed t-test.

[0060] Figure 5 Detailed description of preliminary testing of a minimized exon 45-55 skipping mix. Minimized derivatives of the "full" exon 45-55 skipping PMO mix were generated and tested in immortalized myotubes. (A) Minimization strategy #1 involved two rounds of sequential removal of individual PMOs from the "full" mix. (B) Strategy #2 involved preparation of a "full" mix derivative based on endogenous splicing of the exon 45-55 region in humans. RT-PCR exon 45-55 skipping efficiency results are shown in (A) and (B). (n=3) Error bars: SEM. *p<0.05, **p<0.005, ***p<0.001 one-way ANOVA and Dunnett's test, compared to mock, One-way ANOVA and Dunnett's test, compared with “all”. NT, no treatment.

[0061] Figure 6Histological data for exon 51 skipping treatment with a single dose of DG9-PMO are shown. Male 3-month-old hDMDdel52;mdx mice were injected retro-orbitally once with saline, 50 mg / kg PMO, or an equimolar 64 mg / kg DG9-PMO for exon 51 skipping. Tissues were collected 1 week later for evaluation, sectioned, and stained with hematoxylin and eosin (HE). (A) Representative HE images of the tibia anterior and diaphragm of wild-type, saline, PMO, and DG9-PMO treated mice. Scale bar: 100 μm (B) Quantification of central nucleated fibers (CNFs) in HE images. Error bars: SEM. Quantification of minimum Feret diameter in HE images of (C) tibia anterior and (D) diaphragm. Frequency distributions are shown on the left and quantification of individual fibers is shown on the right. Box edges, 25th and 75th percentiles; center line, median; whiskers, range. (For AD, n=3 / group, 719-854 fibers were counted in the tibia anterior and 962-1,479 fibers were counted in the diaphragm per group) **p<0.005, ***p<0.001 one-way ANOVA and Tukey test.

[0062] Figure 7 Functional and histological data of repeated dose exon 51 skipping treatment with DG9-PMO are shown. Male 2-month-old hDMDdel52;mdx mice were retro-orbitally injected with saline or 30 mg / kg DG9-PMO for exon 51 skipping three times, once a week for 3 weeks. Functional tests were performed at baseline and 2 weeks after the last injection. (A) Results of the rotarod test show the mean and peak time to fall, and their respective % change values ​​from baseline. (B) Results of the running to exhaustion test show the total distance traveled on the treadmill, with % change from baseline on the right. (Wild type, n = 8-11; saline, n = 2; DG9-PMO, n = 6) Error bars: SEM *p < 0.05, unpaired two-tailed t-test. (C) Tissues were collected after treatment functional testing and stained with hematoxylin and eosin (HE). Representative HE images of the tibia anterior and diaphragm of wild-type, saline, and DG9-PMO treated mice are shown. Scale bar: 100 μm. (D) Quantification of central nucleated fibers (CNFs) in HE images. Error bars, SIM. (E) Quantification of minimum Feret diameter of the tibia anterior and (F) diaphragm, as shown in Figure 6 (For CF, n = 3 / group, 610-865 fibers were counted in the tibia anterior and 1,167-1,412 fibers were counted in the diaphragm per group) **p<0.005, ***p<0.001 one-way ANOVA and Tukey test.

[0063] Figure 8Liver and kidney histology from single-dose and repeat-dose exon 51 skipping treatment studies are shown. Representative hematoxylin and eosin-stained images of wild-type and hDMDdel52;mdx livers and kidneys from (A) single-dose and (B) repeat-dose experiments are shown. Scale bar: 100 μm. (n=3 / group)

[0064] Fig. 9 Subcutaneous administration of DG9-PMO on postnatal day 0 prolonged the survival of severe SMA mice and improved motor function. (A) Survival curves of heterozygous mice (Het), untreated (NT), unconjugated PMO (PMO), DG9-PMO, and MOE injected at 40 or 80 mg / kg on PD0. For the 40 mg / kg study, n=15 (Het), n=22 (NT), n=49 (unconjugated PMO), n=14 (DG9-PMO), n=29 (MOE). For the 80 mg / kg study, n=15 (Het), n=22 (NT), n=7 (unconjugated PMO), n=6 (DG9-PMO), n=4 (MOE) (p≤0.0001, log-rank Mantel Cox test). (B) Body weight of mice dosed with 40 or 80 mg / kg on PD7. Each dot (symbol) represents a newborn pup. (C) Hindlimb hanging assay (HLS). Mice were treated with 40 mg / kg AO on PD0. Scoring was based on the position of the hindlimbs while hanging on the falcon tube. (D) Righting reflex test. Mice were treated with 40 mg / kg AO on PD0. The ability of mice to right themselves with their paws was measured every other day between PD2 and PD20 (left). The mean righting reflex time at PD6 and PD8 is also shown (right: box-whisker plots). Box edges, 25th and 75th percentiles; center line, median; whiskers, range. (E) Forelimb grip strength of adult mice in the 40 mg / kg treatment group measured at PD30 and PD60, normalized to body weight. In B, D (box-whisker plots), and E, one-way ANOVA followed by post hoc Tukey test was performed. *p<0.05, **p<0.01, ***p<0.005. In C and D, two-way ANOVA followed by Sidak's multiple comparisons as in A and B. *p<0.03; **p<0.002; ***p<0.0002. *NT, #PMO, @DG9-PMO, & MOE. Error bars: SEM

[0065] Fig.10Subcutaneous administration of DG9-PMO at postnatal day 0 increases SMN expression. (A) Relative expression levels of full-length SMN2 (FL-SMN2) and deleted SMN2 transcripts (Δ7SMN2) measured by qPCR. (B) Representative images of western blots and quantification of SMN protein levels relative to β-tubulin. Heterozygous mice were used as controls and relative SMN expression was set to 1. 40 mg / kg AO was injected at PD 0. Tissues were collected at PD7. One-way ANOVA was performed, followed by post hoc Tukey's test. *NT, #PMO, @DG9-PMO, & MOE. *p<0.05, **p<0.01, ***p<0.005. Error bars, SEM.

[0066] Fig.11 DG9-PMO treatment improves respiratory function in SMA mice at postnatal day 7. (A) Representative traces of whole-body plethysmograph recordings of P7 pups under normoxia (left column) and hypoxia (11% O2, right column) (n=6 each). (B) Respiratory frequency fR. (C) Tidal volume (VT) under normoxia relative to the mean of heterozygotes (100%). (D) Minute ventilation (VE) under normoxia relative to the mean of heterozygotes (100%). (E) Coefficient of variation (CV) of frequency. (F) Total apnea duration (seconds in one minute). For those data that passed the normality test (Shapiro-Wilk) and the test of equal variance (Brown-Forsythe) (fR, VT, VE, and CV in BE), parametric statistics and two-way repeated analysis of variance followed by the Holm-Sidak method were used. Data did not pass the normality test and nonparametric statistics were used. (G) Correlation between respiratory frequency and body weight. Respiratory rate was plotted against body weight in heterozygotes (n=10) with a correlation coefficient of 0.303 (p=0.394). The correlation coefficient for homozygotes (n=43) was 0.791 (p<0.001). 40 mg / kg AO was injected on PD 0. Comparisons of differences in normoxia or hypoxia were performed using Kruskal-Wallis one-way ANOVA on ranks followed by Dunn's method. Differences between hypoxia and normoxia were performed using the signed rank test. p<0.05 was considered statistically significant; p<0.05, p<0.01, p<0.001 compared with the indicated groups (*NT, #PMO, @DG9-PMO, & MOE); $<0.05, $$<0.01, $$$<0.001 compared with normoxia.

[0067] Fig.12It is shown that systemic administration of DG9-PMO improves muscle pathology in SMA mice. (A) Representative images of H&E staining of quadriceps (top row), diaphragm (middle row), and intercostal muscles (bottom row) in heterozygous, NT control, and treated groups at PD7. Scale bar: 100 μm. (B) Frequency distribution (top) and quantification (bottom) of the minimum Feret diameter (μm) of individual muscle fibers. Box edges, 25th and 75th percentiles; center line, median; whiskers, range (n=3-7 per group). 1292-1653 fibers were measured in the quadriceps, 917-1746 fibers in the diaphragm, and 642-1127 fibers in the intercostal muscles. (C) Centrally nucleated fibers (%) quantified from H&E images. 40 mg / kg AO was injected at PD 0. Statistics were performed using one-way ANOVA, followed by post hoc Tukey test. *NT, #PM, @DG9-PMO, & MOE. *p<0.05, **p<0.01, ***p<0.005. Error bars, SEM.

[0068] Fig.13 DG9-PMO treatment results in improvements in neuromuscular junctions (NMJs) are shown. (A) Representative confocal images of neuromuscular junction (NMJ) staining in quadriceps and intercostal muscles collected at PD30. Scale bar: 100 μm. Postsynaptic endplates are stained with α-bungarotoxin (red, α-BTX), while neurofilaments (2H3) and synaptic vesicles (SV2) indicate neurons (green). Denervated endplates can be identified as a-BTX endplates without overlapping synaptophysin-stained axons, while partially denervated endplates are identified as endplates with <50% occupancy of presynaptic nerve terminals. White arrows: complete innervation. Yellow arrows: partial innervation. Blue arrows: denervation. White arrows: collapsed NMJs. (B) Innervation characteristics: Fully innervated, partially innervated, denervated, collapsed NMJs were quantified from at least 300-500 NMJs per group (n=3-7) and plotted as a percentage of the total NMJs analyzed. (C) The number of collapsed vesicles (flat, non-pretzel shaped) was quantified (n=4-6 per group). In (B), two-way ANOVA followed by Sidak's multiple comparisons was used. *p<0.03; **p<0.002; ***p<0.0002. In c, one-way ANOVA was used for statistics followed by post hoc Tukey's test. #PMO, @DG9-PMO, & MOE. *p<0.05, **p<0.01, ***p<0.005. Error bars: sEM. 40mg / kg AO was injected at PD 0.

[0069] Fig.14DG9 increases the uptake of PMO in target tissues after subcutaneous administration at PD0. (A) PMO concentrations (pM) were detected by ELISA using an avidin-biotin affinity system and compared between DG9-PMO and unconjugated-PMO treatments at a dose of 4 0 mg / kg in quadriceps, liver, heart, kidney, brain, and spinal cord (n=3-7 per group). *p<0.05, **p<0.01, ***p<0.001 unpaired two-tailed Student's t-test. Error bars, SEM. (B) Representative immunohistochemical images of PD7 heart, quadriceps, brain, and spinal cord after subcutaneous injection of fluorescently labeled DG9-PMO at PD0. Green: Fluorescein-DG9-PMO. Magenta: DAPI. DG9-PMO without a fluorescent label was used as a negative control. White arrows indicate that DG9-PMO overlaps with the nucleus (DAPI). n=3. Scale bar: 50 μm.

[0070] Fig.15 DG9-PMO crosses the blood-brain barrier and increases FL-SMN2 expression in a mild SMA model. (A) F0 mice (Smn - / - SMN2 + / + ) Representative immunohistochemistry images of quadriceps, heart, brain, and spinal cord at PD7 after subcutaneous administration of fluorescently labeled DG9-PMO (green) at PD5. Magenta: DAPI. n=3 per group. White arrows indicate overlap of DG9-PMO with nuclei (DAPI). Scale bar: 50 μm. (B) PMO concentration (pM) at PD7 was detected by ELISA using an avidin-biotin affinity system and compared between DG9-PMO and unconjugated-PMO treatments injected at 40 mg / kg at PD5 in a milder SMA model (n=3-6 per group). Statistics were performed using an unpaired two-tailed Student's t-test. *p<0.05, **p<0.01, ***p<0.001 (C) Relative expression levels of full-length SMN2 (FL-SMN2) and deleted SMN2 transcripts (Δ7SMN2) in quadriceps, liver, heart, spleen, brain, and spinal cord. Saline, unconjugated PMO, and DG9-PMO were injected subcutaneously into PD5 mice (n=3-6 per group). Tissues were collected at PD7. In c, one-way ANOVA followed by post hoc Tukey test was performed. *p<0.05, **p<0.01, ***p<0.005. Error bars, SEM.

[0071] Fig.16DG9-PMO treatment was shown to induce SMN expression in a dose-dependent manner in SMA mice. (A) Relative expression levels of full-length SMN2 (FL-SMN2) and deleted SMN2 transcripts (Δ7SMN2) in quadriceps, liver, heart, brain, and spinal cord of NT and treated mice measured by qPCR after 80 mg / kg AO treatment. (B) Representative images of western blots and quantification of SMN protein levels relative to β-tubulin. Heterozygous mice were used as controls and relative SMN expression was set to 1. Tissues from 80 mg / kg treated mice were collected at PD7. In AB, one-way ANOVA was performed, followed by post hoc Tukey test. *NT, #PMO, @DG9-PMO, & MOE. *p<0.05, **p<0.01, ***p<0.005. Error bars, SEM.

[0072] Fig.17 DG9-PMO maintains SMN levels in SMA mice at postnatal day 30. Representative images of western blots and quantification of SMN levels. Tissues were collected from the 40 mg / kg group at PD30 relative to β-tubulin. Heterozygous mice were used as controls and relative SMN expression was set to 1. Statistics were performed using one-way ANOVA followed by post hoc Tukey's test. #PMO, @DG9-PMO, & MOE. *p<0.05, **p<0.01, ***p<0.005. Error bars, SEM.

[0073] Fig.18 Muscle strength and motor function tests of adult SMA mice treated with DG9-PMO are shown. (A) Forelimb grip strength of adult males and females was measured at PD30. 40 mg / kg AO was injected at PD0. (B) Forelimb grip strength normalized to body weight. Measured at PD30 and PD60. 80 mg / kg AO was injected at PD0. (C) Rotarod test with acceleration curve. Measured at PD 30-35. Each mouse received three trials, 20 minutes apart. The maximum time on the beam was recorded. 40 mg / kg AO was injected at PD0. One-way ANOVA was performed, followed by a post hoc Tukey test. *NT, #PMO, @DG9-PMO, & MOE. *p<0.05, **p<0.01, ***p<0.005. Error bars, SEM.

[0074] Figure 19 shows that DG9-PMO improves muscle pathology in SMA mice at postnatal day 7. The cross-sectional area (CSA) (μm) of the quadriceps, diaphragm, and intercostal muscles harvested at PD7 2) and quantification of individual muscle fibers. Box edges, 25th and 75th percentiles; center line, median; whiskers, range (n=3-7 per group), approximately 1292-1653 fibers in quadriceps, 917-1746 fibers in diaphragm, and 642-1127 fibers in intercostal muscles. Statistics were performed using one-way ANOVA followed by post hoc Tukey's test. *NT, #PM, @DG9-PMO, & MOE. *p<0.05, **p<0.01, ***p<0.005. Error bars, SEM.

[0075] Figure 20 shows muscle pathology of DG9-PMO treated mice at postnatal day 30. (A) Representative images of H&E staining of quadriceps (top row), diaphragm (middle row), and intercostal muscles (bottom row) in heterozygous, NT control, and treated groups at PD30. 40 mg / kg AO was injected at PD0. Scale bar: 100 μm. (B) Frequency distribution of minimum Feret diameter (μm) in tissues collected at PD30 and quantification of individual muscle fibers are shown below. (C) Cross-sectional area (CSA) (μm 2 ) and quantification of individual myofibers are shown below. Box edges, 25th and 75th percentiles; center line, median; whiskers, range (n=3-6 per group), approximately 960-1868 fibers in quadriceps, 983-1436 fibers in diaphragm, and 800-1802 fibers in intercostal muscles. 40 mg / kg AO was injected on PD0. Statistics were performed using one-way ANOVA followed by post hoc Tukey test. #PMO, @DG9-PMO, & MOE. *p<0.05, **p<0.01, ***p<0.005. Error bars, SEM.

[0076] Fig.21 It shows that DG9-PMO treatment does not cause significant immune response and toxicity. (A) CD68 in quadriceps muscle at PD7 + Representative images of macrophages (green) and DAPI (blue) immunostaining. (B) Average CD68 per section +Cell number. 3-5 sections from the quadriceps muscle of each mouse were used for analysis. (n=3-5 per group). Scale bar: 100 μm. (C) Analysis of ALP, ALT, AST, total bilirubin, GGT, BUN, creatinine, CK, total protein, albumin and globulin in serum. Serum was collected at PD30. (n=2-7 per group). (D) Representative images of H and E staining of liver (top row) and kidney (bottom row) at PD30. No obvious morphological differences were observed between healthy heterozygous control and treatment groups. Scale bar: 100 μm. 40 mg / kg AO was injected at PD0. One-way ANOVA was performed, followed by post hoc Tukey test. *NT, #PM, @DG9-PMO, & MOE. *p<0.05, **p<0.01, ***p<0.005. Error bars, SEM.

