GsEXPA8 protein for regulating and controlling alkali resistance of plants as well as coding gene and application of GsEXPA8 protein

Abstract

The invention discloses a GsEXPA8 protein for regulating and controlling alkali resistance of plants as well as a coding gene and application of the GsEXPA8 protein. The protein provided by the invention is named as GsEXPA8 protein, and is a protein as shown in SEQ ID NO: 1. Nucleic acid molecules for coding the GsEXPA8 protein also belong to the protection range of the invention. The invention also protects application of the nucleic acid molecule for coding the GsEXPA8 protein in preparation of a transgenic plant with improved stress tolerance to alkali stress. The invention also provides a method for cultivating the plant with improved stress tolerance to alkali stress, and the method comprises the following steps: introducing nucleic acid molecules for coding the GsEXPA8 protein into a receptor plant to obtain a transgenic plant with improved stress tolerance to alkali stress. The method has important application and popularization values for alkali-resistant plant breeding, especially alkali-resistant soybean breeding.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a GsEXPA8 protein for regulating plant alkali resistance and a coding gene and application thereof. Background Art

[0003] The soil environment of saline-alkali land is one of the important factors restricting the planting area and yield of crops including soybeans. The barren land surface, which is mainly alkaline, makes it difficult for ordinary crops to grow, and the alkaline stress is mainly sodium bicarbonate.

[0004] Wild soybean has strong alkali resistance and can survive in saline-alkali land, so it is an important material for studying the mechanism of soybean alkali resistance. The alkali resistance signal transduction pathway of wild soybean is a hot topic of research at present. Summary of the invention

[0005] The purpose of the present invention is to provide a GsEXPA8 protein for regulating plant alkali resistance and a coding gene and application thereof.

[0006] The protein provided by the present invention, named GsEXPA8 protein, is as follows (a1) or (a2) or (a3) ​​or (a4) or (a5):

[0007] (a1) the protein shown in SEQ ID NO: 1;

[0008] (a2) the protein shown at positions 2-250 in SEQ ID NO: 1;

[0009] (a3) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1) or (a2);

[0010] (a4) a protein obtained by replacing and / or deleting and / or adding one or more amino acid residues of the protein described in (a1) or (a2) and related to the plant's tolerance to alkaline stress;

[0011] (a5) A protein derived from soybean, having 98% or more identity with the protein described in (a1) or (a2) and associated with plant tolerance to alkaline stress.

[0012] The tag may be a fluorescent protein tag, such as a GFP fluorescent protein tag.

[0013] The tag may also be a purification tag, such as the tags shown in Table 1.

[0014] Table 1 Tag sequences

[0015] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHQ c-myc 10 EQKLISEEDL

[0016] Nucleic acid molecules encoding GsEXPA8 protein also fall within the scope of protection of the present invention.

[0017] Specifically, the nucleic acid molecule may be a DNA molecule.

[0018] Specifically, the nucleic acid molecule is as follows (b1) or (b2) or (b3) or (b4):

[0019] (b1) a nucleic acid molecule whose coding region is shown in SEQ ID NO: 2;

[0020] (b2) a nucleic acid molecule whose coding region is shown in positions 4 to 750 of SEQ ID NO: 2;

[0021] (b3) a nucleic acid molecule derived from soybean and having 95% or more identity with (b1) or (b2) and encoding the protein;

[0022] (b4) A nucleic acid molecule that hybridizes to the nucleic acid sequence defined in (b1) or (b2) under stringent conditions and encodes the protein.

[0023] The expression cassette, recombinant vector or recombinant microorganism containing the nucleic acid molecule all fall within the protection scope of the present invention.

[0024] Specifically, the recombinant vector containing the nucleic acid molecule is shown in SEQ ID NO:3.

[0025] The present invention also protects the use of the GsEXPA8 protein in regulating the plant's tolerance to alkali stress.

[0026] The regulation is positive regulation, the abundance of GsEXPA8 protein increases, and the plant's tolerance to alkaline stress increases.

[0027] The present invention also protects the use of nucleic acid molecules encoding the GsEXPA8 protein in regulating the resistance of plants to alkali stress.

[0028] The regulation is positive regulation, the abundance of nucleic acid molecules encoding the GsEXPA8 protein increases, and the plant's tolerance to alkaline stress increases.

[0029] The present invention also protects the use of the GsEXPA8 protein in preparing plants with improved resistance to alkali stress.

