A gene of AgOMT03 of Equus zoeae and its application in the preparation of bergenin

Abstract

The present invention relates to a kind of fetal oxygen methyltransferase <h2 style=";text-align:left;direction:ltr">AgOMT03 The invention relates to a gene and its application in preparing bergenin, and belongs to the field of biotechnology. <h2 style=";text-align:left;direction:ltr"> AgOMT03 The gene nucleotide sequence is shown in SEQ ID NO.1, and the full length of the sequence is 1095 bp; the amino acid sequence of the encoded protein is shown in SEQ ID NO.2, and it encodes 364 amino acid residues. <h2 style=";text-align:left;direction:ltr"> AgOMT03 The gene can be used as a biosynthesis regulatory gene for bergenin and can be used to prepare bergenin. It has significant application prospects and is easy to promote and apply.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a Zostera fetomethyltransferase AgOMT03 gene and an application thereof in preparing bergenin. Background Art

[0002] Ardisia gigantifolia Stapf is a plant of the genus Ardisia in the family Primulaceae. The plants of this genus are distributed in Yunnan, Guangxi, Guangdong, Jiangxi, Fujian and other places in China, and are also cultivated in northern Vietnam; they like to grow in shaded and moist places such as under forests in mountains or bamboo forests. There are many medicinal ingredients in the plants of the genus Ardisia, and bergenin is one of the main active ingredients. Bergenin has multiple effects such as antitussive, anti-inflammatory, anti-anxiety, antioxidant, anti-malarial, anti-cancer, treatment of diabetes, anti-hepatotoxicity, immunomodulation and neuroprotection. Domestic and foreign scholars have also found that unlike morphine-like central inhibitory cough drugs, bergenin has a selective inhibitory effect on the cough center and has no inhibitory effect on other nerve centers. It also has the characteristics of small toxicity and side effects, few adverse reactions, and no drug resistance after continuous use.

[0003] The precursor of bergenin biosynthesis is 2-glucose-4-methoxygallic acid, which is generated by intramolecular dehydration, rearrangement and ring closure; 2-glucose-4-methoxygallic acid is generated by 4-methoxygallic acid connecting glucose at the 2-position with uridine diphosphate glucose (UDP-glucose) as the glycosyl donor under the catalysis of carbon glycosyltransferase (CGT); 4-methoxygallic acid is catalyzed by gallic acid oxygen methyltransferase (OMT) with gallic acid as substrate and S-adenosyl-methionine (SAM) as the methyl donor; gallic acid is catalyzed by shikimate dehydrogenases (SDH) with NADP+ as the proton donor.

[0004] With the increasing number of chronic bronchitis diseases, the gap in raw materials for bergenin is increasing. At present, the raw materials for bergenin on the market are mainly obtained by extraction, and the annual demand for dry medicinal materials for extracting bergenin has reached more than 2,000 tons. The extensive mining in recent decades has caused a sharp decline in wild resource reserves and is on the verge of exhaustion. At the same time, the high altitude, many mountainous areas and cold climate conditions in the origin make it difficult to cultivate artificially on a large scale, further expanding the gap in the market for bergenin raw materials and causing prices to rise year by year. In recent years, with the rapid development of synthetic biology, the use of synthetic biology technology to produce natural drug monomers can effectively solve the above problems. However, to understand the biosynthetic pathways of these active ingredients, it is necessary to identify the key genes related to these pathways, and the discovery of these catalytic enzyme genes has become a key link in studying the biosynthetic pathways of plant metabolites. At present, gallic acid undergoes glycosylation at the C-2 position, followed by intramolecular dehydration, rearrangement and ring closure to generate nor-bergenin, which is then catalyzed by OMT to methylate the 4-hydroxyl group to generate bergenin. The function of oxygen-methyltransferase responsible for methylation has been less verified, which has affected the advancement of the biosynthesis of bergenin. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a gene of AgOMT03, which can be used as a biosynthesis regulatory gene of bergenin and can be used in the preparation of bergenin.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] The first aspect of the present invention provides a zonulated horse fetoxyl methyltransferase AgOMT03 gene, the nucleic acid sequence of the zonulated horse fetoxyl methyltransferase AgOMT03 gene is shown in SEQ ID NO.1, and the full length of the sequence is 1095 bp.

[0008] The second aspect of the present invention provides a protein encoded by the above-mentioned Equus fetooxygen methyltransferase AgOMT03 gene, the amino acid sequence of which is shown in SEQ ID NO.2, encoding 364 amino acid residues.

[0009] The third aspect of the present invention provides a recombinant plasmid containing the above-mentioned Equus fetomethyltransferase AgOMT03 gene.

