Application of CsPNRC1 gene and its encoded protein in regulating cucumber resistance to fusarium wilt

Abstract

The application discloses a CsPNRC1 gene and application of a coded protein thereof in regulation of cucumber resistance to fusarium wilt, a nucleotide sequence of the gene CsPNRC1 is shown as SEQ ID NO. 1, and a protein sequence coded by the gene is shown as SEQ ID NO. 2; the application firstly constructs CsPNRC1 gene editing and overexpression of a germplasm material of cucumber, and finds that low expression of the cucumber gene CsPNRC1 can improve the resistance of the cucumber to fusarium wilt, and overexpression significantly improves the incidence of the cucumber to fusarium wilt, so that the gene plays a key regulation role in the process of resistance to fusarium wilt.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and molecular biology, and in particular relates to the application of a CsPNRC1 gene and its encoded protein in regulating cucumber resistance to Fusarium wilt. Background Technology

[0002] With the continuous expansion of greenhouse cucumber cultivation area and the resulting soil continuous cropping obstacles becoming increasingly apparent, Fusarium wilt has become the most prominent manifestation of continuous cropping obstacles, seriously restricting the high-quality, safe and efficient cultivation of cucumbers, and in severe cases leading to complete crop failure (Delgado-Baquerizo et al., 2020; Naguib et al., 2021; Lian et al., 2023).

[0003] Cucumber wilt is a devastating soil-borne fungal disease caused by *Fusarium oxysporum* f.sp. *cucumerinum* (Foc). This disease spreads rapidly, adapts to various environments, and grows fastest at temperatures between 23 and 29°C. It grows even faster in acidic soils or areas infested by nematodes (Cohen et al., 2015; Wang et al., 2023). The pathogen produces chlamydospores that can survive in the soil for many years (Sun et al., 2015; Uddin et al., 2023). Continuous cropping of cucumbers leads to a continuous increase in the pathogen's population in the soil, resulting in a progressively worsening disease incidence. The disease can occur at any stage of cucumber growth and development, with the highest incidence in the mid-to-late stages due to decreased growth vigor; it is often referred to as the "cancer" of cucumbers (Shen et al., 2017; Zhang et al., 2023). Therefore, the control of cucumber wilt has become an urgent problem to be solved. Summary of the Invention

[0004] Purpose of the invention: In order to solve the above-mentioned technical problems, the present invention aims to provide a gene CsPNRC1 for regulating cucumber resistance to Fusarium wilt, which can effectively regulate cucumber resistance to Fusarium wilt and significantly reduce the incidence of Fusarium wilt.

[0005] Technical solution: In order to achieve the above objectives, the present invention provides a gene CsPNRC1 for regulating cucumber resistance to Fusarium wilt, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] Furthermore, the primer pair used to amplify the gene CsPNRC1 is as follows:

[0007] CsPNRC1-F: 5'-CTTACGCCACCAAGGATT-3',

[0008] CsPNRC1-R: 5'-ACGGCAAGGGCACCGAACT-3'.

[0009] The amino acid sequence of the protein encoded by the cucumber wilt resistance gene CsPNRC1 described in this invention is shown in SEQ ID NO.2.

[0010] The gene knockout vector pCambia1301-CsPNRC1 that regulates the cucumber wilt resistance gene CsPNRC1 is described in this invention.

[0011] Furthermore, the method for constructing the knockout vector pCambia1301-CsPNRC1 is as follows: using the nucleotide sequence of the CsPNRC1 gene as a template, target primers for CsPNRC1 are designed for amplification. The obtained product is then recombined with the enzyme-digested pCambia3101 modified vector, the sequence of which is shown in SEQ ID NO.3. After transformation, plasmids are extracted to finally obtain the gene knockout vector pCambia1301-CsPNRC1.

[0012] The present invention describes the overexpression vector pCambia1391-CsPNRC1 for regulating the cucumber wilt resistance gene CsPNRC1.

[0013] Furthermore, the overexpression vector pCambia1391-CsPNRC1 is constructed by amplifying the gene CsPNRC1, digesting it with enzymes and ligating it into the pCambia1391 vector, then extracting the plasmid through E. coli transformation and Agrobacterium transformation to finally obtain the overexpression vector pCambia1391-CsPNRC1.