[0030] The present invention also protects the use of nucleic acid molecules encoding the GsEXPA8 protein in preparing transgenic plants with improved resistance to alkali stress.

[0031] The present invention also protects the use of an expression box, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule in preparing a transgenic plant with improved resistance to alkali stress.

[0032] The present invention also provides a method for cultivating plants with improved resistance to alkaline stress, comprising the following steps: introducing a nucleic acid molecule encoding a GsEXPA8 protein into a recipient plant to obtain a transgenic plant with improved resistance to alkaline stress. Specifically, the nucleic acid molecule is introduced into the recipient plant via a recombinant plasmid. Specifically, the nucleic acid molecule is introduced into the recipient plant via a recombinant Agrobacterium containing a recombinant plasmid.

[0033] The present invention also provides a method for cultivating plants with improved resistance to alkali stress, comprising the following steps: increasing the content of GsEXPA8 protein in the plants to obtain plants with improved resistance to alkali stress.

[0034] The present invention also protects the use of any of the above methods in plant breeding. The goal of the plant breeding is to cultivate plants with improved tolerance to alkaline stress.

[0035] Any of the above-mentioned alkaline stresses may be saline-alkali stress.

[0036] Any of the above-mentioned alkaline stresses may be alkaline stress caused by NaHCO3.

[0037] Any of the above plants may be monocots or dicots.

[0038] Any of the above plants may be leguminous plants.

[0039] Any of the above plants may be a soybean plant, such as soybean Dongnong 50.

[0040] The invention has great application and promotion value for alkali-resistant plant breeding, especially alkali-resistant soybean breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 This is the relative abundance result of the target gene in step 1 of Example 1.

[0042] Figure 2 This is the relative abundance result of the target gene in step 2 of Example 1.

[0043] Figure 3 This is the result of western blot identification in Example 2.

[0044] Figure 4 This is a photograph of the morphological observation in Example 2.

[0045] Figure 5 The results of photosynthesis parameter measurement in Example 2 (Tr and Pn).

[0046] Figure 6 The results of photosynthesis parameter measurement in Example 2 (Gs and WUE).

[0047] Figure 7 The results of the physiological index measurements in Example 2 (POD and MDA).

[0048] Figure 8 This is a photograph showing that the GsEXPA8 gene in Example 3 is localized in the cytoplasm of Arabidopsis protoplasts.

[0049] Fig. 9 This is a photo showing that the GsEXPA8 gene in Example 3 is localized in the cell membrane or cell wall of tobacco.

[0050] Fig.10 This is a photo of the root system after DAB staining in Example 4.

[0051] Fig.11 This is a photograph of the leaves in Example 4 after DAB staining.

[0052] Fig.12 It is the statistical result of main stem length and main root length in Example 4.

[0053] Fig.13 These are the statistical results of the number of connections, root nodes, root tips, bifurcations, and intersections of the root system in Example 4, as well as the statistical results of the average root diameter and root volume, and the statistical results of the total plant weight and root weight.

[0054] Fig.14 These are photos of the GFP signal distribution in wild-type and overexpressing soybean plants in Example 5.

[0055] Fig.15 The statistical results of the relative expression levels of the alkaline stress maker gene in Example 6 in WT and GsEXPA8 gene overexpressing plants. DETAILED DESCRIPTION

[0056] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0057] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. Unless otherwise specified, the quantitative tests in the following examples are all repeated three times, and the results are averaged. Unless otherwise specified, soybean cultivation is carried out in an artificial climate box (temperature 28°C, humidity 80%, 16h light / 8h dark). Wild soybeans, also called wild soybeans, have a Latin name of Glycinesoja. Dongnong 50, also known as DN50, is a soybean variety in the prior art. PAT / Bar GMO detection test paper: Aojin Biotechnology (Tianjin) Co., Ltd., product catalog number is AG-002-GSLF.

[0058] Example 1. Expression characteristics of GsEXPA8 gene

[0059] 1. Expression characteristics under alkaline stress

[0060] 1. Take wild soybean seeds, wash them with distilled water first, then soak and shake them with concentrated sulfuric acid for 2 times, then soak and shake them with distilled water for 5 times, and then culture them in the dark at 28℃ for 48h.

[0061] 2. After completing step 1, take the germinated seeds and culture them in 1 / 4 Hoagland culture medium with a pH of 5.8 for 21 days.