[0077] Fig. 22 DG9 PMOs are shown to induce cardiac-specific exon skipping in a transgenic zebrafish model. (A) Transgenic zebrafish lines were generated using the Tol2 transposon system by flanking the dual fluorescent protein switch with the Tol2 inverted terminal repeats (ITRs). Ubiquitous mRNA is generated using the carp β-actin promoter, noncoding exons, and mini-intron 1 (β-act). The mRNA will be generated from two exons. The first exon contains the complete blue fluorescent protein (BFP) open reading frame, including the stop codon. The second exon includes the red fluorescent protein (RFP) open reading frame with its stop codon, polyadenylation signal, and transcription terminator. This bicistronic mRNA will normally only produce functional BFP. However, in the presence of a PMO targeting the BFP splice acceptor (derived from exon 2 of the carp β-actin gene), the BFP exon will be skipped and a shorter mRNA will be generated. RFP can be translated from this shorter mRNA. A switch from BFP expression to RFP would correspond to PMO activity in the nucleus and indicate successful delivery into the cell. B. qPCR data showing detection of RFP transcripts collected from the DG9PPMO-treated zebrafish group (15 months old, approximately 8 fish per group, injected with 1 dose of 25mg / Kg PPMO via the intravenous route). ΔCT plot of RFP transcripts: Of all the organs tested, the heart was the only organ where RFP could be detected. C. Gel electrophoresis of qPCR products was performed to visualize RFP transcripts. The approximately 100bp band detected in the heart was sequenced, and the results were consistent with the desired product.

[0078] Fig.23DG9-PMO treatment of SMA mice showed improved efficacy compared to R6-PMO. (A) Survival curves of heterozygous mice (Het), untreated (NT), unconjugated PMO (PMO), DG9-PMO, MOE, and R6G-PMO injected at a dose of 40 mg / kg on PD0. n=15 (Hets), n=22 (NT), n=49 (unconjugated PMO), n=14 (DG9-PMO), n=29 (MOE), and n=6 (R6G-PMO), (p≤0.0001, log-rank Mantel Cox test). (B) Representative images of heterozygous mice, mice treated with 80 mg / kg or 40 mg / kg DG9-PMO, mice injected with unconjugated PMO (40 mg / kg), and saline-treated NT mice at PD7 (from left to right). (C) Body weight of mice dosed with 40 or 80 mg / kg at PD7. Each point (symbol) represents one newborn pup. (D) Hindlimb hanging assay (HLS). Mice were treated with 40 mg / kg AO at PD0. Scoring was based on the position of the hindlimbs while hanging on a falcon tube. (E) Righting reflex test. Mice were treated with 40 mg / kg AO at PD0. The ability of mice to right themselves with their paws was measured every other day between PD2 and PD20 (left). The mean righting reflex time at PD6 and PD8 is also shown (right: box and whisker plots). Box edges, 25th and 75th percentiles; center line, median; whiskers, range. (F) Relative expression levels of full-length SMN2 (FL-SMN2) compared with the deleted SMN2 transcript (Δ7SMN2) measured by qPCR after treatment with 40 mg / kg ASO or PBS. In C, E (box and whisker plots), and F, one-way ANOVA followed by post hoc Tukey test was performed. *p<0.05, **p<0.01, ***p<0.005. In D and E, two-way ANOVA followed by Sidak's multiple comparisons *p<0.03; **p<0.002; ***p<0.0002. *NT, #PMO, @DG9-PMO, &MOE, ^R6-PMO. Error bars: SEM DETAILED DESCRIPTION

[0079] The present invention provides a therapeutic agent for regulating pre-mRNA splicing, which is optionally suitable for systemic delivery. The therapeutic agent comprises an antisense oligonucleotide conjugated to a cell penetrating peptide derived from the protein transduction domain (PTD) of human Hph-1 transcription factor.

[0080] The therapeutic agent is intended to promote exon skipping or exon inclusion. The therapeutic agent includes a peptide-conjugated antisense therapeutic agent for treating Duchenne muscular dystrophy (DMD) and spinal muscular atrophy (SMA).

[0081] DMD therapeutic agents promote exon skipping. Optionally, this therapeutic agent comprises more than one conjugate and is configured to promote multi-exon skipping. Optionally, the therapeutic agent comprises two, three, four, five, six, seven or more different conjugates, wherein each conjugate comprises an antisense oligonucleotide conjugated to a cell penetrating peptide derived from a protein transduction domain (PTD) of a human Hph-1 transcription factor. In some embodiments, each different conjugate targets a different exon. In some embodiments, different conjugates target the same exon.

[0082] SMA therapeutics promote exon inclusion.

[0083] Conjugate:

[0084] The conjugates of the present invention comprise an antisense oligonucleotide capable of regulating exon splicing of pre-mRNA attached to a cell penetrating peptide (CPP). The cell penetrating peptide of the present invention, also known as DG9, promotes the delivery of the conjugated antisense oligonucleotide and has higher activity than the R6G cell penetrating peptide. In some embodiments, the conjugates of the present invention are used for intravenous delivery.

[0085] The cell penetrating peptide of the present invention is derived from the protein transduction domain of human HPH-1 transcription factor and comprises the following amino acid sequence:

[0086] YARVRRRGPRGYARVRRRGPRR.

[0087] Optionally, in some embodiments, one or both amino groups are deleted or substituted. Optionally, the amino acid is substituted with a non-naturally occurring amino acid.

[0088] In some embodiments, to increase serum stability, one or more L-amino acids are replaced by D-amino acids. In some embodiments, two, three, four, five or six L-amino acids are replaced by D-amino acids. Optionally, two, three, four, five or six L-arginines are replaced by D-arginine.

[0089] In some embodiments, the cell penetrating peptide (CPP) has the following amino acid sequence:

[0090] YArVRRrGPRGYArVRRrGPRr;

[0091] Capital letters represent L-amino acids, and lowercase letters represent D-amino acids.

[0092] In some embodiments, the CPP is conjugated to the 5' end of the oligonucleotide. In other embodiments, the CPP is conjugated to the 3' end of the oligonucleotide.

[0093] As used interchangeably herein, "antisense oligonucleotide," "antisense therapeutic," "AO," "oligonucleotide," "oligomer" refers to a sequence of subunits, each subunit having bases carried on backbone subunits, wherein the backbone groups are connected by intersubunit bonds that allow the bases in the compound to hybridize to a target sequence in a nucleic acid by Watson-Crick base pairing, thereby forming a nucleic acid:oligonucleotide heteroduplex within the target sequence. An oligonucleotide can have exact sequence complementarity to a target sequence or sufficient complementarity to selectively bind to a target sequence.

[0094] Antisense oligonucleotides are about 20 to about 50 nucleotides in length and include at least 10, 12, 15, 17, or 20 contiguous nucleotides that are complementary to the target sequence.

[0095] In one embodiment, the antisense oligonucleotide is 20 to 30 or 24 to 28 nucleotides in length.

[0096] In some embodiments, the antisense oligonucleotide is an antisense oligonucleotide analog.

[0097] The terms "oligonucleotide analog" and "nucleotide analog" refer to any modified synthetic analog of an oligonucleotide or nucleotide, respectively, known in the art.

[0098] Examples of oligonucleotide analogs include, but are not limited to, peptide nucleic acids (PNA), morpholino oligonucleotides, phosphorothioate oligonucleotides, phosphorodithioate oligonucleotides, alkylphosphonate oligonucleotides, acylphosphonate oligonucleotides, phosphoramidite oligonucleotides, tricyclic DNA, and 2' methoxyethyl oligonucleotides.

[0099] In some embodiments, the antisense oligonucleotide comprises a morpholino subunit.

[0100] In some embodiments, the antisense oligonucleotide is a morpholino antisense oligonucleotide.

[0101] In some embodiments, the antisense oligonucleotide comprises morpholino subunits linked together by phosphorus-containing linkages. In a specific example, the antisense oligonucleotide is a phosphoramidite or phosphorodiamidate morpholino antisense oligonucleotide.

[0102] The term "morpholino antisense oligonucleotide" or "PMO" (phosphoramide or phosphorodiamidate morpholino oligonucleotide) refers to an antisense oligonucleotide analog composed of a morpholino subunit structure, wherein (i) the structure is linked together by a phosphorus-containing linkage, e.g., one to three atoms in length, e.g., two atoms in length, and e.g., uncharged or cationic, linking the morpholino nitrogen of one subunit to the 5' exocyclic carbon of the adjacent subunit, and (ii) each morpholino ring bears a purine or pyrimidine base pairing moiety that effectively binds to a base in a polynucleotide through base-specific hydrogen bonding.

[0103] In some embodiments, the antisense oligonucleotide comprises a phosphorus-containing intersubunit linkage linking the morpholino nitrogen of one subunit to the 5' exocyclic carbon of the adjacent subunit.

[0104] Optionally, changes may be made to the intersubunit linkages, provided that these changes do not interfere with binding or activity. For example, the oxygen attached to the phosphorus may be substituted with sulfur (thiophosphorodiamidate). The 5' oxygen may be substituted with an amino or lower alkyl substituted amino. The pendant nitrogen attached to the phosphorus may be unsubstituted, monosubstituted or disubstituted with (optionally substituted) lower alkyl.

[0105] Antisense oligonucleotides can be prepared by well-known solid phase synthesis techniques.

[0106] In some embodiments, the conjugate further comprises a label. The label provides a detectable signal directly or indirectly. Suitable labels are known in the art and include fluorescent labels or radioactive labels.

[0107] Methods for conjugating CPPs to oligonucleotides are known in the art, or conjugates can be prepared commercially.

[0108] Duchenne Muscular Dystrophy (DMD) Conjugate

[0109] Exon skipping peptide-conjugated antisense therapeutics for treating Duchenne muscular dystrophy are provided. Treatment of DMD with peptide-conjugated antisense therapeutics restores partial functional dystrophin to DMD patients.

[0110] A "functional" dystrophin is one that has sufficient biological activity to slow the progressive degeneration of muscle tissue that is otherwise characteristic of the muscular dystrophy, as compared to the defective dystrophin present in a patient suffering from a muscle disease such as DMD.

[0111] In some embodiments, the functional dystrophin protein may have about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of the in vitro or in vivo biological activity of wild-type dystrophin protein. The activity of dystrophin protein in in vitro muscle culture can be measured based on myotube size, myofibril organization, contractile activity and spontaneous aggregation of acetylcholine receptors.

[0112] Thus, in some embodiments, the peptide-conjugated antisense therapeutics of the invention are used to treat DMD by inducing exon skipping in human dystrophin pre-mRNA to restore functional dystrophin expression.

[0113] In one embodiment, the therapeutic agent comprises one peptide-conjugated antisense oligonucleotide. In an alternative embodiment, the therapeutic agent comprises more than one peptide-conjugated antisense oligonucleotide, wherein each peptide-conjugated antisense oligonucleotide targets a different sequence in the dystrophin pre-mRNA.

[0114] As described herein, peptide-conjugated antisense therapeutics are provided that can be therapeutically effective for exon skipping therapy of one or more of exon 44, exon 45, exon 46, exon 47, exon 48, exon 49, exon 50, exon 51, exon 52, exon 53, exon 54 and / or exon 55 in the human dystrophin (DMD) gene.

[0115] In some embodiments, the peptide-conjugated antisense therapeutic comprises a plurality of peptide-conjugated antisense oligonucleotides and promotes skipping of exons 45-55.

[0116] In some embodiments, the peptide-conjugated antisense therapeutic comprises a peptide-conjugated antisense oligonucleotide targeting exon 45, a peptide-conjugated antisense oligonucleotide targeting exon 46, a peptide-conjugated antisense oligonucleotide targeting exon 47, a peptide-conjugated antisense oligonucleotide targeting exon 48, a peptide-conjugated antisense oligonucleotide targeting exon 49, a peptide-conjugated antisense oligonucleotide targeting exon 50, a peptide-conjugated antisense oligonucleotide targeting exon 51, a peptide-conjugated antisense oligonucleotide targeting exon 52, a peptide-conjugated antisense oligonucleotide targeting exon 53, a peptide-conjugated antisense oligonucleotide targeting exon 54, and a peptide-conjugated antisense oligonucleotide targeting exon 55.

[0117] In other embodiments, the peptide-conjugated antisense therapeutic comprises a peptide-conjugated antisense oligonucleotide targeting exon 45, a peptide-conjugated antisense oligonucleotide targeting exon 47, a peptide-conjugated antisense oligonucleotide targeting exon 49, a peptide-conjugated antisense oligonucleotide targeting exon 51, a peptide-conjugated antisense oligonucleotide targeting exon 53, and a peptide-conjugated antisense oligonucleotide targeting exon 55.

[0118] In yet other embodiments, the peptide-conjugated antisense therapeutic comprises a peptide-conjugated antisense oligonucleotide targeting exon 45, a peptide-conjugated antisense oligonucleotide targeting exon 47, and a peptide-conjugated antisense oligonucleotide targeting exon 53.

[0119] In some embodiments, the antisense oligonucleotide of the peptide-conjugated antisense therapeutic binds to a target sequence in exon 44, exon 45, exon 46, exon 47, exon 48, exon 49, exon 50, exon 51, exon 52, exon 53, exon 54, or exon 55 of the human dystrophin (DMD) gene. Optionally, the target sequence is near an exon acceptor splice site in the pre-mRNA. In some embodiments, the target sequence is located within an exon acceptor splice site, within 10 bases of an exon splice site, within 15 bases of an exon splice site, within 20 bases of an exon splice site, within 30 bases of an exon splice site, within 40 bases of an exon splice site, within 50 bases of an exon splice site, within 75 bases of an exon splice site, or within 100 bases of an exon splice site.

[0120] In some embodiments, the antisense oligonucleotide of the conjugate comprises or consists of at least 10, 12, 14, 16, 18, or 20 consecutive nucleotides of any of the following sequences, wherein the thymine bases in the sequence are optionally uracil:

[0121] ID* sequence, 5' to 3' Ex45_Ac9 GACAACAGTTTGCCGCTGCCCAAATGCCATC Ex46_Ac93 AGTTGCTGCTCTTTTCCAGGTTCAAGTGGG Ex47_Ac13 GTTTGAGAATTCCCTGGCCGCAGGGGCAACT Ex48_Ac7 CAATTTCTCCTTGTTTCTCAGGTAAAGCTC Ex48_Ac78 CAGATGATTTAACTGCTCTTCAAGGTCTTC Ex49_Ac17 ATCTCTTCCACATCCGGTTGTTTAGCTTGA Ex50_Ac19 GTAAACGGTTTACCGCCTTCCACTCAGAGC Ex51_Ac0 GTGTCACCAGAGTAACAGTCTGAGTAGGAG Ex52_Ac24 GGTAATGAGTTCTTCCAACTGGGGACGCCT Ex53_Ac26 CCTCCGGTTCTGAAGGTGTTCTTGTACTTC Ex54_Ac42 GAGAAGTTTCAGGGCCAAGTCATTTGCCAC Ex55_Ac0 TCTTCCAAAGCAGCCTCTCGCTCACTCACC

[0122] * Expressed as: exon target_distance from target exon acceptor site.

[0123] Optionally, the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO).

[0124] In some embodiments, the conjugate increases delivery, uptake, or retention to cardiac cells.

[0125] Spinal Muscular Atrophy (SMA)

[0126] Exon inclusion peptide-conjugated antisense therapeutics for treating spinal muscular atrophy are provided. Treatment of SMA with peptide-conjugated antisense therapeutics results in the production of stabilized SMN2 to compensate for the loss of SMN1.

[0127] The peptide-conjugated antisense therapeutic comprises an antisense oligonucleotide conjugated to DG-9 that binds to the intronic splicing silencer N1 of SMN2 pre-mRNA. Optionally, the antisense oligonucleotide comprises or consists of the sequence 5′-TCACTTTCATAATGCTGG-3′, and wherein thymine is optionally replaced by uracil.

[0128] In some embodiments, the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer.

[0129] Pharmaceutically acceptable excipients

[0130] In one aspect, a pharmaceutical composition is described, comprising one or more antisense oligonucleotides of the invention or conjugates thereof, and one or more pharmaceutically acceptable excipients.

[0131] In some embodiments, pharmaceutical compositions are prepared in a manner known in the art using pharmaceutically inert inorganic and / or organic excipients.

[0132] The term "pharmaceutically acceptable" refers to physiologically tolerable molecules and compositions that generally do not produce allergic or similar untoward reactions when administered to a patient.

[0133] In some embodiments, the pharmaceutical composition can be formulated as pills, tablets, coated tablets, hard gelatin capsules, soft gelatin capsules and / or suppositories, solutions and / or syrups, injectable solutions, microcapsules, implants and / or rods, etc.

[0134] In some embodiments, the pharmaceutical composition can be formulated as an injectable solution.

[0135] In some embodiments, the pharmaceutically acceptable excipients used to prepare pills, tablets, coated tablets and hard gelatin capsules can be selected from any one of the following: lactose, corn starch and / or its derivatives, talc, stearic acid and / or its salts, and the like.