[0014] The application of the gene CsPNRC1, the protein, the gene knockout vector, or the overexpression vector described in this invention in regulating cucumber resistance to Fusarium wilt.

[0015] Furthermore, editing the cucumber CsPNRC1 gene in cucumbers increased their resistance to Fusarium wilt and reduced their susceptibility; overexpressing the cucumber CsPNRC1 gene decreased their resistance to Fusarium wilt and increased their susceptibility.

[0016] The application of the cucumber wilt resistance gene CsPNRC1, the protein, the gene knockout vector, or the overexpression vector described in this invention in the cultivation of wilt-resistant cucumber germplasm.

[0017] The cucumber CsPNRC1 gene was used to construct CsPNRC1 cucumber gene-edited transgenic material, which can deactivate proline-rich nuclear receptor coactivators, thereby improving resistance to Fusarium wilt.

[0018] This invention provides the cucumber CsPNRC1 gene sequence and its encoded protein sequence, and for the first time constructs cucumber CsPNRC1 gene-edited transgenic material. Functional studies have revealed that this gene plays a regulatory role in resistance to Fusarium wilt.

[0019] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0020] This invention, for the first time, proposes the application of the CsPNRC1 gene and its encoded protein in regulating cucumber resistance to Fusarium wilt. Transgenic technology was used to construct CsPNRC1 gene-edited and overexpressed transgenic materials, and the function of the CsPNRC1 gene was investigated. Experiments demonstrated that CsPNRC1 expression in the gene-edited cucumber transgenic lines was significantly lower than that in the control group (WT), yet resistance was significantly better than WT. Conversely, the overexpressed transgenic lines showed the opposite result, indicating that this gene plays a negative regulatory role in cucumber resistance to Fusarium wilt. The discovery of this novel function of the gene in cucumber provides new ideas and theoretical basis for the innovation of Fusarium wilt-resistant germplasm materials, and has promising application prospects. Attached Figure Description

[0021] Figure 1 Diagram of the cucumber CsPNRC1 gene editing expression vector;

[0022] Figure 2 This is a diagram of the cucumber CsPNRC1 gene overexpression vector;

[0023] Figure 3 To regulate resistance to Fusarium wilt in cucumber CsPNRC1 gene-edited materials, the following figures are presented: Figure a shows the process of constructing transgenic plants; Figure b shows the sequence differences between different genotypes (KO) and wild-type (WT) of cucumber CsPNRC1 gene-edited transgenic plants; Figure c shows the phenotypic differences between cucumber CsPNRC1-KO and WT lines after inoculation with Fusarium wilt; Figure d shows the expression levels of CsPNRC1 in the three genotypes of edited materials and WT; Figure e shows the disease severity of cucumber CsPNRC1-KO and WT lines after inoculation with Fusarium wilt.

[0024] Figure 4 To investigate the regulation of Fusarium wilt resistance in cucumber CsPNRC1 gene overexpression materials, Figure a shows the expression levels of CsPNRC1 in five overexpression materials and WT; Figure b shows the phenotypic differences between cucumber CsPNRC1-OE(3-3) and WT lines after inoculation with Fusarium wilt; Figure c shows the disease severity of cucumber CsPNRC1-OE(3-3) and WT lines after inoculation with Fusarium wilt.

[0025] Figure 5To regulate the resistance to Fusarium wilt in transgenic materials with overexpression and gene editing of cucumber CsPNRC1 gene;

[0026] Figure 6 To show the attachment of Fusarium oxysporum f.sp.cucumerinum on the root epidermis of cucumber CsPNRC1 transgenic materials and WT. Specific implementation methods

[0027] The technical solutions of the present invention will be further described below with reference to the accompanying drawings.

[0028] The materials, reagents, etc. used in the following examples can be obtained from commercial channels without special instructions. The experimental methods without specific conditions in the examples usually follow conventional conditions or the conditions recommended by the manufacturer.