[0062] 3. After completing step 2, transfer the seedlings to 1 / 4 Hoagland culture medium containing 50 mM NaHCO3 and sample the root tips every 3 hours.

[0063] 4. Extract total RNA from the sample, reverse transcribe it into cDNA, and perform real-time quantitative PCR.

[0064] The target genes are GsEXPA1, GsEXPA6, GsEXPA8, GsEXPA9, GsEXPA10, GsEXPA11, GsEXPA12, GsEXPA15, GsEXPA20, and GsEXPA23. The internal reference gene is the GmACTIN4 gene.

[0065] The primer pairs used to detect each target gene and internal reference gene are shown in Table 2.

[0066] Table 2

[0067]

[0068]

[0069] The relative abundance results of target genes are shown in Figure 1The results showed that under alkaline stress, most of the Expansin family genes were up-regulated at 3h and 12h in response to alkaline stress. The GsEXPA8 gene was significantly up-regulated at 12h, indicating that the GsEXPA8 gene was involved in the alkaline stress regulation pathway.

[0070] 2. Expression characteristics after plant hormone treatment

[0071] The plant hormones tested were abscisic acid (ABA), auxin (IAA), gibberellin (GA) or jasmonic acid (JA).

[0072] 1. Take wild soybean seeds, wash them with distilled water first, then soak and shake them with concentrated sulfuric acid for 2 times, then soak and shake them with distilled water for 5 times, and then culture them in the dark at 28℃ for 48h.

[0073] 2. After completing step 1, take the germinated seeds and culture them in 1 / 4 Hoagland culture medium with a pH of 5.8 for 21 days.

[0074] 3. After completing step 2, transfer the seedlings to 1 / 4 Hoagland culture medium containing the test plant hormone and culture them. Sample the root tip at time 0 and after 12 hours of culture. When the test hormone is ABA, the working concentration is 15mM. When the test hormone is IAA, the working concentration is 5μM. When the test hormone is GA, the working concentration is 0.5μM. When the test hormone is JA, the working concentration is 10μM.

[0075] 4. Extract total RNA from the sample, reverse transcribe it into cDNA, and perform real-time quantitative PCR.

[0076] The target genes are GsEXPA6, GsEXPA8, GsEXPA9, GsEXPA12 and GsEXPA23. The internal reference gene is GmACTIN4. The primer pairs used to detect each target gene are shown in Table 2. The relative abundance of the target gene after 12 hours of culture relative to time 0 is shown in Figure 2 The results showed that except for GsEXPA6, GsEXPA8, GsEXPA9, GsEXPA12 and GsEXPA23 genes in the Expansin family all responded to ABA and IAA treatments. GsEXPA8 was significantly upregulated under ABA treatment, and its expression level was higher under IAA signal treatment. It is speculated that GsEXPA8 regulates root development through ABA and IAA pathways.

[0077] Example 2: Preparation of transgenic plants and identification of alkali resistance

[0078] 1. Construction of recombinant plasmid

[0079] The recombinant plasmid is a circular plasmid, and the full sequence of the plasmid is shown in SEQ ID NO: 3. In SEQ ID NO: 3, nucleotides 4410-5156 constitute the GsEXPA8 gene, and nucleotides 5157-5873 constitute the GFP gene, and the two genes are fused and expressed. In SEQ ID NO: 3, nucleotides 8929-9480 constitute the bar gene (template chain).

[0080] 2. Preparation of transgenic plants

[0081] 1. Preparation of explants

[0082] Take Dongnong 50 soybean seeds, culture them until they germinate, then cut off part of the hypocotyl, peel off the seed coat, separate the two cotyledons, clamp the cotyledon with the cotyledon node, remove the two true leaves, and make 1 to 2 cuts with the tip of the knife towards the growth point to obtain the explant.

[0083] 2. Prepare infection solution

[0084] The recombinant plasmid obtained in step 1 was introduced into Agrobacterium GV3101 to obtain recombinant Agrobacterium. After the recombinant Agrobacterium was propagated, the bacterial precipitate was collected and resuspended with a 10mmol / L MgCl2 aqueous solution, and then AS was added to a concentration of 200μmol / L. The solution was left to stand at room temperature for 3 hours to obtain the infection solution (OD 600nm value = 0.5).