[0136] In some embodiments, pharmaceutically acceptable excipients for preparing soft gelatin capsules and / or suppositories may be selected from fats, waxes, semi-solid and liquid polyols, natural and / or hardened oils, and the like.

[0137] In some embodiments, the pharmaceutically acceptable excipients used to prepare solutions and / or syrups can be selected from water, sucrose, invert sugar, glucose, polyols, and the like.

[0138] In some embodiments, the pharmaceutically acceptable excipients for preparing injection solutions can be selected from water, saline, alcohol, glycerol, polyols, vegetable oils, and the like.

[0139] In some embodiments, the pharmaceutically acceptable excipients used to prepare microcapsules, implants and / or rods can be selected from mixed polymers, such as glycolic acid and lactic acid, and the like.

[0140] In some embodiments, the pharmaceutical composition may comprise a liposomal formulation.

[0141] In some embodiments, optionally, the pharmaceutical composition may comprise two or more different antisense oligonucleotides or conjugates thereof.

[0142] In some embodiments, the antisense oligonucleotide and / or the conjugate may optionally be present in the pharmaceutical composition as a physiologically tolerated salt.

[0143] Suitably, physiologically tolerated salts retain the desired biological activity of the antisense oligonucleotide and / or its conjugate and do not produce undesirable toxicological effects. For antisense oligonucleotides, suitable examples of pharmaceutically acceptable salts include (a) salts formed with cations, such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, etc.; (c) salts formed with organic acids, such as acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalene disulfonic acid, polygalacturonic acid, etc.; and (d) salts formed by elemental anions (such as chlorine, bromine and iodine).

[0144] In some embodiments, in addition to the active ingredient and excipient, the pharmaceutical composition may also include additives such as fillers, extenders, disintegrants, binders, lubricants, wetting agents, stabilizers, emulsifiers, preservatives, sweeteners, dyes, flavorings or fragrances, thickeners, diluents or buffer substances, and solvents and / or solubilizers and / or agents for achieving a sustained release effect, and salts, coating agents and / or antioxidants for changing osmotic pressure. Suitable additives may include Tris-HCl, acetate, phosphate, Tween 80, polysorbate 80, ascorbic acid, sodium pyrosulfite, Thimersol, benzyl alcohol, lactose, mannitol, etc.

[0145] Application

[0146] In some embodiments, one or more peptide-conjugated antisense oligonucleotides and / or pharmaceutical compositions are for topical, enteral, or parenteral administration.

[0147] In some embodiments, one or more peptide-conjugated antisense oligonucleotides and / or pharmaceutical compositions can be used for oral, transdermal, intravenous, intrathecal, intramuscular, subcutaneous, nasal, transmucosal, etc. administration.

[0148] In some embodiments, one or more antisense oligonucleotides and / or pharmaceutical compositions are for intramuscular administration.

[0149] In some embodiments, one or more antisense oligonucleotides and / or pharmaceutical compositions are for intramuscular administration by injection.

[0150] "Effective amount" or "therapeutically effective amount" refers to the amount of antisense oligonucleotide administered to a subject, whether as a single dose or as part of a series of doses, that is effective to produce the desired physiological response or therapeutic effect in the subject.

[0151] In some embodiments, one or more antisense oligonucleotides or their conjugates are administered once a day, once every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days, once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 weeks, or once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months.

[0152] In some embodiments, the antisense oligonucleotide or its conjugate may be administered separately as two, three, four, five, six or more sub-doses at appropriate intervals throughout the day, optionally in unit dosage form.

[0153] In order to better understand the present invention described herein, the following examples are presented. It should be understood that these examples are for illustrative purposes only. Therefore, they should not limit the scope of the present invention in any way.

[0154] Example

[0155] Example 1: Peptide-conjugated PMOs for the treatment of Duchenne muscular dystrophy

[0156] Duchenne muscular dystrophy (DMD) is primarily caused by out-of-frame deletions of the dystrophin gene. Exon skipping using phosphorodiamidate morpholino oligomers (PMOs) converts out-of-frame mutations to in-frame mutations, producing partially functional dystrophin. Skipping exons 45-55 can treat 40-47% of all patients and is associated with improved clinical outcomes. The development of a peptide-conjugated PMO for exon 45-55 skipping is reported. Experiments with immortalized patient myotubes showed that exons 45-55 can be skipped by targeting as few as five exons. Conjugation of the cell-penetrating peptide DG9 to the PMO improved single exon 51 skipping, dystrophin restoration, and muscle function in hDMDdel52;mdx mice. Local administration of a DG9-PMO mixture that minimizes exon 45-55 skipping restored dystrophin production.

[0157] result

[0158] Minimizing the exon 45-55 skipping mixture

[0159] Two strategies were used to minimize the number of pMOs required to skip DMD exons 45–55.

[0160] First, the PMO (or multiple PMOs) targeting exons in this region were removed from a previously developed exon 45-55 skipping mix

[13] (Table 1). The complete mix, in which the PMOs targeted all exons within exon 45-55, was referred to as the “full” mix ( Figure 1a). The “full” mixture and its derivatives were transfected into healthy immortalized patient-derived KM155 myotubes ( Figure 1 b), only the “full” mixture skipped exons 45-55 significantly higher than the mock (p<0.005) ( Figure 5 a). PMOs whose deletion resulted in a significant decrease in skipping were retained as part of the minimization mix, namely PMOs targeting exons 45, 47, and 53. PMOs targeting exons 49, 51, and 55 were also retained. This minimization mix was termed the “base” mix and subjected to another round of minimization in immortalized exon 52-deleted patient-derived KM571 myotubes. The “base” mix showed significant exon 45-55 skipping compared to mock (p<0.05), as well as its derivatives in which exons 47 (p<0.05) or 51 (p<0.05) were not targeted ( Figure 5 a). The “Base” and “Base-51” mixtures showed the highest hopping efficiency in the batch ( Figure 1 a).

[0161] For the second strategy, minimized mixtures based on the endogenous splicing of DMD exons 45-55 were prepared. One model proposes that exons 45-49, 50-52, and 53-55 are spliced ​​first, after which these groups are spliced ​​together to complete the exon 45-55 region (25). Derivative mixtures from the “full” mixture were designed in which PMOs targeted the terminal exons of these three groups. Transfection into healthy KM155 myotubes revealed that the three derivative mixtures skipped exons 45-55 significantly more than the mock (p < 0.05) ( Figure 5 b), the skipping efficiency was not significantly different from the "full" mixture. Based on this, a mixture targeting exons 45, 49, 50, 52, 53, and 55 ("block" mixture) and a mixture targeting exons 45, 50, and 55 ("3-PMO" mixture) were selected for further experiments ( Figure 1 a).

[0162] Minimized exon skipping cocktail efficiently skips exons 45-55 in various patient cells

[0163] The “full,” “basal,” “basal-51,” “block,” and “3-PMO” exon 45–55 skipping cocktails were subsequently tested in the following immortalized patient-derived myocyte cell lines: KM155 (healthy), KM571 (Δex52), 6594 (Δex48–50), and 6311 (Δex45–52) ( Figure 1 a). Each cell line was treated with a cocktail of mutant tailored versions that removed unnecessary PMOs. Figure 1b) and after RT-PCR analysis, the “full” mixture significantly skipped exons 45-55 in all lines compared to the mock (p<0.005 or p<0.001) ( Figure 1 c). The "Basic-51", "Block" and "3-PMO" mixtures induced significant exon 45-55 skipping in KM155, KM571 and 6594 myotubes compared to mock (at least p<0.05); the "Basic" mixture showed significant skipping only in KM155 cells (p<0.001). In 6594 myotubes, the "3-PMO" mixture induced significantly higher skipping than the "Full" mixture. Interestingly, all minimized mixtures did not show any exon 45-55 skipping in 6594 myotubes.

[0164] The ability of the "Block" and "3-PMO" mixtures to restore dystrophin in KM571 myotubes was assessed, as these mixtures induced the highest levels of exon 45-55 skipping in this line. Western blotting using antibodies against the rod (DYS1, exons 26-30) and C-terminal domains of dystrophin (ab15277) detected dystrophin after treatment with the "Full" and "Block" mixtures, but not with the "3-PMO" mixture ( Figure 1 d). Quantification of DYS1 signaling showed that the “block” mixture treatment restored an average of 2.94% of wild-type dystrophin levels, slightly higher than the average 2.33% dystrophin restored by the “full” mixture, and an increase compared to the 0.10% dystrophin level in the mock (p<0.001) ( Figure 1 e). Western blotting using MANEX45A (corresponding to exons 45-46) and MANEX4850E (corresponding to exons 48-50) antibodies did not detect dystrophin in treated myotubes ( Figure 1 d), suggesting that the dystrophin induced after treatment may arise from exon 45-55 skipped transcripts.

[0165] A single intravenous treatment with DG9-PMO induces higher dystrophin production in skeletal muscle and heart than unconjugated PMO

[0166] To evaluate DG9 as a conjugate in a mixture that minimizes exon 45-55 skipping, its in vivo efficacy for single exon skipping was evaluated. DG9 was conjugated to Ex51_Ac0, an exon 51-skipping PMO in a “full” mixture that is up to 7-fold more effective than eteplirsen in restoring dystrophin production in vitro [13,26]. Three-month-old hDMDdel52;mdx mice were injected retro-orbitally with a single saline, 50 mg / kg unconjugated PMO, or 64 mg / kg DG9-PMO (equimolar to the PMO dose) and evaluated one week later ( Figure 2 a). DG9-PMO treated mice showed significantly higher levels of exon 51 skipping in various skeletal muscles (at least p<0.05) and heart (p<0.001) than saline or PMO treated mice ( Figure 2 b). DG9-PMO induced an average of 2.2 to 12.3-fold higher jumps in skeletal muscle and 14.4-fold higher jumps in heart compared to unconjugated PMO. DG9-PMO treatment significantly restored dystrophin production in gastrocnemius and quadriceps muscles to up to 3% of wild-type levels (P < 0.05) compared to saline (p < 0.005) and PMO (p < 0.05) treatment. Figure 2 c). In the heart, DG9-PMO restored an average of 2.5% of wild-type dystrophin levels, significantly higher than saline or PMO groups (p<0.05). Compared to PMO-treated mice, mice receiving DG9-PMO had an average of 1.5- to 3.4-fold and 4.5-fold higher dystrophin levels in skeletal muscle and heart, respectively.

[0167] Extensive dystrophin-positive fibers were observed in the tibia anterior, diaphragm, and heart of DG9-PMO-treated mice, whereas few or even none were found in saline- or PMO-treated mice ( Figure 2 d). However, histological analysis showed that the percentage of centrally nucleated fibers (CNFs, a marker of cumulative muscle regeneration) in the tibialis anterior and diaphragm was not reduced after PMO or DG9-PMO treatment ( Figure 6 a, b), and no improvement in muscle fiber size ( Figure 6 a,c,d).

[0168] Repeated intravenous treatment with DG9-PMO improves dystrophin production, muscle function, and fiber size in dystrophic mice

[0169] A repeat-dose treatment study was performed to gain more insight into the efficacy of DG9-PMO exon skipping therapy in ameliorating malnutrition symptoms. Two-month-old hDMDdel52;mdx mice were retro-orbitally injected with saline or 30 mg / kg DG9-PMO once weekly for 3 weeks. Functional assessments were performed at baseline and 2 weeks after the last injection, and tissues were collected ( Figure 3 a). Again, DG9-PMO treatment significantly induced exon 51 skipping at high levels in skeletal muscle and heart compared with saline controls (55-71% on average) (p<0.001) ( Figure 3 b). This resulted in significant dystrophin production in various skeletal muscles, averaging 2.8-3.9% compared to 0.1-0.3% in saline-treated mice (at least p<0.05) ( Figure 3 c), and in the heart an average of 7.7% compared with 0.5% in the saline group (p<0.001) ( Figure 3 d). Immunofluorescence confirmed the presence of extensive dystrophin-positive fibers in the anterior tibia, diaphragm, and heart ( Figure 3 e).

[0170] There were no significant differences in body weight between the groups during treatment ( Figure 3 f). Most impressively, repeated DG9-PMO treatment significantly improved the forelimb size of hDMDdel52;mdx mice (p<0.05) ( Figure 3 g) and whole limb (p<0.005) ( Figure 3 h) Grip strength, thus they were not significantly different from wild type controls. Almost all mice showed an improvement in forelimb / total limb grip strength from baseline, with only one mouse showing a -0.3% difference in forelimb grip strength after treatment. This was in contrast to saline controls, which showed no direction of change ( Figure 3 g) or no change from baseline ( Figure 3 h). Rotarod and treadmill tests showed similar improvements; in particular, treadmill distance walked was significantly improved compared to baseline in treated mice compared to saline control mice ( Figure 7 a, b).

[0171] Histological analysis still did not show any significant reduction in CNF in the anterior tibia and diaphragm ( Figure 7 c, d). However, a significant increase in fiber size was observed after DG9-PMO treatment (p < 0.001) ( Figure 7e, f), the minimum Feret diameter of most fibers in the tibialis anterior was 45-50 μm and in the diaphragm was 25-30 μm. This contrasts with the diameter of most fibers in saline control muscles, which were 30-35 μm and 20-25 μm, respectively. Qualitative histological analysis of the liver and kidneys of mice treated with single and repeated doses revealed no evidence of toxicity caused by PMO or DG9-PMO treatment ( Figure 8 a, b).

[0172] Local treatment with a DG9-conjugated minimized exon 45–55 skipping cocktail induced successful skipping and dystrophin production

[0173] Finally, DG9 was conjugated to each PMO of the minimized “block” exon 45-55 skipping mix for in vivo testing. The “block” mix was chosen because it induces high levels of exon 45-55 skipping and dystrophin restoration in KM571 myotubes ( Figure 1 Therefore, 5- to 6-month-old hDMDdel52;mdx mice were injected into the tibialis anterior muscle with saline or a “block” mixture of mutant-tailored DG9-conjugated forms (5 DG9-PMOs, 5 μg / DG9-PMO, total dose 25 μg) and assessed one week later ( Figure 4 a). Significant exon 45-55 skipping was observed compared to saline controls (p<0.001) ( Figure 4 b). Western blot showed that the restoration of dystrophin in DG9-PMO treated muscles averaged 0.76% of wild-type levels, which was significantly higher than 0.46% in saline treated muscles (p<0.05) ( Figure 4 c). Because one leg of the same mouse received DG9-PMO and the contralateral leg received saline, protein from untreated mice was included to account for possible leakage between the legs. Dystrophin in untreated tibialis anterior muscles was 0.12% of wild-type levels, which is lower than levels in saline controls. Some scattered dystrophin-positive fibers were observed in DG9-PMO-treated muscles and few to none in saline controls, confirming dystrophin restoration ( Figure 4 d).

[0174] discuss

[0175] A minimized exon 45-55 skipping mix was developed that induced dystrophin restoration in immortalized patient cells and dystrophic hDMDdel52;mdx mice. For exon 52-deleted DMD transcripts, the number of PMOs used for exon 45-55 skipping was reduced from 11 in the "full" mix to 5 in the "block" mix ( Figure 1a), PMO content was reduced by more than 50%. While most minimized mixes significantly skipped exons 45-55 in KM571 (Δex52) and 6594 (Δex48-50) myotubes, it was clear that all remaining exons must have been targeted in 6311 myotubes (Δex45-52). The "block" mix restored dystrophin production to about 3% of wild-type levels, approaching the amount of the "full" mix ( Figure 1 e).

[0176] The efficacy of DG9 conjugated to PMO in single-exon and multi-exon skipping applications was demonstrated. DG9-PMO treatment resulted in higher levels of single-exon skipping and dystrophin recovery in vivo compared to unconjugated PMO ( Figure 2 Repeated treatment resulted in a more pronounced restoration of dystrophin in all tissues examined, especially the heart, from 2.5% to 7.7% of wild-type levels ( Figure 2 c, 3d).

[0177] The advantage of DG9 over other peptides lies in its potentially better toxicity profile. Peptide-conjugated PMOs induced dose-dependent toxic effects in preclinical studies, including drowsiness, weight loss, and renal damage (20). This is related to the membrane-destructive properties of cell-penetrating peptides, which are largely influenced by their amino acid composition (20, 29). Certain L-arginine residues in DG9 were converted to D-arginine because this increased the viability of peptide-conjugated PMO-treated cells in vitro (30). DG9 also does not contain any 6-aminohexanoic acid residues, which have been associated with increased toxicity (30). Compared with DG9, previous peptides mostly used L-arginine and contained multiple 6-aminohexanoic acid residues, but were similar in length and total arginine content (20). Although the above modifications reduce the antisense activity of peptide-conjugated PMOs, they have the benefit of improved safety. A balance must be struck between the efficacy and safety of peptide-conjugated PMOs, as too frequent or too high doses can increase toxicity (20, 29). No evidence of liver and kidney toxicity was found for DG9-PMO ( Figure 8 ).