[0029] The cucumber inbred line 'Chinese Dragon' (Chinese Dragon / 9930) and the cucumber Fusarium wilt strain Foc (Fusarium oxysporum f.sp.cucumerinum) used in the experiments of the present invention were published in an article in 2017, titled "Isolation and Identification of Cucumber Fusarium Wilt Pathogen and Analysis of Resistance Differences Among Varieties", in the Journal of Molecular Plant Breeding (Dong Jingping et al., 2017).

[0030] The pCambia1391 vector was purchased from Shanghai Zeyue Biotechnology Co., Ltd.

[0031] Example 1

[0032] Obtain the full-length sequence of cucumber CsPNRC1 gene

[0033] Using the cDNA of the cucumber susceptible inbred line 'Chinese Dragon' (Chinese Dragon / 9930) roots as a template, design cloning primers CsPNRC1-F and CsPNRC1-R, and perform PCR amplification with high-fidelity DNA polymerase.

[0034] The primer sequences are as follows:

[0035] CsPNRC1-F: 5’-CTTACGCCACCAAGGATT-3’ ,

[0036] CsPNRC1-R: 5’-ACGGCAAGGGCACCGAACT-3’ 。

[0037] The PCR system consisted of 50 μL of the following: 25 μL of 2×PhantaFlash Master Mix, 2 μL of template, 2 μL each of forward and reverse primers, and 19 μL of ddH2O. The PCR reaction program was as follows: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 60℃ annealing for 5 seconds, and 72℃ extension for 2 minutes, for a total of 35 cycles; and a final extension at 72℃ for 1 minute. The obtained PCR products were identified by 1% agarose gel electrophoresis. The target band was then purified using a Takara gel extraction kit, and the product was ligated into the PMD19-T vector (Takara). The recombinant plasmid was then sent for assay.

[0038] The nucleotide sequence of the CsPNRC1 gene is shown in SEQ ID No. 1; the amino acid sequence encoded by this gene is shown in SEQ ID No. 2.

[0039] Example 2

[0040] Construction and Detection of Cucumber CsPNRC1 Gene-Edited Transgenic Materials

[0041] 1. Steps for constructing a knockout vector using the cucumber CsPNRC1 gene:

[0042] Using the nucleotide sequence of the CsPNRC1 gene (SEQ ID No. 1) as a template, target primers were designed: pCambia3101-CsPNRC1-F1: GAATTTCGCCGAGAACTCAACGG; pCambia3101-CsPNRC1-R1: ACCGTCAAGCTAACAGAGAGCGG for amplification. The resulting products were then recombined with the pCambia3101 modified vector digested with AluI and BarI via homologous recombinase (Novizan, ClonExpress Ultra One Step Cloning Kit) to construct its knockout vector. The pCambia3101 modified vector is a vector modified with the pCambia3101 plasmid as the basic backbone, and its sequence is shown in SEQ ID NO. 3. It was constructed and synthesized by Weimi Biotechnology (Suzhou) Co., Ltd. The recombinant product was transformed into E. coli DH5α competent cells. Positive clones were screened using Kan+ resistant bacterial culture medium and colony PCR. The identification primers were: pCambia3101-CsPNRC1-F2: AGACGAAGA AGGCGACACTT; pCambia3101-CsPNRC1-R2: CAAGTCGTAGCAACCGCCTA. After sequencing verification of the positive clones at a biological sequencing company, the knockout vector pCambia1301-CsPNRC1 was obtained. Figure 1After successful sequencing, the plasmid was extracted (Norvita, RapidLyse PlasmidMini Kit).

[0043] The successfully constructed pCambia1301-CsPNRC1 vector was transformed into Agrobacterium EHA105 competent cells, and single-clone strains with correct sequencing were selected for incubation. Two-day-old germinating cucumber cotyledons were used as material, placed in Agrobacterium suspension at room temperature for 30 minutes for infection. After infection, the explants were placed in a co-culture medium and cultured in the dark at 23°C for 3 days; then transferred to resting medium and cultured in light at 25°C for 7 days; then transferred to selection culture for 6 weeks to induce resistant shoots, and then transferred to elongation medium and cultured in light at 25°C for 3-6 weeks until rooting, obtaining tissue culture seedlings. Figure 3 a). The obtained regenerated plants were identified using primers for the vector antibiotic gene AADA: AADA_F: TCCGACATCGATCT CCTGGT; AADA_R: CAGGGTGAGGACCACATTCC; and specific primers designed for the CsPNRC1 gene: CsPNRC1_T_F: AGACGAAGAAGGCGACACTT; CsPNRC1_T_R: CAAGTCGTAG CAACCGCCTA. Ultimately, eight transgenic positive plants were obtained, and sequencing revealed three transgenic knockout lines (…). Figure 3 b) T2 generation plants were obtained through single-plant self-pollination and named KO6.1_line1, KO6.1_line2, and KO6.1_line3 respectively for subsequent experimental analysis.