[0085] 3. Infect the explants prepared in step 1 with the infection solution prepared in step 2, and perform co-cultivation, recovery culture, screening culture (using hygromycin for screening), elongation culture and rooting culture in sequence to obtain rooted regenerated plants, i.e., T0 generation plants.

[0086] 4. Take leaves from T0 generation plants, extract total protein, and then use PAT / Bar transgenic detection test paper for detection to screen plants that are positive for the Bar gene, which are TO generation transgenic plants.

[0087] 5. The TO generation transgenic plants are self-pollinated and the seeds obtained are the T1 generation seeds, and the plants grown from the T1 generation seeds are the T1 generation plants.

[0088] 6. Take leaves from the T1 generation plants, extract total protein, and then use PAT / Bar transgenic detection paper for detection. If the T1 generation plants obtained from a T0 generation transgenic plant are all Bar gene positive, the T0 generation transgenic plant is a homozygous transgenic plant, and its self-pollinated offspring is a homozygous transgenic strain. Five transgenic strains were obtained, named OE-1 strain, OE-2 strain, OE-3 strain, OE-4 strain and OE-5 strain respectively. Take leaves from the T1 generation plants of the five transgenic strains respectively, extract total protein, and perform western blot (the primary antibody used is GFP antibody). See photos. Figure 3 .

[0089] 7. The T1 generation plants of the transgenic strain are self-pollinated and the seeds obtained are the T2 generation seeds of the transgenic strain.

[0090] 3. Alkali stress treatment

[0091] Test soybean seeds: seeds of Dongnong 50 soybean plants (expressed as WT), T2 seeds of OE-1 line, T2 seeds of OE-2 line or T2 seeds of OE-5 line.

[0092] The test seeds were cultured in pots filled with soil, and the plants germinated for 25 days were divided into groups:

[0093] Alkali stress group (expressed by NaHCO3): watered once on the day of grouping and once every 3 days thereafter, with 1 L of 50 mM NaHCO3 aqueous solution (excess and seepage) per pot each time;

[0094] Normal control group (indicated by CK): watered once on the day of grouping and once every 3 days thereafter, with 1 L of water per pot each time (excess and seepage).

[0095] 4. Trait detection

[0096] 1. Morphological observation

[0097] The plants in the alkaline stress group were photographed before the alkaline stress treatment in step 3, 5 days after the stress treatment, and 15 days after the stress treatment. Figure 4 (The first row is before stress treatment, the second row is 5 days after stress treatment, and the third row is 15 days after stress treatment). Before stress treatment: WT plants and transgenic plants grew well with dark green leaves. 5 days after stress treatment: WT plants showed wilting, yellowing, curling, and shrinking leaves; transgenic plants only had some yellowing leaves, but still grew normally. 15 days after stress treatment: WT plants completely wilted, stems became thinner, leaves curled and wrinkled, and could not grow normally; some leaves of transgenic plants lost green, but most leaves were still able to photosynthesize.

[0098] 2. Determination of photosynthesis parameters

[0099] Photosynthetic parameters: transpiration rate (Tr), photosynthetic rate (Pn), stomatal conductance (Gs) and water use efficiency (WUE).

[0100] After 15 days of group treatment in step 3, the 4th to 5th functional leaves with uniform growth and good growth located at the lower side of the top of the plant were selected, and the photosynthetic parameters were measured using the American Li-6800 portable photosynthesis measurement system (measurement time: 10:00 am).

[0101] The results of transpiration rate and photosynthesis rate are shown in Figure 5 (Sample size N = 30). Normal control group: Compared with WT plants, the transpiration rate of transgenic plants increased, and the photosynthetic rate of transgenic plants increased significantly. Alkali stress group: Compared with WT plants, the transpiration rate of transgenic plants decreased significantly, and the photosynthetic rate of transgenic plants increased significantly.

[0102] The results of stomatal conductance and water use efficiency in the alkaline stress group are shown in Figure 6 (Sample size N = 30). Compared with WT plants, the stomatal conductance of transgenic plants was significantly reduced, and the water use efficiency of transgenic plants was significantly increased.

[0103] The above results show that overexpression of GsEXPA8 gene can directly improve the photosynthetic capacity of leaves. Under alkaline stress environment, transgenic plants improve water use efficiency by reducing transpiration rate and stomatal conductance, thereby improving alkaline tolerance.