[0178] In terms of efficacy, although our DG9-PMO induced high exon 51 skipping, the observed dystrophin recovery was generally lower than that achieved with other peptide-conjugated PMOs (20, 29). This may be due to differences in strategy, as most peptide-conjugated PMO studies have performed exon 23 skipping (20). Aoki et al. (2010) (who used a PMO to skip exon 51 (31)) and Aupy et al. (2020) (who also skipped exon 51 but used adeno-associated virus-delivered U7 small nuclear RNA (32)) observed similar differences between exon skipping and dystrophin recovery levels in vivo. It is possible that exon 51-skipped transcripts or proteins are less stable than their exon 23-skipped counterparts, leading to the observed reduction in dystrophin levels. An in vitro study using various internally truncated dystrophins showed that exon 51-skipped dystrophins were mostly as stable as full-length dystrophins (33), supporting the hypothesis of reduced transcript stability. While previous studies have shown that DMD transcript stability has an impact on dystrophin production (34, 35), whether this explains the differences in the case of exon 23 and exon 51 skipped transcripts remains to be determined. Another factor is the animal model used for testing. Since humanized dystrophin mice such as hDMDdel52;mdx have only recently been developed, it will be important to characterize the stability of human DMD transcripts and proteins in these models to determine whether this will have an impact on the efficacy of the exon skipping therapies being tested.

[0179] Despite its relatively reduced activity, functional improvements were observed in mice given repeated doses of DG9-PMO ( Figure 3 g, h, Figure 7 a, b). The average dystrophin levels in skeletal muscle of treated hDMDdel52;mdx mice were restored to 2.8-3.9% of wild-type ( Figure 3 c). This was accompanied by improvements in fiber size as shown in the tibialis anterior and diaphragm ( Figure 7 c, e, f). This finding supports the idea that not much dystrophin may be needed to achieve functional benefits in vivo. Indeed, previous studies of mdx mice with nonrandom X chromosome inactivation (mdx-Xist Δhs ) demonstrated that just 3–14% of normal levels of dystrophin were sufficient to increase performance in wire-hanging and grip strength tests to wild-type levels (36).

[0180] In terms of multi-exon skipping, promisingly, a DG9-conjugated version of the minimized “block” mixture successfully skipped exons 45–55 with 9.5% efficiency and restored dystrophin production in hDMDdel52;mdx mice to an average of 0.8% near wild-type levels ( Figure 4 b, c). It has been previously shown that the ‘full’ mix induces 15% exon 45-55 skipping efficiency following intramuscular treatment of different humanized DMD mouse models at a dose of 1.67 μg / PMO

[13] . Clearly higher doses of the ‘block’ mix are required to induce comparable skipping levels in vivo as the ‘full’ mix. As the human and mouse transcript target sequences of the DG9-PMOs in the ‘block’ mix are 70–93% identical, it is possible that the mouse Dmd transcript expressed in hDMDdel52;mdx mice may have sequestered some of the administered DG9-PMOs. Crossing the hDMDdel52 transgene to a mouse Dmd null background

[37] would eliminate this possibility and potentially yield more representative efficacy results.

[0181] method

[0182] Cell culture. All immortalized human muscle cells were kindly provided by the MRC Neuromuscular Disease Centre Biobank (NHS Research Ethics Committee Reference 06 / Q0406 / 33, HTA License No. 12198) through Dr. Francesco Muntoni. The following immortalized patient-derived myoblast cell lines were used: KM155 (healthy), KM571 (DMDΔex52), 6594 (DMDΔex48-50) and 6311 (DMDΔex45-52). Table 2 summarizes the information of these cell lines. Myoblasts were grown in DMEM / F12 medium (with HEPES; Gibco) containing 20% ​​fetal bovine serum (Sigma), 1 bottle of skeletal muscle growth supplement mixture (Promocell), 50 U / mL penicillin and 50 μg / mL streptomycin. Myoblasts were then plated at 0.53×10 5 cells / cm 2 The cells were seeded at a density of 100 μg / mL into 12-well plates coated with type 1 collagen. Once 90% confluent, myoblasts were differentiated into myotubes by replacing the growth medium with differentiation medium (DMEM / F12 containing 2% horse serum [GE Healthcare], 1× ITS solution [Sigma], 50 U / mL penicillin, and 50 μg / mL streptomycin). All cells were incubated at 37°C, 5% CO2.

[0183] PMO transfection. Table 1 summarizes the PMOs used, which were derived from mixture set 3 in our previous publication [1]. Prior to transfection, PMOs (Gene Tools) were heated at 65°C for 15 min to remove aggregates. PMOs were then transfected into myofibers 3 days after differentiation using 6 μM Endoporter reagent (Gene Tools) in differentiation medium. In all experiments, each PMO in the mixture was transfected at a final concentration of 5 μM. Cells were incubated in PMO for 2 days, after which RNA and protein were harvested ( Figure 1 a). Mock treatment was performed using a randomized control 25-N (Gene Tools). For untreated samples, transfection was performed as described by Endoporter, except that no PMO was used.

[0184] Animal treatment. Only male hDMDdel52;mdx mice (C57BL / 6J background) heterozygous for the hDMDdel52 transgene were used (2, 3). For single exon skipping studies, DG9 (sequence N-YArVRRrGPRGYArVRRrGPRr-C; uppercase: L-amino acids, lowercase: D-amino acids) was conjugated to the 3' end of Ex51_Ac0 (Table 1), which is a human DMD exon 51 skipping PMO that we developed previously [1, 4]. We performed two experiments: single-dose and repeated-dose treatments. For single-dose treatments, 3-month-old hDMDdel52;mdx mice were injected retro-orbitally with phosphate-buffered saline (PBS), PMO (50 mg / kg, unconjugated Ex51_Ac0), or DG9-PMO (64 mg / kg, equimolar to 50 mg / kg PMO) and euthanized one week later for tissue collection. For repeated dose treatment, 2-month-old hDMDdel52;mdx mice were injected retro-orbitally with PBS or DG9-PMO (30 mg / kg) three times once a week for 3 weeks. Body weight was recorded throughout the treatment, and mice were tested for muscle function before the first injection and 2 weeks after the last injection as described for functional testing. Mice were euthanized after functional testing to collect tissues. After dissection, tissues were mounted in tragacanth gum on corks and snap-frozen in liquid nitrogen-cooled isopentane.

[0185] For multi-exon skipping, DG9 was conjugated to each PMO that minimized the “block” exon 45-55 skipping mixture ( Figure 1a). This DG9-PMO mixture (5 μg of DG9-PMO per time, total dose of 25 μg) was then administered intramuscularly to the anterior tibia of 5- to 6-month-old hDMDdel52;mdx mice; the contralateral leg was injected with PBS. One week later, mice were euthanized as described above for tissue collection. All injections (retro-orbital and intramuscular) were performed under isoflurane anesthesia. Tissues from age-matched wild-type male C57BL / 6J mice were collected as controls.

[0186] Functional testing. Forelimb and whole-limb grip strength tests were performed by blinded personnel using a Chatillon DFE II dynamometer (Columbus Instruments) according to TREAT-NMD SOP DMD_M.2.2.001. The average of the three most consistent readings was used for each mouse, and the results were normalized to body weight. Rotarod testing was performed using an AccuRotor 4-channel rotarod (Omnitech Electronics, Inc.). The mice were first placed on a rod that rotated at a steady speed of 5 rpm. Once all mice were in place, the rotation was accelerated from 5 to 45 rpm within 300 s [5]. The time to fall was automatically recorded by the software. The software automatically records the time to fall. Three trials were performed with an interval of 15 minutes, and the average or peak time to fall of these trials was used for analysis. According to TREAT-NMD SOP DMD_M.2.1.003, running to exhaustion tests were performed using an Exer 3 / 6 animal treadmill (Columbus Instruments). Mice ran on a treadmill according to the following program: 5 m / min for 5 min, then the speed increased by 1 m / min per minute until exhaustion. Exhaustion was considered to be when the mouse did not return to the treadmill within 10 seconds after repeated gentle pushes. The maximum test duration was set at 15 min. All tests were performed at baseline (before receiving treatment) and 2 weeks after receiving the final treatment. Age-matched wild-type male C57BL / 6J mice were used as controls.

[0187] RT-PCR and exon skipping assessment Total RNA was extracted from cells and 20 μm tissue sections using Trizol (Invitrogen) according to the manufacturer's instructions.

[0188] For exon 45-55 skipping analysis, a Platinum TM SuperScript of Taq (Invitrogen) TMIII One-step RT-PCR system. Briefly, 200 ng of total RNA was used as a template in a 25 μL solution containing 1× reaction mixture, 0.2 μM each of the forward and reverse primers of DMD or GAPDH / Gapdh (Table 3) and 1 μL SuperScript III RT / Platinum Taq. The reaction was performed under the following conditions: 1) 50°C, 5 min, 2) 94°C, 2 min, 3) 35 cycles of 94°C, 15 s; 60°C, 30 s; 68°C, 33-118 s, 4) 68°C 5 min, 5) 4°C, hold.

[0189] For exon 51 skipping analysis, SuperScript was used according to the manufacturer's instructions. TM cDNA was synthesized from 750-1000 ng total RNA in a 20 μL reaction using IV reverse transcriptase (Invitrogen) and 2.5 μM random hexamers (Invitrogen). Thus, 8 μL of cDNA was used in a 25 μL reaction with 1× Green Master Mix (Promega) and 0.3 μM each of the forward and reverse primers of DMD or Gapdh (Table 3) were used for PCR. The reaction was performed as follows: 1) 95°C, 2 min, 2) 40 cycles of 95°C, 30 s; 60°C, 30 s; 72°C, 35 s, 3) 72°C 5 min, and 4) 4°C, hold. All PCR products (exon 45-55 or exon 51 skipped) were run on 1.5% agarose gel in 1×tris-EDTA buffer, and band intensity was quantified by Image J (NIH). The percentage of successful exon skipping was calculated using the following formula: (intensity of the desired skipping band / total intensity of the unskipped, intermediate and desired skipping bands)×100.

[0190] Western blotting. Total proteins were extracted from cells using RIPA buffer (Sigma) supplemented with complete, mini, and EDTA-free protease inhibitor cocktail (Roche) according to our previously published protocol (6). On the other hand, total proteins were extracted from 20 μm tissue sections using high SDS lysis buffer containing 10% SDS, 70 mM Tris-HCl (pH 6.7), 5 mM EDTA (pH 8.0), 5% β-mercaptoethanol, and complete protease inhibitor cocktail in water, also according to a previous protocol (7). TM BCA kit (Thermo Scientific) or Pierce TM Protein was quantified using the Coomassie Brilliant Blue (Bradford) kit (Thermo Fisher).

[0191] In preparation for western blot, proteins were mixed with NuPAGE TM LDS sample buffer (Invitrogen; 1× final concentration) and NuPAGE TM The samples were mixed with reducing agent (Invitrogen; 1× final concentration) and then heated at 70°C for 10 min. TM SDS-PAGE was performed on 3-8% Tris-acetate Midi gels (Invitrogen) at 150 V for 75 min. Proteins were then transferred to PVDF membranes (Millipore) using a semi-dry blotting system at 20 V for 70 min. The membranes were blocked overnight in 2% ECL Prime blocking agent (GE Healthcare) while shaking at 4°C; the transferred gels were stained with PageBlue protein staining solution (Thermo Scientific) for 1 hour at room temperature to detect the myosin heavy chain band. After blocking, the membrane was excised and incubated for 1 h at room temperature in one of the following primary antibodies in blocking reagent: 1:200 NCL-DYS1 (Leica), 1:2,500 anti-dystrophin C-terminus (Abcam, ab15277), 1:100 MANEX45A (Developmental Studies Hybridoma Bank; DSHB), (8) 1:100 MANEX4850E (MDA Monoclonal Antibody Resource, Wolfson Center for Inherited Neuromuscular Diseases) (8), or 1:4,000 anti-desmin (Abcam, ab8592). The membrane was then washed three times for 10 min each with PBS containing 0.05% Tween 20 (PBST) and then incubated in anti-mouse IgG2a, anti-mouse IgG1, or anti-rabbit IgG (H+L) horseradish peroxidase-conjugated secondary antibodies (Invitrogen) where appropriate, all at 1:10,000 in PBST. The membrane was then washed similarly with PBST and detected with ECL Select Detection Reagent (GE Healthcare). TM DYS1 band intensity was quantified by Dynabeads® software v.6.0.1 (Bio-Rad), and dystrophin levels are expressed relative to the intensity of the lowest wild-type sample in the series.

[0192] Dystrophin immunofluorescence. Frozen muscle and heart samples were cut into 7-μm thick sections and placed on poly-L-lysine-coated slides. After thawing for 30 min at room temperature, the sections were blocked in PBS containing 10% goat serum and 0.1% Triton X-100 for 2 h at room temperature. The sections were then incubated with 1:50 NCL-DYS1 in blocking agent at 4°C overnight. The next day, the sections were washed three times with PBS for 5 min each and subsequently incubated with Alexa 488-conjugated goat anti-mouse IgG2a secondary antibody (Life Technologies) at room temperature for 30 min. The sections were washed again with PBS and mounted with Vectashield HardSet antifade mounting medium containing DAPI (Vector Laboratories). Dystrophin and DAPI in the samples were observed at 200× magnification using a Zeiss LSM 710 confocal microscope by staff who were unaware of the treatment.

[0193] Histology. Frozen muscles were cut into 7-μm thick sections and placed on poly-L-lysine-coated slides. After thawing at room temperature for 30 min, the slides were stained with Mayer's hematoxylin (Electron Microscopy Sciences) for 15 min, washed with tap water for 15 min, and then stained with eosin Y (Electron Microscopy Sciences) for 10 min. The sections were then dehydrated with an ethanol series (70%-90%-99%), cleared with xylene substitute, and mounted with Permount. TM (Fisher Scientific). Samples were observed under bright field using an Optika B-290TB microscope at 200× magnification, and three fields of view were randomly selected for each sample. The CNF percentage was calculated as (#CNF / total number of fibers)×100, and fibers were manually counted using Image J. The average CNF percentage across all fields of view for each sample was obtained. Minimum Feret diameter was quantified by blinded personnel in two steps. First, images were semiautomatically measured using an Image J macro developed in-house based on Open-CSAM (9). Since Open-CSAM was originally developed for immunofluorescence images, we had to modify it extensively to be compatible with hematoxylin and eosin-stained images, which required the use of the Color Deconvolution 2 plugin [10, 11]. Second, images from the semiautomatic measurements were manually cleaned to correct for fiber boundaries. A single fiber measurement was considered for the sample for analysis. For CNF and minimum Feret diameter quantification, fibers that touched the edge of the image were not considered.

[0194] Statistical analysis. All statistical tests were performed using Prism v.9.0.1 (GraphPad Software). Unpaired two-tailed t-tests, or one-way ANOVA with post hoc Tukey or Dunnett multiple comparison tests were performed as appropriate. P values ​​< 0.05 were considered statistically significant.

[0195] Table 1. List of PMO sequences used in this study.

[0196] ID* sequence, 5' to 3' Ex45_Ac9 GACAACAGTTTGCCGCTGCCCAAATGCCATC Ex46_Ac93 AGTTGCTGCTCTTTTCCAGGTTCAAGTGGG Ex47_Ac13 GTTTGAGAATTCCCTGGCCGCAGGGGCAACT Ex48_Ac7 CAATTTCTCCTTGTTTCTCAGGTAAAGCTC Ex48_Ac78 CAGATGATTTAACTGCTCTTCAAGGTCTTC Ex49_Ac17 ATCTCTTCCACATCCGGTTGTTTAGCTTGA Ex50_Ac19 GTAAACGGTTTACCGCCTTCCACTCAGAGC Ex51_Ac0 GTGTCACCAGAGTAACAGTCTGAGTAGGAG Ex52_Ac24 GGTAATGAGTTCTTCCAACTGGGGACGCCT Ex53_Ac26 CCTCCGGTTCTGAAGGTGTTCTTGTACTTC Ex54_Ac42 GAGAAGTTTCAGGGCCAAGTCATTTGCCAC Ex55_Ac0 TCTTCCAAAGCAGCCTCTCGCTCACTCACC

[0197] * Expressed as: Exon target_distance from target exon acceptor site

[0198] Table 2. Information about the immortalized cell lines used in this study.

[0199]

[0200]

[0201] Table 3. List of primers and sequences used in this study.