[0044] 2. The construction steps of the overexpression vector are as follows:

[0045] Homologous recombination primers were designed using the overexpression vector pCambia1391 sequence and the nucleotide sequence of the target gene (SEQ ID No. 1). The sequences were: pCambia1391-CsPNRC1-F: 5'-tgggcccggcgcgccaagcttATGGCAACCGTGATTCTTCCG-3'; pCambia1391-CsPNRC1-R: 5'-cggggatccgtcgacctgcagTCATTCTAAATCAAGTCGTAGCAACC-3'. The nucleotide sequence (SEQ ID No. 1) was used as a template for amplification. The amplification products were collected by agarose gel electrophoresis and then recycled for later use. The vector was linearized using restriction endonucleases HindIII and PstI. The vector was constructed using the Novitane recombinant DNA kit. 5 μL of the recombinant product was transformed into *E. coli* DH5α competent cells. Colonies were verified by PCR using recombinant primers (pCambia1391-CsPNRC1-F and pCambia1391-CsPNRC1-R). Correctly sequenced bacterial cultures were selected for testing and then transformed into *Agrobacterium* EHA105 competent cells. Again, colony PCR verification yielded *Agrobacterium* cultures with the correct sequence for further transformation experiments. The vector is as follows: Figure 2 As shown.

[0046] Two-day-old germinating cotyledons of cucumber "9930" were placed in 50 mL of correctly sequenced Agrobacterium suspension in the logarithmic growth phase. Infection was performed at room temperature for 30 minutes. After infection, the treated explants were placed in a co-culture medium and cultured in the dark at 23°C for 3 days. After co-culture, the explants were transferred to a resting medium and cultured under light at 25°C for 7 days. They were then placed on a selection medium and cultured for 6 weeks to induce resistant shoots. These shoots were then transferred to an elongation medium and cultured under light for 3-6 weeks until rooting. Finally, they were transplanted into seedling trays for testing of T0 plants. The detection primers were: AADA_F:TCCGACATCGATCTCCTGGT; AADA_R:CAGGGTGAGGACCACATTCC. Positive plants were propagated, resulting in 5 transgenic positive plants, named OE. 1-1 OE 3-2 OE 3-3 OE 8-1 OE 8-2 T2 generation plants were obtained through single-plant self-pollination for subsequent experimental analysis.

[0047] Example 3

[0048] Research on the regulation of Fusarium wilt resistance in cucumber CsPNRC1 gene-edited transgenic materials

[0049] Based on the sequence following the R-terminal primer of the CsPNRC1 editing target, qRT-PCR primers were designed: CsPNRC1_qPCR_F:GTGATGATTCTTGTGGTAA, CsPNRC1_qPCR_R:ATCCTTGAAGTCCGTTAA. qRT-PCR was used to verify the expression level of CsPNRC1 in gene-edited transgenic plants and WT plants. The results showed that the expression level of the CsPNRC1 gene in the three transgenic lines was significantly lower than that in WT plants, with the lowest expression level observed in KO6.1_line1. This line can be used as material for further research. Figure 3 d).

[0050] To further analyze the role of the CsPNRC1 gene in cucumber resistance to Fusarium wilt, three genotypes of CsPNRC1 gene-edited materials were selected for sowing. Each seedling was inoculated with a 5 mL (1×10⁻⁶) suspension of Fusarium wilt spores (Foc) via root drenching at the two-leaf-one-heart stage. 6 Spores / mL), disease severity was assessed and disease index was calculated 10 days after inoculation. Results showed that dead plants had already appeared in WT plants 10 days after inoculation, while only a few of the gene-edited materials showed the phenotypic pattern of browning at the stem base of the wilt disease. With prolonged inoculation time, the incidence rate of WT increased, indicating that CsPNRC1 gene editing significantly improves resistance to cucumber wilt. Figure 3 c, Figure 3 e).