[0104] 3. Determination of physiological indicators

[0105] After 15 days of group treatment in step 3, the root system was taken to measure the peroxidase (POD) content and malondialdehyde (MDA) content. The peroxidase content was detected using a kit and operated according to the instructions (peroxidase test kit: China Suzhou Mengxi Biomedical Technology Co., Ltd., product catalog number M0105A). The malondialdehyde content was detected using a kit and operated according to the instructions (malondialdehyde kit: China Suzhou Ge Ruisi Biotechnology Co., Ltd., product number G0109W).

[0106] Results Figure 7 (Sample size N = 30). Normal control group: Compared with WT plants, there was no significant difference in the MDA content of transgenic plants, and the POD content of transgenic plants was significantly increased. Alkali stress group: Compared with WT plants, the MDA content of transgenic plants was reduced, and there was no significant difference in the POD content of transgenic plants. It is speculated that the GsEXPA8 gene increases the POD activity of soybean plants under normal conditions and maintains cell membrane permeability under alkaline treatment conditions.

[0107] Example 3: Localization of the GsEXPA8 gene

[0108] 1. GsEXPA8 gene is localized in the cytoplasm of Arabidopsis protoplasts

[0109] Protoplasts were prepared from leaves of Arabidopsis thaliana seedlings of the Columbia ecotype, and then transfected with pEGOEP35S::GsEXPA8 subcellular localization vector or pEGOEP35S::GFP empty vector using PEG4000, and observed and photographed using a laser confocal microscope.

[0110] See the sample photos Figure 8 (Green fluorescent protein GFP: excitation wavelength 488nm; red fluorescent protein mCherry: excitation wavelength 561nm; chloroplast excitation wavelength: 640nm). In protoplasts, the pEGOEP35S::GFP empty vector is expressed in the nucleus and cytoplasm, showing ubiquitous expression. pEGOEP35S::GsEXPA8-GFP is dispersedly expressed in non-nuclear and non-membrane areas. The results show that when the cell has no cell wall, the GsEXPA8 gene is expressed in the cytoplasm.

[0111] 2. GsEXPA8 gene is located in the cell membrane or cell wall of tobacco

[0112] The pEGOEP35S::GsEXPA8 subcellular localization vector or the pEGOEP35S::GFP empty vector was introduced into Agrobacterium GV3101 to obtain recombinant Agrobacterium. After the recombinant Agrobacterium was propagated, the bacterial precipitate was collected and resuspended with a 10mmol / L MgCl2 aqueous solution, and then AS was added to a concentration of 200μmol / L, and the solution was left to stand at room temperature for 3h to obtain the infection solution. The 4-week-old Nicotiana benthamiana seedlings were transferred to dark culture for 1 day, and then the infection solution was injected into two of the leaves, and the infection solution was observed after 2 days of culture using a laser confocal microscope.

[0113] See the sample photos Fig. 9 pEGOEP35S::GFP is expressed in the nucleus, cell wall and cytoplasm, and pEGOEP35S::GsEXPA8-GFP is expressed in the cell membrane or nucleus. This indicates that the GsEXPA8 gene is localized from the cytoplasm to the cell membrane or cell wall when the cell has a cell wall. It is speculated that GsEXPA8 regulates root development by expanding the cell membrane or cell wall.

[0114] Example 4: Overexpression of the GsEXPA8 gene in soybean roots and determination of root morphology and physiological indicators

[0115] 1. Preparation of overexpression plants

[0116] The recombinant plasmid constructed in step 1 of Example 2 was introduced into Agrobacterium rhizogenes K599 to obtain recombinant Agrobacterium. The recombinant Agrobacterium was resuspended in liquid LB medium to OD 600nm The value is 0.8, which means it is recombinant Agrobacterium liquid.

[0117] Soybean Dongnong 50 seeds were cultured in a pot filled with soil, and the seeds germinated into seedlings. When the cotyledons of the seedlings were fully opened and the plant height was about 5 cm, the recombinant Agrobacterium solution was injected into the hypocotyl of the seedlings with a syringe (350 μL was injected per plant), and then cultured until hairy roots appeared at the injection site. This plant is an overexpression plant, denoted by OE.

[0118] 2. Preparation of control plants

[0119] Resuspend Agrobacterium rhizogenes K599 in liquid LB medium to OD 600nm The value is 0.8, which is Agrobacterium solution.