[0202]

[0203] Table 4. List of PMO sequences for exon 44 skipping

[0204] name Oligo sequence hEx44_Ac7 AAAACGCCGCCATTTCTCAACAGATCTGTC hEx44_Ac2 GCCGCCATTTCTCAACAGATCTGTCAAATC hEx44_Ac14 CATAATGAAAACGCCGCCATTTCTCAACAG hEx44_Ac0 CGCCATTTCTCAACAGATCTGTCAAATCGC hEx44_Ac18 ATATCATAATGAAAACGCCGCCATTTCTCA hEx44_Ac56 ACTGTTCAGCTTCTGTTAGCCACTGATTAA hEx44_Ac118 CTTAAGATACCATTTGTATTTAGCATGTTC hEx44_Ac85 ATTCTCAGGAATTTGTGTCTTTCTGAGAAA

[0205] Example 2: Peptide-conjugated PMO for the treatment of spinal muscular atrophy

[0206] Spinal muscular atrophy (SMA) is the most common genetic cause of infantile death caused by mutations in the survival motor neuron 1 (SMN1) gene. Humans have an SMN1 paralog, SMN2. However, SMN2 cannot rescue the SMA phenotype because 90% of exon 7 in SMN2 mRNA is spliced ​​due to a single CT nucleotide transition. The currently approved antisense oligonucleotide (AO) nusinersen (trade name Spinraza) targets SMN2 and induces SMN expression by promoting exon 7 inclusion. However, delivering AO to the central nervous system (CNS) and systemic tissues is difficult. Although current approaches are limited to the use of highly invasive intrathecal injections and primarily treat motor neurons, recent studies have shown that SMA is a multi-organ disease that requires a systemic range of treatment approaches. To bypass intrathecal injections, a novel cell-penetrating peptide called DG9 significantly increases the absorption of AO after a single subcutaneous application. It has been shown that DG9-conjugated AO (DG9-PMO) extends the lifespan of SMA mice and improves respiratory dysfunction, the most common cause of death in SMA. DG9-PMO treatment resulted in a significant increase in full-length SMN2 expression and SMN protein levels in peripheral and CNS tissues. Furthermore, treatment ameliorated pathology in skeletal muscle and neuromuscular junctions. Finally, we show that DG9-PMO penetrates the fully developed blood-brain barrier and can be distributed in the CNS after systemic injection.

[0207] result

[0208] Subcutaneous administration of DG9-PMO improved the survival rate of severe SMA mice and increased SMN2 expression in a dose-dependent manner.

[0209] To examine whether DG9 peptide can improve the efficacy of PMO, DG9 peptide was conjugated to 18-mer PMO with the same sequence as nusinersen. DG9-conjugated PMO and unconjugated PMO as well as 2'-O-methoxyethyl-RNA (MOE) were injected into SMA model mice. We used the Taiwanese SMA mouse model (Smn - / - SMN2 Tg / - ), which exhibits a severe phenotype with a median survival of 8 days (d) [77,78].

[0210] Mice were injected subcutaneously with AO or saline (NT) at two different doses of 40 mg / kg or 80 mg / kg on postnatal day 0 (PD0). Survival was recorded until humane endpoints were reached. For the 40 mg / kg dose, median survival was 12 days (unconjugated PMO), 15.5 days (MOE), and increased to 58 days (DG9-PMO treatment) ( Fig. 9a). For the higher dose of 80 mg / kg, the median survival increased to 57 days (unconjugated PMO), 121 days (DG9-PMO), and 64 days (MOE) ( Fig. 9 a). These results suggest that DG9-PMO can extend the lifespan of SMA mice more effectively than unmodified PMO. For both doses, DG9-PMO-treated mice were significantly heavier at postnatal day 7 (PD7) than NT, unconjugated PMO-treated littermates, and compared with age-matched heterozygous littermates (Het) (Smn + / - SMN2 Tg / - ) showed no significant difference in body weight, showing normal wild-type (WT)-like characteristics ( Fig. 9 b) DG9-PMO treated mice looked very similar to Het, whereas unconjugated PMO treated neonates appeared to exhibit a weak phenotype similar to NT mice ( Fig.16 ).

[0211] Next, we evaluated the expression of FL-SMN2 relative to Δ7SMN2 transcripts using real-time quantitative PCR (RT-qPCR) at PD7. At both doses, DG9-PMO treatment resulted in 4- to 30-fold higher expression of FL-SMN2 in peripheral and CNS tissues compared with NT controls ( Fig.10 a). It also resulted in an approximately 5-fold increase in FL-SMN2 expression compared to unconjugated PMO and MOE treatment in most tissues ( Fig.10 a, Fig.16 a). These data indicate that DG9-PMO induces FL-SMN2 expression more effectively than unmodified PMO. These findings were validated at the protein level using Western blotting, where DG9-PMO treatment increased SMN protein levels in both peripheral and CNS tissues. ( Fig.10 b, Fig.16 b). We also found that subcutaneous administration of 40 mg / kg of DG9-PMO resulted in sustained levels of SMN expression at PD30 ( Fig.17 ). DG9-PMO and MOE treatments resulted in similar SMN levels in the tissues studied. These results suggest that DG9-PMO is more effective than unconjugated PMO, with a dose-dependent effect.

[0212] Subcutaneous administration of DG9-PMO improved motor function and muscle strength in SMA mice.

[0213] To evaluate the effects of systemic DG9-PMO treatment on muscle strength and motor neuron function, several functional tests were used to compare motor function between treated and NT mice at different time points. The hindlimb hanging (HLS) assay and righting reflex test were performed in the early weeks of life. After PD6, the HLS scores of NT mice decreased as they were unable to extend their hindlimbs when suspended by their tails ( Fig. 9 c). These mice also showed a reduction in latency to the tube. At PD12, DG9-PMO-treated neonates showed comparable hindlimb strength to Het, with significantly higher scores and longer latency to the tube compared to unconjugated PMO and NT mice ( Fig. 9 c). In the righting reflex test, the time it took DG9-PMO mice to right themselves with their paws was significantly reduced between PD6 and PD10, indicating improved muscle strength and coordination ( Fig. 9 d). Unconjugated PMO and MOE treated mice that survived past PD12 showed some improvement in performance, but still took longer than DG9-PMO mice. Of note, these results are slightly biased as only the healthiest unconjugated PMO and MOE treated mice survived to these time points. This improvement was further supported by assessment of forelimb grip strength in DG9-PMO treated mice at PD30 ( Fig. 9 e). DG9-PMO treated mice showed forelimb grip strength comparable to that of Het and significantly higher than that of unconjugated PMO and MOE treated mice ( Fig. 9 e). We also evaluated the relationship between forelimb data and sex at PD30. Surprisingly, no significant differences were observed between males in the groups, but significant differences were observed in females ( Fig.18 a). At PD60, Het and treated mice showed no significant difference in performance ( Fig. 9 e). Unconjugated PMO mice did not survive to PD60 and were excluded from this part of the study. We observed similar results at PD30 and PD60 in the 80 mg / kg dose study ( Fig.18 b). We also performed the rotarod test on the 40 mg / kg group at PD30 to assess their overall muscle coordination and balance. The ability of mice in all groups to coordinate and balance on the rotating beam varied, and no significant differences were detected

[36] ( Fig.18 c). Based on the conclusive findings from these functional tests, systemic injection of DG9-PMO improves motor function and muscle strength in SMA mice.

[0214] DG9-PMO treatment improves respiratory function in newborn SMA mice

[0215] Most SMA patients have impaired respiratory function and are dependent on external respiratory support. To evaluate the effect of DG9-PMO treatment on respiratory function, we performed whole-body plethysmograph recordings at PD7 under normoxic (21% O2) and hypoxic (11% O2) conditions ( Fig.11 a). Under normoxic conditions, Het mice showed no respiratory phenotype. On the other hand, NT mice breathed slowly and irregularly, as indicated by a high frequency coefficient of variation (CoV, a measure of relative variability) and prominent apneas (absence of airflow / pressure changes for periods equivalent to or greater than two complete respiratory cycles) ( Fig.11 b, f). Half of the unconjugated PMO mice (n=14) showed the parameters shown in NT mice compared to NT controls, while the other half, similar to Het, showed increases in respiratory rate (fR, breaths per minute), minute ventilation (VE), and tidal volume (VT, the amount of air flowing into or out of the lungs per respiratory cycle) ( Fig.11 b, d). Under the same normoxic conditions, most DG9-PMO (n=11) and MOE (n=10) treated mice did not show any respiratory phenotype and were similar to Het ( Fig.11 bf).

[0216] When switched to hypoxia, Het, DG9-PMO, and MOE-treated mice showed increases in respiratory parameters—fR, VE, and VT—relative to normoxia ( Fig.11 bd). Although hypoxia reduced the number of apneas, breathing remained slow and irregular, as indicated by high CoV in NT mice ( Fig.11 e). Most respiratory parameters of unconjugated PMO neonates increased relative to normoxia compared to NT mice, with no effect on apnea, but their breathing remained slow, weak, and irregular compared to Het ( Fig.11 The association between the severity of respiratory phenotype (reduced fR or VE) and weight loss was examined by using the Pearson product-moment correlation t test ( Fig.11 g). We did not observe a correlation between fR and body weight in Het, but found a strong correlation in NT and treated mice (grouped as homozygotes). DG9-PMO treatment improved respiratory dysfunction in SMA mice by reducing CoV and significantly improving respiratory parameters.

[0217] DG9-PMO treatment improves muscle pathology and neuromuscular junction (NMJ) characteristics in SMA mice.

[0218] Atrophic muscle tissue is a typical feature of SMA, with a decrease in skeletal muscle fiber size. To determine the effect of treatment on muscle pathology, we evaluated the physiology and structure of myofibers in two affected muscle groups (quadriceps and intercostal muscles) and, to a lesser extent, the diaphragm at PD7 and PD30 [79,80]. We quantified the cross-sectional area (CSA), minimum feret diameter, and centrally nucleated fibers in at least 500 myofibers per muscle for each treatment using hematoxylin and eosin (H&E) staining at PD7 and PD30. Fig.12 a, b, Figures 19 and 20).

[0219] At PD7, the feret diameter and CSA of myofibers in all three muscle groups were significantly increased after DG9-PMO treatment compared with NT controls ( Fig.12 b, Figure 19). In the quadriceps, there was no significant difference in muscle fiber size between Het and DG9-PMO treatments. On the other hand, unconjugated PMO and MOE quadriceps muscle fibers were significantly smaller than DG9-PMO. In the diaphragm and intercostal muscles, all three treatment groups showed similar muscle fiber size ( Fig.12 b, Figure 19). In addition, DG9-PMO treatment did lead to a significant decrease in the percentage of centrally nucleated fibers, indicating myofiber degeneration in atrophic myofibers. ( Fig.12 c). The effect of DG9-PMO persisted at PD30 (Figure 20). Unconjugated PMO and MOE treated mice had significantly smaller muscle fibers and a higher percentage of central nuclei in all three tissue types compared to DG9-PMO (Figure 20c).

[0220] SMA mice typically begin to show neuropathological defects around PD4-PD5, and as the disease progresses, neuromuscular junction (NMJ) denervation and collapse

[37] . We evaluated the NMJ structure of the quadriceps and intercostal muscles at PD30 to understand the phenotypic rescue after our injection at PD0 ( Fig.13 a). DG9-PMO treatment restored NMJ integrity, increased endplate size, reduced denervation, and exhibited a similar innervation pattern to Het ( Fig.13 ac). Peripheral synapses in DG9-PMO treated muscles showed more than 60% complete innervation, while unconjugated PMO and MOE treatments approached 40-50% innervation ( Fig.13 b). Unconjugated PMO treated mice exhibited smaller end plates and collapsed vesicles, especially in the intercostal muscles ( Fig.11 c). These data suggest that DG9-PMO treatment improves NMJ phenotypes in SMA mice. These findings confirm our hypothesis that DG9-PMO treatment rescues the crosstalk between muscle and neurons by improving muscle pathology and features at the NMJ.

[0221] DG9 peptide increases systemic and CNS tissue uptake of PMO following a single subcutaneous administration

[0222] To determine the role of the DG9 peptide in increasing PMO uptake, we evaluated the biodistribution of unconjugated PMO and DG9-PMO in peripheral and CNS tissues

[82] . We used a well-established hybridization-based ELISA assay specifically designed to detect PMO to compare the concentrations of DG9-PMO and unconjugated PMO in tissues of treated PD7 mice

[82] . Conjugation of DG9 to PMO resulted in significantly higher uptake in most tissues except the liver, with mean AO detection of 12202 pM (quadriceps, (n=5)), 2x10 8 pM (liver (n=5)), 8359pM (brain (n=5)), 13907pM (spinal cord (n=4)), 8886pM (heart (n=4)), and 2x10 7 pM (kidney (n=6)) Fig.14 a). Both unconjugated PMO and DG9-PMO showed higher levels in the liver and kidney, which are responsible for the metabolism and clearance of PMO.

[0223] PMO uptake is mediated by a caveolin-dependent pathway in myotubes

[83] . Some CPP-PMOs are often trapped in endosomes, limiting the efficiency of splicing correction

[84] . To demonstrate the intracellular localization of DG9-PMO, we attached a fluorescent tag to DG9-PMO. SMA mice received subcutaneous injections (40 mg / kg) at PD0, and immunohistochemistry (IHC) was performed to examine the localization of DG9-PMO in frozen tissue sections collected at PD7. Some DG9-PMOs were localized in the nuclei of the heart and quadriceps muscles, and to a lesser extent in CNS tissues ( Fig.14 b) This experiment demonstrated that DG9 promoted PMO uptake into peripheral and CNS tissues after a single subcutaneous administration, leading to an overall increase in SMN levels and an improvement in the SMA phenotype.

[0224] DG9-PMO penetrates the blood-brain barrier in a mild SMA model

[0225] To investigate whether DG9-PMO can cross the fully developed BBB, the milder SMA model (F0) (Smn - / - SMN2 + / +These mice have a normal lifespan, typically only developing tail and ear necrosis around 8-12 weeks of age. Tissues were harvested at PD7. First, we observed localization of fluorescently labeled DG9-PMO in the nuclei of peripheral and CNS tissues ( Fig.15 a). This supports our hypothesis that DG9-PMO can penetrate the BBB. ELISA was performed to obtain the biodistribution of unconjugated PMO and DG9-PMO. Despite subcutaneous administration at PD5, DG9 significantly increased the absorption of PMO in both CNS and peripheral tissues ( Fig.15 b). Finally, FL-SMN2 levels normalized to saline-injected mice (NT controls) were analyzed and an increase in FL-SMN2 expression in the spinal cord and other peripheral tissues was observed ( Fig.15 c) These findings suggest that DG9-PMO can penetrate the fully developed BBB and ensure widespread distribution of AO to peripheral and CNS tissues.

[0226] DG9-PMO treatment rescues SMA phenotype without overt toxicity

[0227] Peptides can often act as antigens, leading to immune responses. Therefore, we observed CD68 positive cells (CD68 + ) to examine the susceptibility of DG9-PMO to induce immune activation in the early neonatal period, CD68 + Circulating and tissue macrophages in quadriceps sections at PD7 indicated ( Fig.21 a) Due to the atrophic muscle tissue in SMA, NT control mice show CD68 + Increased levels of macrophages.

[0228] Unconjugated PMO and MOE treated muscles had significantly higher numbers of CD68 compared to Het + macrophages, while there was no significant difference between NT and DG9-PMO mice ( Fig.21 a) The apparent reduction in circulating macrophages after DG9-PMO treatment may be due to improvements in atrophic muscle tissue, which would compensate for any increase induced by the treatment itself.

[0229] To further elucidate the possibility of long-term toxicity, sera from Het and treated mice were collected at PD 30-35. Toxicological evaluation was performed with levels of alkaline phosphatase (ALP), alanine aminotransferase (ALT), aspartate aminotransferase (AST), creatine kinase (CK), creatinine, total bilirubin, total protein, albumin, globulin, and gamma-glutamyltransferase (GGT). All parameters examined were comparable between groups, indicating no significant toxic effects ( Fig.21 b). We also performed qualitative histological analysis of the liver and kidneys and found no observable signs of toxicity ( Fig.21 c) These findings emphasize that DG9-PMO is not associated with overt toxicity and immune dysfunction in mice.

[0230] discuss

[0231] Duplication and mutation of the telomeric SMN1 gene leads to the formation of its centromeric SMN2 paralog, which differs in only a few nucleotides.

[85] Since SMN2 can produce small amounts of functional SMN, it is a viable target for the treatment of SMA patients. The SMN1 gene is mutated in 95% of SMA patients, making the SMN2 gene a candidate for AO treatment of nearly all SMA patients.

[0232] We deployed CPPs conjugated to AO (PMO) because some of the studied CPPs can deliver biological cargo into cells and can also cross the BBB [86, 73]. Some peptides have also shown neuroprotective effects, minimizing the risk of toxicity and side effects, making them suitable for clinical application

[87] . As nusinersen still has some issues, SMA treatment still needs a therapy that addresses invasive administration, immune response, toxicity, and other adverse events.

[0233] In this study, we evaluated the efficacy of a novel peptide, DG9, which was identified after screening several peptides in a zebrafish model system

[75] . To overcome the invasive intrathecal injection and ensure systemic restoration of SMN protein, we subcutaneously injected 40 mg / kg of DG9-PMO, unconjugated PMO, MOE, or saline into newborn SMA mice at PD 0. DG9-PMO treatment significantly prolonged survival and increased body weight, FL-SMN2 expression, and SMN levels in peripheral and CNS tissues.