[0010] Preferably, the recombinant plasmid is obtained by homologous recombination of the above-mentioned AgOMT03 gene and the pET28a vector, and is named pET28a-AgOMT03.

[0011] The fourth aspect of the present invention provides a genetically modified engineered bacterium, comprising the recombinant plasmid, or the genome of the genetically modified bacterium is integrated with the exogenous AgOMT03 gene.

[0012] Preferably, the genetically modified bacteria is Escherichia coli BL21 (DE3) strain.

[0013] The fifth aspect of the present invention provides an application of the Zouma feto-oxygen methyltransferase AgOMT03 gene in the preparation of bergenin.

[0014] Preferably, under the catalysis of the Zoma fetomethyltransferase obtained from the above-mentioned Zoma fetomethyltransferase AgOMT03 gene, gallic acid is first glycosylated at the C-2 position in Saccharomyces cerevisiae, and after intramolecular dehydration, it is rearranged and ring-closed to form demethylbergenin, and finally the 4-hydroxyl group is methylated by OMT to form bergenin.

[0015] The present invention obtains the target protein after in vitro expression through the recombinant plasmid, and directly generates bergenin by further catalyzing the substrate nor-bergenin.

[0016] The Zoma fetal oxygen methyltransferase AgOMT03 gene of the present invention is identified from the Zoma fetal plant through transcriptome sequencing and bioinformatics technology, and after a large number of experiments and screening; RNA of the Zoma fetal rhizome is extracted using RNA reagent, and reverse transcribed into cDNA and then PCR amplified. The amplification primers of the Zoma fetal oxygen methyltransferase AgOMT03 gene are as follows:

[0017] 5'F: ATGGGTTCCTTAGAAAACACCC; (SEQ ID NO.3)

[0018] 3'R:TTAAACATTATTCTTGAGAAACTCC; (SEQ ID NO.4)

[0019] In addition, when homologous recombination is performed with the vector pET28a, the AgOMT03 gene needs to be amplified and recovered using primers with homologous walls. The primers with homologous walls are as follows:

[0020] Upstream homology arm primer:

[0021] 5'F: gcatgactggtggacagcaaatgggtcgcggatccATGGGTTCCTTAGAAAACACCC; (SEQ ID NO.5)

[0022] Downstream homology arm primer:

[0023] 3'R: aagcttgtcgacggagctcgaattcggatccTTAAACATTATTCTTGAGAAACTCC; (SEQ IDNO.6)

[0024] The oxygen methyltransferase AgOMT03 gene isolated and identified from the zouma fetus can be used as an important marker gene for molecular assisted breeding of zouma fetus, and can also be used as an important candidate gene for the production of bergenin in the construction of yeast chassis cells.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] (1) The present invention provides a gene of AgOMT03, which can be used as a biosynthesis regulatory gene of bergenin and can be used in the preparation of bergenin.

[0027] (2) With the rapid development of bioinformatics technology, the mining of key enzyme genes in the biosynthesis pathway of bergenin has been greatly promoted. The biosynthesis regulatory gene of bergenin in the present invention, namely the AgOMT03 gene, was identified and successfully verified for the first time, opening up a new biosynthetic method for producing bergenin. The present invention obtains the target product by enzyme catalysis in vitro through heterologous expression of Escherichia coli proteins, adopts in vitro biosynthesis, and carries out directional production, which has the advantages of less by-products, etc.

[0028] (3) The present invention also provides a recombinant plasmid, a genetically engineered bacterium and a recombinant protein containing the AgOMT03 gene of the bergenin, which lays a foundation for synthesizing bergenin in large quantities through bioengineering methods and further for constructing a cell factory that produces bergenin.

[0029] (4) The in vitro biosynthesis of bergenin is highly controllable, which can reduce the demand for raw material planting, produce a single product, facilitate the separation and purification of bergenin in the later stage, and reduce the difficulty of chemical synthesis and the complexity of the synthesis path. The Zouma fetomethyltransferase AgOMT03 gene, as a key gene for the biosynthesis of bergenin, can also be used for breeding research of plants rich in bergenin such as Ardisia japonica. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of the synthetic route derived for bergenin;

[0031] Figure 2 Schematic diagram of the construction of the recombinant expression plasmid Pet28a-AgOMT03;

[0032] Figure 3 It is the electrophoresis test result after AgOMT03 recombinant, where M is nucleic acid Mar, 1 and 2 are the positive single colony test results;