[0120] Soybean Dongnong 50 seeds were cultured in a pot filled with soil. The seeds germinated into seedlings. When the cotyledons of the seedlings were fully opened and the plant height was about 5 cm, the Agrobacterium solution was injected into the hypocotyl of the seedlings with a syringe (350 μL was injected per plant), and then cultured until hairy roots appeared at the injection site. This plant was the control plant, denoted by WT.

[0121] 3. Group Processing

[0122] After completing step 1 or step 2, cover the infected site and roots with vermiculite and allow them to absorb water. Continue to cultivate until the hairy roots are 4-8 cm long. Then, cut off the primary roots and bury them in the soil. Continue to cultivate for 15 days, and then divide them into groups and treat them as follows:

[0123] Alkali stress group (expressed by NaHCO3): watered once on the day of grouping and once every 3 days thereafter, with 1 L of 100 mM NaHCO3 aqueous solution (excess and seepage) per pot each time;

[0124] Normal control group (indicated by CK): watered once on the day of grouping and once every 3 days thereafter, with 1 L of water per pot each time (excess and seepage).

[0125] 4. Detection of phenotypes and traits

[0126] 1. After 15 days of group treatment in step 3, the roots of the plants in the alkaline stress group were taken for DAB staining. The photos after DAB staining are shown in Fig.10 Compared with WT plants, the overexpression plants (OE-1 and OE-2 are different overexpression plants) have thicker and more developed root systems.

[0127] 2. After 15 days of group treatment in step 3, the leaves were taken and DAB stained. The photos after DAB staining are shown in Fig.11 Under alkaline stress, the leaves of the overexpressing plants were lighter in color than those of the WT plants, indicating that the leaves of the transgenic plants were less damaged by alkaline stress.

[0128] 3. After 15 days of group treatment in step 3, the main stem length and main root length of the plants in the alkali stress group were counted. The statistical results are shown in Fig.12 (Sample size N = 30). There was no significant difference in stem length between WT plants and overexpression plants, and the root length of overexpression plants was significantly shorter than that of WT plants. The results showed that overexpression of GsEXPA8 caused the gene to shorten the root length of soybean plants.

[0129] 4. After 15 days of group treatment in step 3, the number of root connections, root nodes, root tips, bifurcations, and intersections of the plants in the alkali stress group were counted. The statistical results are shown in Fig.13 (Sample size N = 30). Compared with WT plants, the number of connections, root nodes, root tips, and chiasma in the overexpressing plants were significantly reduced, but there was no significant difference in the number of bifurcations.

[0130] 5. After 15 days of group treatment in step 4, the average root diameter and root volume of the plants in the alkali stress group were measured and counted. The statistical results are shown in Fig.13 (Sample size N = 30). The overexpression plants were significantly higher than the WT plants.

[0131] 6. 15 days after the group treatment in step 4, the total plant weight and root weight of the plants in the alkaline stress group were measured. Fig.13 (Sample size N=30).

[0132] The above results indicate that overexpression of GsEXPA8 promotes the thickening, shortening and volume increase of the plant roots, thereby improving the plant's alkali tolerance.

[0133] Example 5. Distribution of GFP signals in wild-type and overexpressing soybean plants

[0134] The pEGOEP35S::GFP empty vector was transformed into the roots of DN50 plants using Agrobacterium rhizogenes K599. The green fluorescence signal was located in the cell wall, cell membrane and cytoplasm of each cell (see Fig.14 The pEGOEP35S::GsEXPA8 subcellular localization vector was transformed into the roots of DN50 plants using Agrobacterium rhizogenes K599. The green fluorescence signal was mainly located in the outer cells (see Fig.14 After local magnification, it can be found that the GsEXPA8 gene is expressed in the two layers of cells near the outermost layer of the root tip (see Fig.14 The above proves that after overexpression, the GsEXPA8 gene is localized in the soybean root tip and regulates the development of the outer layer cells of the root.

[0135] Example 6. Relative expression of alkaline stress maker gene in WT and GsEXPA8 gene overexpressing plants

[0136] Test soybean seeds: seeds of Dongnong 50 soybean plants (expressed as WT), T2 seeds of the OE-1 strain obtained in step 2 of Example 2, T2 seeds of the OE-2 strain, or T2 seeds of the OE-5 strain.

[0137] The test seeds were cultured in pots filled with soil, and the plants germinated for 25 days were watered with 1L of 50mM NaHCO3 aqueous solution (excess and exudation) per pot. The root tips were sampled before (0 time), 3 hours after, 6 hours after, or 12 hours after the alkaline stress treatment.