[0234] Newborn and adult mice treated with DG9-PMO showed significant improvements in muscle strength and coordination, as well as significant improvements in functional tests. We also observed that when a higher dose of 80 mg / kg AO was administered to mice, survival and FL-SMN2 expression increased in a dose-dependent manner, and DG9-PMO-treated mice maintained the improvements in motor function even at PD60.

[0235] The DG9 peptide resulted in sustained delivery of PMO to skeletal and respiratory muscles, which in turn reduced the number of myofibers with central nuclei and increased myofiber size. At PD30, myofibers in the intercostal and quadriceps muscles of unconjugated PMO mice were significantly smaller, suggesting the possibility of impaired breathing, with myofiber atrophy as a cause of early mortality. Although born normal, SMA mice begin to exhibit decreased respiratory rate and increased apnea frequency at PD7, which is generally due to weakening of the inspiratory and expiratory muscles

[88] . Our plethysmograph recordings at PD7 under normoxic and hypoxic conditions showed that NT SMA mice had weak, slow, and irregular breathing. We did not perform statistics to compare treatments individually, but compared with Het, half of the PMO mice exhibited a severe respiratory phenotype with irregular breathing and apnea, whereas the majority of MOE mice exhibited normal respiratory function. The variability in results, particularly in unconjugated PMO mice, suggests a deeper understanding of the respiratory dysfunction in SMA that leads to their sudden death. Under normoxic and hypoxic conditions, DG9-PMO mice had similar respiratory outcomes to Het mice and significantly better respiratory outcomes than NTPD7 mice. These findings provide evidence for the effectiveness of DG9-PMO in rescuing early respiratory dysfunction in SMA mice.

[0236] At PD30, DG9-PMO mice showed improved NMJ structure, with less collapsed structures and increased innervation patterns. On the other hand, unconjugated PMO mice had a greater number of denervated endplates and collapsed NMJs, indicating a distinct SMA phenotype. NMJ and motor neuron development go hand in hand, although this link has not been firmly established. NMJ defects are an early pathology in motor neuron disease and require SMN for proper innervation [81, 89, 90]. Our treatment improved NMJ innervation, which was inversely correlated with muscle atrophy

[94] , resulting in better performance in functional tests.

[0237] The uptake of PMO into peripheral and CNS tissues was significantly higher when conjugated to the DG9 peptide compared to unconjugated PMO alone, providing evidence that the peptide ensures widespread distribution of AO to the brain and spinal cord. Since the median survival of our mouse model is only 8 days, the exact effect of treatment during the late symptomatic phase cannot be fully elucidated. To demonstrate the ability of DG9 to penetrate the fully developed BBB in mice, we used a milder model with a normal lifespan (Smn - / - ;SMN2 Tg / Tg). We observed robust uptake of PMO and localization of DG9 peptide in CNS tissues after a single subcutaneous injection at PD5. However, from a therapeutic point of view, it will be necessary to confirm our findings in detail in other mild SMA models with multiple copies of SMN2 that could serve as models for the treatment of patients with late-onset SMA types III-IV or symptomatic clinical stages I-II.

[0238] Toxicity associated with cationic peptide-conjugated PMOs generally develops within 24 hours of administration. Neonates receiving subcutaneous AO showed no apparent physiological differences. They were active and similar to healthy peers. We also quantified CD68 in quadriceps muscle at PD7. + This indicates that macrophages are activated during the immune response in vivo after AO administration. SMA mice suffer from immune dysregulation and have increased numbers of immune cells. + The cell numbers were similar, but we believe that the concurrent improvement in muscle pathology and atrophic muscle reduced the total number of circulating macrophages, despite the potential for an immune response induced by DG9-PMO treatment. Based on serum and histological analysis at PD30, no overt toxicity was observed in the liver or kidney.

[0239] Materials and methods

[0240] Synthesis of DG9-PMO

[0241] DG9 (sequence N-YArVRRrGPRGYArVRRrGPRr-C; uppercase: L-amino acid, lowercase: D-amino acid) was synthesized and covalently conjugated to the 3' end of PMO. PMO targeting ISS-N1 intron 7 (5'-TCACTTTCATAATGC TGG-3') was purchased from Gene Tools LLC. 2'MOE was purchased from Eurogentec North America, USA.

[0242] Animal models

[0243] All animal experiments were performed at the University of Alberta and approved by the University of Alberta Office of Research Ethics Animal Care and Use Committee. SMA transgenic mice (JAX Stock No. 005058FVB.Cg-Tg(SMN2)2HungSmn1 tm1Hung / J(Smn - / - ;SMN2 Tg / Tg ), also known as Chinese Taiwan mice, were purchased from Jackson Laboratory (Bar Harbor, Maine, USA). Smn1 heterozygous mice (Smn1 + / - ;SMN2 - / - ) and Smn1 Smn - / - ;SMN2Tg / Tg Homozygous mice were crossed to obtain SMA mice (Smn - / - ;SMN2 Tg / - ) or heterozygous healthy controls (Smn1 + / - ;SMN2 Tg / - ). SMA mice exhibit a severe dominant phenotype similar to that of SMA I patients. Mice were genotyped by PCR assay using genomic DNA isolated from tail biopsies using the Phire Tissue Direct PCR Kit (ThermoFisher) according to the manufacturer's instructions. DNA was amplified using the primers described in Table 5 under the condition mouse Smn: 98°C / 5min→98°C / 5s_58°C / 10_72°C / 10s×35 cycles→72°C / 1min.

[0244] deal with

[0245] Injections were performed using a 30-gauge Hamilton syringe. SMA neonates were injected subcutaneously with 40 or 80 mg / kg of AO at P0, while NT and heterozygous control mice were injected with saline per group (n=10-25). Tissues including quadriceps, liver, kidney, spleen, diaphragm, intercostal muscles, heart, brain, and spinal cord were collected, snap-frozen in dry ice-cooled isopentane, and then stored at -80°C.

[0246] Real-time quantitative PCR (RT-qPCR)

[0247] Frozen tissues harvested at P7 were cut into 20 μm sections using a cryostat (Leica CM 1950, Leica). RNA was extracted from these sections using TRIzol 10 reagent (Invitrogen). cDNA was synthesized from 50 ng / μl RNA using superscript IV reverse transcriptase (ThermoFisher) and oligo (dT) primers (ThermoFFisher) according to the manufacturer's instructions. qPCR reactions were performed using SsoAdvanced Universal SYBR Green Supermix (BioRad) and QuantStudio3 real-time PCR system (Applied Biosystems). The relative gene expression of full-length SMN2 relative to the deletion SMN2 transcript without exon 7 was normalized to the NT control sample and analyzed using the ΔΔCt method.

[0248] Western blotting

[0249] Total protein was extracted from frozen tissue harvested at P7 or P30 using RIPA buffer (Sigma) and complete mini protease inhibitor cocktail (Sigma) without EDTA. Protein concentration was quantified using Pierce BCA protein assay kit (ThermoFisher). For SDS-PAGE, 5-10 μg of protein per well was run at 150V for 60 minutes per well in NuPAGE Novex 4-12% Bis-Tris Midi protein gel (Life Technologies), and then semi-dry transfer was performed at 20V for 30 minutes. Polyvinylidene fluoride (PVDF) membranes were blocked overnight with 5% skim milk and 0.05% Tween20 in PBS (PBST). The membranes were incubated with mouse purified anti-SMN antibody (BD Biosciences) (1:10,000) for one hour at room temperature (RT) with stirring. The membranes were washed three times with PBST (10 minutes each wash) and incubated with HRP-conjugated goat anti-mouse (IgG H+L) for 1 hour at room temperature with stirring. The bands were detected using Amersham ECL Select Western Blot Detection Kit (GE Healthcare) and visualized by ChemiDoc Touch Imaging System (BioRad). For β-tubulin, the membrane was incubated with stripping buffer (15 g glycine, 1 g SDS, 10 ml Tween20 pH 2.2) at room temperature for 10 minutes, then washed twice in PBS (10 minutes each time), washed twice in tris buffered saline and 0.05% Tween20 (TBST) (5 minutes each time). Similar to the first antibody protocol, the membrane was subsequently blocked overnight and incubated with β-tubulin rabbit antibody (Abcam ab6046, 1:5000) for 1 hour at room temperature the next day. The second antibody used was goat anti-rabbit (IgG H+L) (BioRad, 1:10000) conjugated to HRP for tubulin. As previously mentioned, these bands were visualized.

[0250] Enzyme-linked immunosorbent assay (ELISA)

[0251] ELISA was performed as described previously [83, 96]. Briefly, proteins were extracted from frozen tissue sections (approximately 20 μm) using RIPA buffer (Sigma) and EDTA-free complete mini protease inhibitor cocktail (Sigma). Probes (Integrated DNA Technologies) were designed to be complementary to the PMO sequence and have a phosphorothioate backbone at the 5' and 3' ends. The 5' and 3' ends were labeled with digoxigenin and biotin, respectively. Tissue lysates (0.02 mg / ml protein concentration) were pretreated overnight at 37°C with 2.5 mg / mL trypsin containing 10 mM CaCl2 to digest the DG9 peptide. The probe was added to the sample and hybridized at 37°C for 30 minutes. After probe-PMO hybridization, the hybridized samples were added to Pierce NeutrAvidin-coated 96-well plates, black (Thermo Fisher Scientific) to allow avidin-biotin interactions between the plate and the probe. Unhybridized probes were digested using 0.1 gel units / μl of micrococcal nuclease (New England Biolabs). Anti-digoxigenin antibody conjugated with alkaline phosphatase was then added (1:5000, Roche Applied Sciences). Attophos AP fluorescent substrate (Promega) was added to the PMO / DG9-PMO probe, and fluorescence was detected using a monochromator SpectraMax M3 plate reader (Molecular Devices) at 444 nm excitation and 555 nm emission.

[0252] Histology and immunohistochemistry

[0253] H and E staining

[0254] 7 μm cryosections of quadriceps, diaphragm, and intercostal muscles were stained with Meyer's H&E reagent (Electron Microscopy Reagents)

[97] . For central nucleated fibers and myofiber size, 500–800 fibers were randomly selected per muscle for each treatment. Cross-sectional area and minimum Feter diameter were quantified using Image J. All H and E analyses were performed in a blinded manner.

[0255] NMJ staining

[0256] NMJ staining was performed as described previously

[98] . Briefly, quadriceps and intercostal muscles were fixed in 4% paraformaldehyde (PFA) for 2 h. Muscles were quickly washed with PBS and blocked with 5% goat serum and 2% Triton-X in PBS for 1 h at room temperature. Muscles were then incubated with primary mouse monoclonal antibodies anti-neurofilament 2H3 (1:100) and anti-synaptophysin (1:500) (DSHB, Iowa) overnight at 4°C. Subsequently, muscles were incubated in the dark with Alexafluor 488-goat anti-mouse IgG1 (1:1000) (Life Technologies) and Alexafluor 594-bungarotoxin (1:5000) (ThermoFisherScientific). At least 300 NMJs were z-stacked and visualized using a confocal microscope (Zeiss LSM 710) and Zeiss Zen software to analyze denervation and cross-sectional area. Synaptic area was quantified using image J. All analyses were performed in a blinded manner.

[0257] Macrophage detection

[0258] 7 μm cryosections of quadriceps femoris were fixed with 4% PFA. Sections were incubated with rat anti-mouse CD68 antibody (Bio-Rad, MCA1957T). CD68 was detected in at least 5 sections per sample at random intervals at 20× magnification. + The cell numbers were counted and averaged.

[0259] Functional testing

[0260] Righting reflex test

[0261] The spontaneous ability of mice to right themselves was tested from P2 to weaning stage P20. The newborns were placed in a supine position, and the time required to reposition and place all four paws on the ground was recorded. The maximum recording time was 60 seconds. Each newborn received three trials with at least 10 minutes of rest between trials. Data are expressed as the mean time to complete the righting reflex test ± SEM.

[0262] Hindlimb hanging test (tube test)

[0263] The test was performed on newborn mice at P2-P12 as described in Treat NMD protocol SMA_M.2.2.001. Briefly, the hind limbs of newborn mice were suspended from a tube. They were scored based on the position of the hind limbs and their latency to fall was recorded with a cutoff time of 30 seconds. Each newborn pup received three trials with a 15-minute rest between trials. An observer who was blind to the test recorded the average score.

[0264] Forelimb grip strength

[0265] The assay was performed as described in Treat NMD protocol SMA_M.2.1.002. In brief, mice were placed on the metal grid of an automatic grip dynamometer (Columbus Instruments) so that only the forepaws grasped the metal grid. The mice were steadily pulled by the tail to completely detach from the grid. P30 and P60 mice were used. Each mouse was tested three times.

[0266] Rotarod test

[0267] P30-P40 mice were subjected to the rotarod test (AccuScan Instruments) as previously described, using a 300 s acceleration profile

[99] .

[0268] toxicology

[0269] Blood was collected from mice around P30-P40 during the autopsy (n=4-10 per group). The blood was placed at room temperature for 30 minutes and centrifuged at 2000 rcf. The resulting supernatant (serum) was transferred to a new 1.5 ml tube and stored at -20°C. Serum samples were analyzed by Idexxx Bioanalytics. A panel of standard toxicity markers was evaluated: glucose, total bilirubin, blood urea nitrogen (BUN), creatine kinase (CK), creatinine, alkaline phosphatase (ALP), alanine aminotransferase (ALT), aspartate aminotransferase (AST), gamma-glutamyl transferase (GGT), globulin, albumin, and total protein.

[0270] Whole body plethysmograph recording

[0271] Measurements were performed in a whole-body cylindrical transparent plexiglass plethysmograph with one inlet and two outlets for continuous delivery of fresh room air and removal of exhaled carbon dioxide [100, 101]. The plethysmograph volumes used to measure respiratory parameters were 10 ml (for P7 mice weighing less than 2.5 g, inner diameter: 1.9 cm, length: 3.5 cm), 30 ml (for P7 mice weighing more than 2.5 g, inner diameter: 2.6 cm, length: 5.6 cm), and 80 ml (for P30, inner diameter: 3.8 cm, length: 7 cm), with flow rates of 15, 45, and 120 ml / min, respectively. Gases were mixed by a gas mixer (GSM-3, CWEInC, USA), delivered from compressed pure oxygen and pure nitrogen tanks, and monitored using a 0-200 ml / min gas regulator (Porter Instrument Company, USA).

[0272] Hypoxia challenge (11% oxygen for 5 min) was performed by switching the inflow gas from normoxia (21% oxygen, balanced by nitrogen) to hypoxia (11% oxygen, balanced by nitrogen) and continuously monitoring the plethysmograph recording without physical handling of the animals. The gas exchange took approximately 1 min to complete and was confirmed by a gas analyzer (Model: ML206, ADInstruments). For P7, the plethysmograph was placed in an infant incubator (Isolette, Model C-86; Air-Shields / Medical, USA) to maintain the ambient temperature at a nest temperature of about 32°C. For P30, the plethysmograph was recorded at room temperature of about 22°C. Pressure changes were detected using a pressure sensor (model DP 103; Validyne, USA) and a signal conditioner (CD-15; Validyne), and recorded with data acquisition software (Axoscope) through an analog digital board (Digidata 1322A). The signal was high-pass filtered (0.01kHz) and the sampling rate was 1kHz. Respiratory rate and tidal volume (VT) were measured using Labchart 8 (ADInstruments Inc., USA) under blood pressure settings. The threshold level of the burst was set, and the burst was then automatically detected to obtain the frequency (calculated based on the cycle duration) and tidal volume (calculated based on the maximum pressure minus the minimum pressure).

[0273] Of note, our plethysmograph is effective for studying respiratory rate (fR) and detecting apnea. Apnea is defined as the absence of airflow (pressure changes) for a period equivalent to or greater than two complete respiratory cycles. Our whole-body plethysmograph system provides semiquantitative measures of tidal volume (VT, mL / g) and minute ventilation, from which we report changes relative to wild-type normoxia (Ren et al., 2009, 2015). The frequency coefficient of variation (a measure of relative variability) is the ratio of the standard deviation to the mean (average). The smaller the ratio, the more regular the breathing. Experiments were performed between 10 AM and 5 PM. After the experiments, the animals were returned to the animal facility.

[0274] Respiratory parameters were calculated during continuous plethysmographic recordings averaged over 1 minute. Respiratory parameters VT and VE are reported relative to the mean value of heterozygotes under normoxia (100%). The nature of the hypothesis tests was two-tailed. We first performed normality tests (Shapiro-Wilk) and tests of equal variance (Brown-Forsythe).