[0051] Based on the above qRT-PCR sequences, the OE gene with the highest expression level of CsPNRC1 was selected. 3-3 The strain and WT plants were sown ( Figure 4 a) Each seedling was inoculated with a suspension of Fusarium wilt spores (Foc) at the two-leaf-one-heart stage, using the same inoculation method as during gene-editing material validation, with each seedling inoculated with 5 mL (concentration 1×10⁻⁶). 6 (spores / mL), 10 days after inoculation, it was observed that the overexpressing plants were severely wilted, and even several dead plants appeared, which was more severe than the WT disease. Figure 4 b, c).

[0052] To clarify the function of CsPNRC1 and determine the resistance of gene-edited and overexpressed plants to Fusarium wilt pathogens, gene-edited transgenic material CsPNRC1-KO6.1_line1 and overexpression transgenic material CsPNRC1-OE were sown simultaneously. 3-3 For WT, inoculate with Fusarium wilt pathogen at the two-leaf-one-heart stage, using the same inoculation method as during the validation of the gene-edited materials mentioned above, inoculating each seedling with 5 mL (concentration of 1×10⁻⁶). 6 Spores / mL), and the disease severity was observed and recorded at 10 and 15 days after inoculation. Figure 5On day 10 after inoculation, WT strains were found to have developed disease, and most of the overexpression materials showed severe wilting, while the gene-edited materials were asymptomatic.

[0053] The wilt pathogen infects through the roots. To further determine the function of CsPNRC1, roots from gene-edited, overexpressed, and WT plants at the two-leaf-one-heart stage were collected, washed, and placed in an equal volume and concentration of spore suspension (1×10⁻⁶). 6 Root epidermis samples were collected at 24h, 48h, and 96h (spores / mL) for observation. It was found that the root epidermis of overexpression plants began to accumulate large amounts of hyphae at 24h, while WT plants showed a small amount of accumulation. No hyphae or spores were found in the root epidermis of gene-edited plants. Over time, the hyphae accumulated in the root epidermis of overexpression and WT plants increased significantly, while spores and hyphae were almost entirely absent from the root epidermis of gene-edited plants. Figure 6 ).

[0054] In summary, the experiments demonstrated that the expression of CsPNRC1 in cucumber gene-edited transgenic lines was significantly lower than that in WT, while the resistance was significantly better than that in WT. Conversely, the overexpression transgenic lines showed the opposite results, indicating that the gene plays a negative regulatory role in cucumber resistance to Fusarium wilt. The discovery of this new function of the gene in cucumber provides new ideas and theoretical basis for the innovation of cucumber Fusarium wilt resistant germplasm materials, and has good application prospects.

Claims

1. Gene knockout CsPNRC1 Or the application of the gene knockout vector in regulating resistance to cucumber wilt; in cucumbers, knocking out the gene... CsPNRC1 The gene increases its resistance to Fusarium wilt and reduces its susceptibility to the disease; the gene CsPNRC1 The nucleotide sequence is shown in SEQ ID NO.1, and the knockout vector is pCambia1301-CsPNRC1.

2. The application according to claim 1, characterized in that, The method for constructing the knockout vector pCambia1301-CsPNRC1 is as follows: using the nucleotide sequence of the CsPNRC1 gene as a template, target primers for CsPNRC1 are designed for amplification. The obtained product is then recombined with the enzyme-digested pCambia3101 modified vector. The sequence of the pCambia3101 modified vector is shown in SEQ ID NO.

3. After transformation, the plasmid is extracted to finally obtain the gene knockout vector pCambia1301-CsPNRC1.

3. Knockout CsPNRC1 Or the application of the gene knockout vector in the breeding of cucumber germplasm resistant to Fusarium wilt; the gene CsPNRC1 The nucleotide sequence is shown in SEQ ID NO.1, and the knockout vector is pCambia1301-CsPNRC1.

Images