[0138] The total RNA of the samples was extracted, reverse transcribed into cDNA, and real-time quantitative PCR was performed.

[0139] The target genes are: KIN, RD22, DnaJ6, NFYC and MYB. The internal reference gene is GmACTIN4 gene.

[0140] The primer pairs used to detect each target gene and internal reference gene are shown in Table 3.

[0141] Table 3

[0142] Primer name Primer sequences qRD22-F TCGTCTCCTACCCATTTTTACTTTA qRD22-R TCCACCCAATCGGGGTAA qDnaJ A6-F AGCAGTGGCTAAGCTAGCAG qDnaJ A6-R TCCCGCGAAAATCTGAGGAT qMYB14-F ACATCTGGGTAACAGATGGTC qMYB14-R GTGGCTACTGAGTCTTGTTGA qNFYC1-F GCTCTTGGAATCACACTGAAG qNFYC1-R GGCATGTAGCAGTATGGAAG qKIN-F ATCTCCATAACGGACTTCGGTG qKIN-R ATTCCCCAACTCCTGCGTGG qGmACTIN4-F GTGTCAGCCATACTGTCCCCATTT qGmACTIN4-R GTTTCAAGCTCTTGCTCGTAATCA

[0143] Results Fig.15 . In transgenic plants, the relative expression levels of KIN and NFYC at 3h, 6h and 12h were significantly higher than those in WT plants. In transgenic plants, the relative expression levels of RD22 and DnaJ6 at 6h and 12h were higher than those in WT plants. In transgenic plants, the relative expression level of MYB gene at 0h, 3h and 6h was higher than that in WT plants. This may be because RD22 and DnaJ6 are downstream functional genes; KIN and NFYC are genes that continuously respond to alkaline stress; MYB is a transcription factor gene, which causes them to respond to alkaline stress at different times. These results reveal that under alkaline stress, the transgenic GsEXPA8 gene can improve plant alkaline tolerance by regulating alkaline-resistant genes such as KIN, RD22, DnaJ6, NFYC and MYB.

[0144] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A protein, which is (a1) or (a2) or (a3) ​​or (a4) or (a5): (a1) the protein shown in SEQ ID NO: 1; (a2) the protein shown at positions 2-250 in SEQ ID NO: 1; (a3) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1) or (a2); (a4) a protein obtained by replacing and / or deleting and / or adding one or more amino acid residues of the protein described in (a1) or (a2) and related to the plant's tolerance to alkaline stress; (a5) A protein derived from soybean, having 98% or more identity with the protein described in (a1) or (a2) and associated with plant tolerance to alkaline stress.

2. A nucleic acid molecule encoding the protein of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that: The nucleic acid molecule is as follows (b1) or (b2) or (b3) or (b4): (b1) a nucleic acid molecule whose coding region is shown in SEQ ID NO: 2; (b2) a nucleic acid molecule whose coding region is shown in positions 4 to 750 of SEQ ID NO: 2; (b3) a nucleic acid molecule derived from soybean and having 95% or more identity with (b1) or (b2) and encoding the protein; (b4) A nucleic acid molecule that hybridizes to the nucleic acid sequence defined in (b1) or (b2) under stringent conditions and encodes the protein.

4. An expression cassette, recombinant vector or recombinant microorganism containing the nucleic acid molecule according to claim 2 or 3.

5. Use of the protein according to claim 1 or the nucleic acid molecule according to claim 2 or 3 in regulating the tolerance of plants to alkaline stress.

6. Use of the protein according to claim 1 in preparing plants with improved tolerance to alkali stress.

7. Use of the nucleic acid molecule according to claim 2, the nucleic acid molecule according to claim 3, the expression cassette according to claim 4, the recombinant vector according to claim 4 or the recombinant microorganism according to claim 4 in preparing a transgenic plant with improved tolerance to alkaline stress.

8. A method for cultivating plants with improved tolerance to alkali stress, comprising the following steps: introducing the nucleic acid molecule according to claim 2 or 3 into a recipient plant to obtain a transgenic plant with improved tolerance to alkali stress.

9. A method for cultivating plants with improved tolerance to alkali stress, comprising the steps of: increasing the content of the protein according to claim 1 in the plants to obtain plants with improved tolerance to alkali stress.

10. Use of the method according to claim 8 or 9 in plant breeding.

Images