[0275] For data that pass both tests ( Figure 6BE: fR, VT, VE, and CV), using parametric statistics and two-way repeated measures analysis of variance (ANOVA) followed by the Holm-Sidak method (two factors: different treatments and different conditions). p < 0.05 was considered statistically significant; n refers to the number of animals, and the animal was the unit of analysis for statistical tests. For those data that did not pass the normality test or the test for equal variance (total apnea duration, Figure 6 F), nonparametric statistics were applied. Comparisons of differences in normoxia or hypoxia were performed using Kruskal-Wallis one-way ANOVA on ranks followed by Dunn's method. Differences between hypoxia and normoxia were performed using signed-rank tests. To examine whether the severity of the respiratory phenotype (reduction in respiratory rate or VE) was associated with weight loss, we used Pearson product-moment correlation t-tests ( Figure 6 G) For whole body plethysmography recordings, data were expressed as mean ± SD, or first interquartile range 25%, median 50% and third interquartile range 75% (Sigmaplot 11 Systat Software Inc., USA).

[0276] Statistical analysis

[0277] All statistical analyses of all data (except respiration analysis) were performed using GraphPad Prism 9 software. One-way ANOVA and Tukey's test were used for multiple comparisons, or long-rank Mantel-Cox test was used for survival analysis, as appropriate. No statistical power calculations were performed prior to the study. Sample size was based on our previous experience with these experimental protocols.

[0278] Table 5: List of primers used in this study

[0279]

[0280] References

[0281] 1.Hoffman EP, Brown RH, Kunkel LM (1987) Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell 51(6):919-928.

[0282] 2.Petrof BJ,Shrager JB,Stedman HH,Kelly AM,Sweeney HL(1993)Dystrophinprotects the sarcolemma from stresses developed during musclecontraction.Proc Natl Acad Sci U S A 90(8):3710-3714.

[0283] 3.Manzur A,Kinali M,Muntoni F(2008)Update on the management ofDuchenne muscular dystrophy.Arch Dis Child 93(11):986-990.

[0284] 4.Crisafulli S,et al.(2020)Global epidemiology of Duchenne musculardystrophy:an

[0285] updated systematic review and meta-analysis.Orphanet J Rare Dis 15(1):141.

[0286] 5.Bladen CL,et al.(2015)The TREAT-NMD DMD Global Database:Analysis ofMore than 7,000 Duchenne Muscular Dystrophy Mutations.Hum Mutat 36(4):395-402.

[0287] 6.Monaco AP,Bertelson CJ,Liechti-Gallati S,Moser H,Kunkel LM(1988)Anexplanation for the phenotypic differences between patients bearing partialdeletions of the DMD locus.Genomics 2(1):90-95.

[0288] 7.Lim KRQKRQ,Maruyama R,Yokota T(2017)Eteplirsen in the treatment ofDuchenne muscular dystrophy.Drug Des Devel Ther 11:533-545.

[0289] 8.Anwar S,Yokota T(2020)Golodirsen for Duchenne musculardystrophy.Drugs of Today 56(8):491-504.

[0290] 9.Roshmi,R R,Yokota T(2019)Viltolarsen for the treatment of Duchennemuscular dystrophy.Drugs of Today 55(10):627.

[0291] 10.Shirley M(2021)Casimersen:First Approval.Drugs.doi:10.1007 / s40265-021-01512-2.

[0292] 11.Aartsma-Rus A,et al.(2009)Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations.Hum Mutat 30(3):293-299.

[0293] 12.Béroud C,et al.(2007)Multiexon skipping leading to an artificialDMD protein lacking amino acids from exons 45 through 55 could rescue up to63%of patients with Duchenne muscular dystrophy.Hum Mutat 28(2):196-202.

[0294] 13.Echigoya Y,et al.(2019)Exons 45-55 Skipping Using Mutation-Tailored Cocktails of Antisense Morpholinos in the DMD Gene.Mol Ther 27(11):2005-2017.

[0295] 14.Lim KRQ,Nguyen Q,Yokota T(2020)Genotype-Phenotype Correlations inDuchenne and Becker Muscular Dystrophy Patients from the CanadianNeuromuscular Disease Registry.J Pers Med 10(4):241.

[0296] 15.Nakamura A,et al.(2017)Comparison of the phenotypes of patientsharboring in-frame deletions starting at exon 45 in the Duchenne musculardystrophy gene indicates potential for the development of exon skippingtherapy.J Hum Genet 62(4):459-463.

[0297] 16.Aoki Y,et al.(2012)Bodywide skipping of exons 45-55 in dystrophicmdx52 mice by systemic antisense delivery.Proc Natl Acad Sci U S A 109(34):13763-13768.

[0298] 17.Echigoya Y,Mouly V,Garcia L,Yokota T,Duddy W(2015)In SilicoScreening Based on Predictive Algorithms as a Design Tool for Exon SkippingOligonucleotides in Duchenne Muscular Dystrophy.PLoS One 10(3):e0120058.

[0299] 18.Lim KRQ,et al.(2019)Efficacy of Multi-exon Skipping Treatment inDuchenne Muscular Dystrophy Dog Model Neonates.Mol Ther 27(1):76-86.

[0300] 19.Lehto T,et al.(2014)Cellular trafficking determines the exonskipping activity of Pip6a-PMO in mdx skeletal and cardiac musclecells.Nucleic Acids Res 42(5):3207-3217.

[0301] 20.Tsoumpra MK,et al.(2019)Peptide-conjugate antisense based splice-correction for Duchenne muscular dystrophy and other neuromusculardiseases.EBioMedicine 45:630-645.

[0302] 21.Kim J,Clark K,Barton C,Tanguay R,Moulton H(2018)A Novel ZebrafishModel for Assessing In Vivo Delivery of Morpholino Oligomers,pp 293-306.

[0303] 22.Veltrop M,et al.(2018)A dystrophic Duchenne mouse model fortesting human antisense oligonucleotides.PLoS One 13(2):e0193289.

[0304] 23.Yavas A,et al.(2020)Detailed genetic and functional analysis ofthe hDMDdel52 / mdx mouse model.PLoS One 15(12):e0244215.

[0305] 24.Sicinski P,et al.(1989)The molecular basis of muscular dystrophyin the mdx mouse:a point mutation.Science 244(4912):1578-1580.

[0306] 25.Suzuki H,et al.(2016)Endogenous Multiple Exon Skipping and Back-Splicing at the DMD Mutation Hotspot.Int J Mol Sci 17(10):1722.

[0307] 26.Echigoya Y,et al.(2017)Quantitative Antisense Screening andOptimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.MolTher.doi:10.1016 / j.ymthe.2017.07.014.

[0308] 27.Choi J-M,et al.(2006)Intranasal delivery of the cytoplasmic domainof CTLA-4using a novel protein transduction domain prevents allergicinflammation.Nat Med12(5):574-579.

[0309] 28.Lehto T,Ezzat K,Wood MJA,El Andaloussi S(2016)Peptides for nucleicacid delivery.Adv Drug Deliv Rev 106(Pt A):172-182.

[0310] 29.Moulton HM,Moulton JD(2010)Morpholinos and their peptideconjugates:Therapeutic promise and challenge for Duchenne musculardystrophy.Biochim Biophys Acta–Biomembr 1798(12):2296-2303.

[0311] 30.Wu RP,et al.(2007)Cell-penetrating peptides as transporters formorpholino oligomers:effects of amino acid composition on intracellulardelivery and cytotoxicity.Nucleic Acids Res 35(15):5182-5191.

[0312] 31.Aoki Y,et al.(2010)In-frame dystrophin following exon 51-skippingimproves muscle pathology and function in the exon 52-deficient mdx mouse.MolTher18(11):1995-2005.

[0313] 32.Aupy P,et al.(2020)Long-Term Efficacy of AAV9-U7snRNA-MediatedExon 51Skipping in mdx52 Mice.Mol Ther-Methods Clin Dev 17:1037-1047.

[0314] 33.McCourt JL,et al.(2015)In vitro stability of therapeuticallyrelevant,internally truncated dystrophins.Skelet Muscle 5(1):13.

[0315] 34.Spitali P,et al.(2013)DMD transcript imbalance determinesdystrophin levels.FASEB J 27(12):4909-4916.

[0316] 35.Anthony K,et al.(2014)Biochemical Characterization of PatientsWith In-Frame or Out-of-Frame DMD Deletions Pertinent to Exon 44 or 45Skipping.JAMA Neurol 71(1):32.

[0317] 36.van Putten M,et al.(2012)The Effects of Low Levels of Dystrophinon Mouse Muscle Function and Pathology.PLoS One 7(2):e31937.

[0318] 37.Kudoh H,et al.(2005)A new model mouse for Duchenne musculardystrophy produced by 2.4Mb deletion of dystrophin gene using Cre-loxPrecombination system.Biochem Biophys Res Commun 328(2):507-516.

[0319] 38.Aartsma-Rus A,van Putten M(2014)Assessing Functional Performancein the Mdx Mouse Model.J Vis Exp(85):51303.

[0320] 39.Lim KRQ,Yokota T(2018)Quantitative evaluation of exon skipping inimmortalized muscle cells in vitro.Exon Skipping and Inclusion Therapies:Methods and Protocols,eds Yokota T,Maruyama R Springer,New York),pp 127-140.

[0321] 40.Maruyama R,et al.(2017)Systemic Delivery of Morpholinos to SkipMultiple Exons in a Dog Model of Duchenne Muscular Dystrophy.Methods Mol Biol1565:201-213.

[0322] 41.Thanh LT,et al.(1995)Characterization of genetic deletions inbecker muscular dystrophy using monoclonal antibodies against a deletion-prone region of dystrophin.Am J Med Genet 58(2):177-186.

[0323] 42.Desgeorges T,et al.(2019)Open-CSAM,a new tool for semi-automatedanalysis of myofiber cross-sectional area in regenerating adult skeletalmuscle.Skelet Muscle 9(1):2.

[0324] 43.Landini G,Martinelli G,Piccinini F(2020)Colour deconvolution:stainunmixing in histological imaging.Bioinformatics:btaa847.

[0325] 44.Ruifrok AC,Johnston DA(2001)Quantification of histochemicalstaining by color deconvolution.Anal Quant Cytol Histol 23(4):291-299.

[0326] 45.Lunn MR,Wang CH(2008)Spinal muscular atrophy.Lancet 371

[0327] (9630):2120-2133.doi:10.1016 / S0140-6736(08)60921-6

[0328] 46.D'Amico A,Mercuri E,Tiziano FD et al.(2011)Spinal muscularatrophy.Orphanet J Rare Dis 6:71.doi:10.1186 / 1750-1172-6-71

[0329] 47.Lefebvre S,Burglen L,Reboullet S et al.(1995)Identification andcharacterization of a spinal muscular atrophy-determining gene.Cell 80(1):155-165.doi:10.1016 / 0092-8674(95)90460-3

[0330] 48.Monani UR,Lorson CL,Parsons DW et al.(1999)A single nucleotidedifference that alters splicing patterns distinguishes the SMA gene SMN1 fromthe copy gene SMN2.Hum Mol Genet 8(7):1177-1183.doi:10.1093 / hmg / 8.7.1177

[0331] 49.Schrank B,Gotz R,Gunnersen JM et al.(1997)Inactivation of thesurvival motor neuron gene,a candidate gene for human spinal muscularatrophy,leads to massive cell death in early mouse embryos.Proc Natl Acad SciU S A 94(18):9920-9925.doi:10.1073 / pnas.94.18.9920

[0332] 50.Schmutz J,Martin J,Terry A et al.(2004)The DNA sequence andcomparative analysis of human chromosome Nature 431(7006):268-274.doi:10.1038 / nature02919

[0333] 51.Vitte J,Fassier C,Tiziano FD et al.(2007)Refined characterizationof the expression and stability of the SMN gene products.Am J Pathol 171(4):1269-1280.doi:10.2353 / ajpath.2007.070399

[0334] 52.Singh NK SN,Androphy EJ,Singh RN(2006)Splicing of a critical exonof human Survival Motor Neuron is regulated by a unique silencer elementlocated in the last intron.Mol Cell Biol 26(4):13.doi:10.1128 / MCB.26.4.1333-1346.2006

[0335] 53.Sumner CJ,Crawford TO(2018)Two breakthrough gene-targetedtreatments for spinal muscular atrophy:challenges remain.J Clin Invest 128(8):3219-3227.doi:10.1172 / JCI121658

[0336] 54.Li Q(2020)Nusinersen as a Therapeutic Agent for Spinal MuscularAtrophy.Yonsei Med J 61(4):273-283.doi:10.3349 / ymj.2020.61.4.273

[0337] 55.Lorson CL,Hahnen E,Androphy EJ et al.(1999)A single nucleotide inthe SMN gene regulates splicing and is responsible for spinal muscularatrophy.Proc Natl Acad Sci U S A 96(11):6307-6311.doi:10.1073 / pnas.96.11.6307

[0338] 56.Campbell L,Potter A,Ignatius J et al.(1997)Genomic variation andgene conversion in spinal muscular atrophy:implications for disease processand clinical phenotype.Am J Hum Genet 61(1):40-50.doi:10.1086 / 513886

[0339] 57.Hua Y,Vickers TA,Okunola HL et al.(2008)Antisense masking of anhnRNP A1 / A2intronic splicing silencer corrects SMN2 splicing in transgenicmice.Am J Hum Genet 82(4):834-848.doi:10.1016 / j.ajhg.2008.01.014

[0340] 58.Hamilton G,Gillingwater TH(2013)Spinal muscular atrophy:goingbeyond the motor neuron.Trends Mol Med 19(1):40-50.doi:10.1016 / j.molmed.2012.11.002

[0341] 59.Nash LA,Burns JK,Chardon JW et al.(2016)Spinal Muscular Atrophy:More than a Disease of Motor Neurons?Curr Mol Med 16(9):779-792.doi:10.2174 / 1566524016666161128113338

[0342] 60.Deguise MO,De Repentigny Y,McFall E et al.(2017)Immunedysregulation may contribute to disease pathogenesis in spinal muscularatrophy mice.Hum Mol Genet 26(4):801-819.doi:10.1093 / hmg / ddw434

[0343] 61.Rudnik-Schoneborn S,Heller R,Berg C et al.(2008)Congenital heartdisease is a feature of severe infantile spinal muscular atrophy.J Med Genet45(10):635-638.doi:10.1136 / jmg.2008.057950

[0344] 62.Bevan AK,Hutchinson KR,Foust KD et al.(2010)Early heart failure inthe SMNDelta7 model of spinal muscular atrophy and correction by postnatalscAAV9-SMN delivery.Hum Mol Genet 19(20):3895-3905.doi:10.1093 / hmg / ddq300

[0345] 63.Heier CR,Satta R,Lutz C et al.(2010)Arrhythmia and cardiac defectsare a feature of spinal muscular atrophy model mice.Hum Mol Genet 19(20):3906-3918.doi:10.1093 / hmg / ddq330

[0346] 64.Kolb SJ,Kissel JT(2011)Spinal muscular atrophy:a timelyreview.Arch Neurol 68(8):979-984.doi:10.1001 / archneurol.2011.74

[0347] 65.Kim JK,Jha NN,Feng Z et al.(2020)Muscle-specific SMN reductionreveals motor neuron-independent disease in spinal muscular atrophy models.JClin Invest130(3):1271-1287.doi:10.1172 / JCI131989

[0348] 66.Lowery S,Oliver A(2008)Incidence of postdural puncture headacheand backache following diagnostic / therapeutic lumbar puncture using a 22Gcutting spinal needle,and after introduction of a 25G pencil point spinalneedle.Paediatr Anaesth 18(3):230-234.doi:10.1111 / j.1460-9592.2008.02414.x

[0349] 67.Hache M,Swoboda KJ,Sethna N et al.(2016)Intrathecal Injections inChildren With Spinal Muscular Atrophy:Nusinersen Clinical Trial Experience.JChild Neurol 31(7):899-906.doi:10.1177 / 0883073815627882

[0350] 68.Hoy SM(2019)Onasemnogene Abeparvovec:First Global Approval.Drugs79(11):1255-1262.doi:10.1007 / s40265-019-01162-5

[0351] 69.Van Alstyne M,Tattoli I,Delestree N et al.(2021)Gain of toxicfunction by long-term AAV9-mediated SMN overexpression in the sensorimotorcircuit.Nat Neurosci.doi:10.1038 / s41593-021-00827-3

[0352] 70.Singh RN,Ottesen EW,Singh NN(2020)The First Orally DeliverableSmall Molecule for the Treatment of Spinal Muscular Atrophy.NeurosciInsights15:2633105520973985.doi:10.1177 / 2633105520973985

[0353] 71.Dhillon S(2020)Risdiplam:First Approval.Drugs 80(17):1853-1858.doi:10.1007 / s40265-020-01410-z

[0354] 72.Ratni H,Ebeling M,Baird J et al.(2018)Discovery of Risdiplam,aSelecti ve Survival of Motor Neuron-2(SMN2)Gene Splicing Modifier for theTreatment o f Spinal Muscular Atrophy(SMA).J Med Chem 61(15):6501-6517.doi:10.1021 / acs.j medchem.8b00741

[0355] 73.Sheng L,Rigo F,Bennett CF et al.(2020)Comparison of the efficacyof MOE and PMO modifications of systemic antisense oligonucleotides in asevere SMA mouse model.Nucleic Acids Res 48(6):2853-2865.doi:10.1093 / nar / gkaa126

[0356] 74.Hammond SM,Hazell G,Shabanpoor F et al.(2016)Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinalmuscular atrophy.Proc Natl Acad Sci U S A 113(39):10962-10967.doi:10.1073 / pnas.1605731113

[0357] 75.Shabanpoor F,Hammond SM,Abendroth F et al.(2017)Identification ofa Peptide for Systemic Brain Delivery of a Morpholino Oligonucleotide inMouse Models of Spinal Muscular Atrophy.Nucleic Acid Ther 27(3):130-143.doi:10.1089 / nat.2016.0652

[0358] 76.Wesolowski D,Tae HS,Gandotra N et al.(2011)Basic peptide-morpholino oligomer conjugate that is very effective in killing bacteria bygene-specific and nonspecific modes.Proc Natl Acad Sci U S A 108(40):16582-16587.doi:10.1073 / pnas.1112561108

[0359] 77.Choi JM,Ahn MH,Chae WJ et al.(2006)Intranasal delivery of thecytoplasmic domain of CTLA-4 using a novel protein transduction domainprevents allergic inflammation.Nat Med 12(5):574-579.doi:10.1038 / nm1385

[0360] 78.Hsieh-Li HM,Chang JG,Jong YJ et al.(2000)A mouse model for spinalmuscular atrophy.Nat Genet 24(1):66-70.doi:10.1038 / 71709

[0361] 79.Gogliotti RG,Hammond SM,Lutz C et al.(2010)Molecular andphenotypic reassessment of an infrequently used mouse model for spinalmuscular atrophy.Biochem Biophys Res Commun 391(1):517-522.doi:10.1016 / j.bbrc.2009.11.090

[0362] 80.Nizzardo M,Simone C,Salani S et al.(2014)Effect of combinedsystemic and local morpholino treatment on the spinal muscular atrophy Delta7mouse model phenotype.Clin Ther 36(3):340-356 e345.doi:10.1016 / j.clinthera.2014.02.004

[0363] 81.Crawford TO,Pardo CA(1996)The neurobiology of childhood spinalmuscular atrophy.Neurobiol Dis 3(2):97-110.doi:10.1006 / nbdi.1996.0010

[0364] 82.Sumner CJ(2006)Therapeutics development for spinal muscularatrophy.NeuroRx3(2):235-245.doi:10.1016 / j.nurx.2006.01.010

[0365] 83.Burki U,Keane J,Blain A et al.(2015)Development and Application ofan Ultrasensitive Hybridization-Based ELISA Method for the Determination ofPeptide-Conjugated Phosphorodiamidate Morpholino Oligonucleotides.NucleicAcid Ther 25(5):275-

[0366] 284.doi:10.1089 / nat.2014.0528

[0367] 84.Miyatake S,Mizobe Y,Tsoumpra MK et al.(2019)Scavenger ReceptorClass A1Mediates Uptake of Morpholino Antisense Oligonucleotide intoDystrophic Skeletal Muscle.Mol Ther Nucleic Acids 14:520-535.doi:10.1016 / j.omtn.2019.01.008

[0368] 85.Gait MJ,Arzumanov AA,McClorey G et al.(2019)Cell-PenetratingPeptide Conjugates of Steric Blocking Oligonucleotides as Therapeutics forNeuromuscular Diseases from a Historical Perspective to Current Prospects ofTreatment.Nucleic Acid Ther 29(1):1-12.doi:10.1089 / nat.2018.0747

[0369] 86.Kariya S,Park GH,Maeno-Hikichi Y et al.(2008)Reduced SMN proteinimpairs maturation of the neuromuscular junctions in mouse models of spinalmuscular atrophy.Hum Mol Genet 17(16):2552-2569.doi:10.1093 / hmg / ddn156

[0370] 87.Rochette CF,Gilbert N,Simard LR(2001)SMN gene duplication and theemergence of the SMN2 gene occurred in distinct hominids:SMN2 is unique toHomo sapiens.Hum Genet 108(3):255-266

[0371] 88.Zou LL,Ma JL,Wang T et al.(2013)Cell-penetrating Peptide-mediatedtherapeutic molecule delivery into the central nervous system.CurrNeuropharmacol 11(2):197-208.doi:10.2174 / 1570159X11311020006

[0372] 89.Tsoumpra MK,Fukumoto S,Matsumoto T et al.(2019)Peptide-conjugateantisense based splice-correction for Duchenne muscular dystrophy and otherneuromuscular diseases.EBioMedicine 45:630-645.doi:10.1016 / j.ebiom.2019.06.036

[0373] 90.Meloni BP,Mastaglia FL,Knuckey NW(2020)Cationic Arginine-RichPeptides(CARPs):A Novel Class of Neuroprotective Agents With a MultimodalMechanism of Action.Front Neurol 11:108.doi:10.3389 / fneur.2020.00108

[0374] 91.Hua Y,Sahashi K,Rigo F et al.(2011)Peripheral SMN restoration isessential for long-term rescue of a severe spinal muscular atrophy mousemodel.Nature 478(7367):123-126.doi:10.1038 / nature10485

[0375] 92.Michaud M,Arnoux T,Bielli S et al.(2010)Neuromuscular defects andbreathing disorders in a new mouse model of spinal muscular atrophy.NeurobiolDis 38(1):125-135.doi:10.1016 / j.nbd.2010.01.006

[0376] 93.Hensel N,Kubinski S,Claus P(2020)The Need for SMN-IndependentTreatments of Spinal Muscular Atrophy(SMA)to Complement SMN-EnhancingDrugs.Front Neurol 11:45.doi:10.3389 / fneur.2020.00045

[0377] 94.Boido M,Vercelli A(2016)Neuromuscular Junctions as KeyContributors and Therapeutic Targets in Spinal Muscular Atrophy.FrontNeuroanat 10:6.doi:10.3389 / fnana.2016.00006

[0378] 95.Zhang Z,Pinto AM,Wan L et al.(2013)Dysregulation of synaptogenesisgenes antecedes motor neuron pathology in spinal muscular atrophy.Proc NatlAcad Sci U S A 110(48):19348-19353.doi:10.1073 / pnas.1319280110

[0379] 96.Echigoya Y,Nakamura A,Nagata T et al.(2017)Effects of systemicmultiexon skipping with peptide-conjugated morpholinos in the heart of a dogmodel of Duchenne muscular dystrophy.Proc Natl Acad Sci U S A 114(16):4213-4218.doi:10.1073 / pnas.1613203114

[0380] 97.Echigoya Y,Aoki Y,Miskew B et al.(2015)Long-term efficacy ofsystemic multiexon skipping targeting dystrophin exons 45-55with a cocktailof vivo-morpholinos in mdx52 mice.Mol Ther Nucleic Acids 4:e225.doi:10.1038 / mtna.2014.76

[0381] 98.Passini MA,Bu J,Roskelley EM et al.(2010)CNS-targeted gene therapy improves survival and motor function in a mouse model of spinal muscularatrophy.J Clin Invest 120(4):1253-1264.doi:10.1172 / JCI41615

[0382] 99.Donadon I,Bussani E,Riccardi F et al.(2019)Rescue of spinalmuscular atrophy mouse models with AAV9-Exon-specific U1 snRNA.Nucleic AcidsRes 47(14):7618-7632.doi:10.1093 / nar / gkz469

[0383] 100.Ren J,Ding

[0384] 101.Ren J,Ding

[0385] The embodiments described herein are intended to be exemplary. Those skilled in the art may make changes, modifications and variations to the specific embodiments. The scope of the claims should not be limited to the specific embodiments described herein, but should be interpreted in a manner consistent with the entire specification.

[0386] All publications, patents, and patent applications mentioned in this specification are indicative of the level of skill of those skilled in the art to which the invention pertains and are incorporated herein by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0387] The invention being thus described, it will be obvious that the invention may be varied in many ways. These variations are not to be regarded as a departure from the spirit and scope of the invention, and all such modifications obvious to one skilled in the art are intended to be included within the scope of the appended claims.

Claims

1. A conjugate comprising an antisense oligonucleotide capable of regulating exon splicing of pre-mRNA attached to a cell penetrating peptide (CPP), the cell penetrating peptide comprising the following amino acid sequence: YArVRRrGPRGYArVRRrGPRr; Uppercase: L-amino acid, lowercase: D-amino acid.

2. The conjugate of claim 1, wherein the antisense oligonucleotide is capable of regulating exon splicing of human dystrophin pre-mRNA or SMN2 pre-mRNA.

3. A conjugate comprising an antisense oligonucleotide capable of inducing exon skipping in human dystrophin covalently attached to a cell penetrating peptide (CPP), the cell penetrating peptide comprising the following amino acid sequence: YArVRRrGPRGYArVRRrGPRr; Uppercase: L-amino acid, lowercase: D-amino acid.

4. The conjugate of claim 3, wherein the antisense oligonucleotide binds to a target in exon 44, exon 45, exon 46, exon 47, exon 48, exon 49, exon 50, exon 51, exon 52, exon 53, exon 54 and / or exon 55 of human dystrophin pre-mRNA.

5. The conjugate of claim 3, wherein the antisense oligonucleotide comprises or consists of any one of the following oligonucleotides: 5′-AAAACGCCGCCATTTCTCAACAGATCTGTC-3′, 5′-GACAACAGTTTGCCGCTGCCCAAATGCCATC-3′, 5′-AGTTGCTGCTCTTTTCCAGGTTCAAGTGGG-3′, 5′-GTTTGAGAATTCCCTGGCCGCAGGGGCAACT-3′, 5′-CAATTTCTCCTTGTTTCTCAGGTAAAGCTC-3′, 5′-CAGATGATTTAACTGCTCTTCAAGGTCTTC-3′, 5′-ATCTCTTCCACATCCGGTTGTTTAGCTTGA-3′, 5′-GTAAACGGTTTACCGCCTTCCACTCAGAGC-3′, 5′-GTGTCACCAGAGTAACAGTCTGAGTAGGAG-3′, 5′-GGTAATGAGTTCTCCAACTGGGGACGCCT-3′, 5′-CCTCCGGGTTCTGAAGGTGTTCTTGTACTTC-3′, 5′-GAGAAGTTTCAGGGCCAAGTCATTTGCCAC-3′ and 5′-TCTTCCAAAGCAGCCTCTCGCTCACTCACC-3′.

6. A composition comprising a first conjugate comprising a first antisense oligonucleotide capable of inducing exon skipping in human dystrophin covalently attached to a cell penetrating peptide (CPP), the cell penetrating peptide comprising the following amino acid sequence: YArVRRrGPRGYArVRRrGPRr; Upper case: L-amino acid, lower case: D-amino acid, and a second conjugate comprising a second antisense oligonucleotide capable of inducing exon skipping in human dystrophin covalently attached to a cell penetrating peptide (CPP).

7. The composition of claim 6, further comprising at least one other conjugate comprising another antisense oligonucleotide capable of inducing exon skipping in human dystrophin covalently attached to a cell penetrating peptide (CPP).

8. A composition as described in claim 7, comprising a peptide-conjugated antisense oligonucleotide targeting exon 45, a peptide-conjugated antisense oligonucleotide targeting exon 46, a peptide-conjugated antisense oligonucleotide targeting exon 47, a peptide-conjugated antisense oligonucleotide targeting exon 48, a peptide-conjugated antisense oligonucleotide targeting exon 49, a peptide-conjugated antisense oligonucleotide targeting exon 50, a peptide-conjugated antisense oligonucleotide targeting exon 51, a peptide-conjugated antisense oligonucleotide targeting exon 52, a peptide-conjugated antisense oligonucleotide targeting exon 53, a peptide-conjugated antisense oligonucleotide targeting exon 54, and a peptide-conjugated antisense oligonucleotide targeting exon 55.

9. A composition as described in claim 7, comprising a peptide-conjugated antisense oligonucleotide targeting exon 45, a peptide-conjugated antisense oligonucleotide targeting exon 47, a peptide-conjugated antisense oligonucleotide targeting exon 49, a peptide-conjugated antisense oligonucleotide targeting exon 51, a peptide-conjugated antisense oligonucleotide targeting exon 53, and a peptide-conjugated antisense oligonucleotide targeting exon 55. 10 . The composition of claim 7 , comprising a peptide-conjugated antisense oligonucleotide targeting exon 45, a peptide-conjugated antisense oligonucleotide targeting exon 47, and a peptide-conjugated antisense oligonucleotide targeting exon 53.

11. The composition of claim 7, comprising: Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GACAACAGTTTGCCGCTGCCCAAATGCCATC-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-AGTTGCTGCTCTTTTCCAGGTTCAAGTGGG-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GTTTGAGAATTCCCTGGCCGCAGGGGCAACT-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-CAATTTCTCCTTGTTTCTCAGGTAAAGCTC-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-CAGATGATTTAACTGCTCTTCAAGGTCTTC-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-ATCTCTTCCACATCCGGTTGTTTAGCTTGA-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GTAAACGGTTTACCGCCTTCCACTCAGAGC-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GTGTCACCAGAGTAACAGTCTGAGTAGGAG-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GGTAATGAGTTCTCCAACTGGGGACGCCT-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-CCTCCGGGTTCTGAAGGTGTTCTTGTACTTC-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GAGAAGTTTCAGGGCCAAGTCATTTGCCAC-3′ and Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-TCTTCCAAAGCAGCCTCTCGCTCACTCACC-3′; wherein one or more thymines in the sequence are optionally replaced by uracil.

12. The composition of claim 7, comprising: Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GACAACAGTTTGCCGCTGCCCAAATGCCATC-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GTTTGAGAATTCCCTGGCCGCAGGGGCAACT-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-ATCTCTTCCACATCCGGTTGTTTAGCTTGA-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GTGTCACCAGAGTAACAGTCTGAGTAGGAG-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-CCTCCGGGTTCTGAAGGTGTTCTTGTACTTC-3′ and Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-TCTTCCAAAGCAGCCTCTCGCTCACTCACC-3′; wherein one or more thymines in the sequence are optionally replaced by uracil.

13. The composition of claim 7, comprising: Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GACAACAGTTTGCCGCTGCCCAAATGCCATC-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GTTTGAGAATTCCCTGGCCGCAGGGGCAACT-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-ATCTCTTCCACATCCGGTTGTTTAGCTTGA-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-CCTCCGGGTTCTGAAGGTGTTCTTGTACTTC-3′ and Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-TCTTCCAAAGCAGCCTCTCGCTCACTCACC-3′; wherein one or more thymines in the sequence are optionally replaced by uracil.

14. The composition of claim 7, comprising: Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GACAACAGTTTGCCGCTGCCCAAATGCCATC-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-ATCTCTTCCACATCCGGTTGTTTAGCTTGA-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GTAAACGGTTTACCGCCTTCCACTCAGAGC-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GGTAATGAGTTCTCCAACTGGGGACGCCT-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-CCTCCGGGTTCTGAAGGTGTTCTTGTACTTC-3′ and Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-TCTTCCAAAGCAGCCTCTCGCTCACTCACC-3′; wherein one or more thymines in the sequence are optionally replaced by uracil.

15. The composition of claim 7, comprising: Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GACAACAGTTTGCCGCTGCCCAAATGCCATC-3′, Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-GTAAACGGTTTACCGCCTTCCACTCAGAGC-3′ and Peptide-conjugated antisense oligonucleotides having the following sequence: 5′-TCTTCCAAAGCAGCCTCTCGCTCACTCACC-3′; wherein one or more thymines in the sequence are optionally replaced by uracil.

16. A pharmaceutical composition comprising the peptide conjugate according to any one of claims 1 to 5 or the composition according to claims 6 to 15, and a pharmaceutically acceptable excipient.

17. A method of treating a subject suffering from DMD, comprising: Administering a therapeutically effective amount of the peptide conjugate of any one of claims 1 to 5 or the composition of claims 6 to 15.

18. The method of claim 17, wherein the subject is a human.

19. A conjugate comprising an antisense oligonucleotide capable of inducing exon inclusion in the human SMN2 gene covalently attached to a cell penetrating peptide (CPP), the cell penetrating peptide comprising the following amino acid sequence: YArVRRrGPRGYArVRRrGPRr; Uppercase: L-amino acid, lowercase: D-amino acid.

20. The conjugate of claim 19, wherein the antisense binds to the intronic splicing silencer N1 of SMN2 pre-mRNA.

21. The conjugate of claim 19, wherein the antisense oligonucleotide comprises or consists of the sequence 5'-TCACTTTCATAATGCTGG-3', and wherein the thymine is optionally replaced by uracil.

22. The conjugate of any one of claims 19-21, wherein the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer.

23. A method of treating spinal muscular atrophy (SMA) in a subject, comprising: Administering a therapeutically effective amount of the conjugate of any one of claims 19-22.

Images