[0033] Figure 4This is the SDS-PAGE protein electrophoresis detection diagram of the fetal oxygen methyltransferase AgOMT03. Among them, M is the protein molecular weight standard; lanes 1, 2, 3, and 4 are respectively the precipitation eluent, the flow-through eluent, the 20mmol / L imidazole eluent, and the 50mmol / L imidazole eluent; lanes 5-10 are all proteins in the 250mmol / L imidazole eluent;

[0034] Figure 5 HPLC detection of the methylation of the hydroxyl group at the C-4 position of norbergenin by oxygen methyltransferase AgOMT03. The horizontal axis is time, unit is min, and the vertical axis is the response value, unit is mAU; wherein, CK: the result of the enzyme activity reaction of the control group (norbergenin + S-adenosyl-methionine + inactivated troglodyte fetal oxygen methyltransferase AgOMT03) inactivated enzyme; standard product: norbergenin standard product + bergenin standard product; AgOMT03: the result of the enzyme activity reaction of the experimental group (norbergenin + S-adenosyl-methionine + troglodyte fetal oxygen methyltransferase AgOMT03);

[0035] Figure 6 is the mass spectrometry analysis (LC / MS / MS) spectrum of the standard, wherein A is the retention time of the standard norbergenin, 17.46 minutes; B is the retention time of the standard bergenin, 21.44 minutes;

[0036] Figure 7 The mass spectrometry analysis (LC / MS / MS) spectrum of the enzyme activity verification reaction product, wherein A is the retention time of the substrate norbergenin, 17.46 minutes; B is the retention time of the reaction product bergenin, 21.45 minutes;

[0037] Figure 8 The fragment ion pattern of the standard substance bergenin (theoretical molecular weight 328) (LC / MS / MS);

[0038] Fig. 9 The fragment ion pattern of the reaction product bergenin (theoretical molecular weight 328) (LC / MS / MS). DETAILED DESCRIPTION

[0039] The present invention is further described in detail below in conjunction with embodiments.

[0040] Those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the art or the product specifications are used. If the manufacturer of the materials or equipment used is not specified, they are all conventional products that can be purchased.

[0041] Example 1

[0042] Based on the Unigene basic functional annotation information of the transcriptome of the horsetail, the OMT candidate genes were screened in the sequencing annotation results. At the same time, the OMT identified in plants was analyzed by sequence local BLAST, and then the screening results were sorted and analyzed. Finally, an OMT gene was found. After a series of work such as cDNA preparation, candidate gene amplification and recovery, homologous recombination, protein expression, in vitro enzyme activity reaction, and HPLC and LC / MS detection, the target candidate OMT03 gene (which can catalyze the methylation reaction of the hydroxyl group at the C-4 position of norbergenin to generate bergenin) was finally identified. Figure 1 The operation steps of each stage of the synthesis of bergenin are as follows (the reagents, raw materials, instruments and equipment used in the following implementation are all commercially available):

[0043] (1) Preparation of cDNA template

[0044] Fresh samples of the rhizomes of the horse fetus were taken, sliced, and then quickly frozen in liquid nitrogen for RNA extraction. The total RNA was extracted using the HiPure Plant RNA Mini Kit from Magen (Guangzhou Meiji Biotechnology Co., Ltd.). RNA was extracted according to the operating procedures of the kit. After passing the test, the RNA was reverse transcribed into cDNA using the TAKARA reverse transcription kit and stored at -20°C for later use.

[0045] (2) Gene amplification and recovery

[0046] Using primer design software (CE Design) v1.04, primers with homology arms of the gene were designed (homologous arms were Escherichia coli pET28a), and then KOD high-fidelity enzyme was used for gene amplification. The PCR reaction system was: 94°C, 5min; 94°C, 30S, 58°C, 50S, 72°C, 1min, 35 cycles; 72°C, 7min. After the PCR was completed, the gel was run, and the target band was recovered after confirming the successful amplification. The EasyPure Quick GelExtraction Kit kit of Beijing Quanshijin Biotechnology Co., Ltd. was used for gene gel excision and recovery to recover the target gene. After recovery, the recovery concentration was determined on the NanoReady ultra-micro UV-visible spectrophotometer, and finally stored in a -20°C refrigerator for standby use. The gene fragment of the fetal oxygen methyltransferase AgOMT03 was obtained, and its nucleic acid sequence was sequenced as shown in SEQ ID NO.1.

[0047] 5'F: ATGGGTTCCTTAGAAAACACCC; (SEQ ID NO.3)

[0048] 3'R:TTAAACATTATTCTTGAGAAACTCC; (SEQ ID NO.4)

[0049] In addition, when homologous recombination is performed with the vector pET28a, the AgOMT03 gene needs to be amplified and recovered using primers with homologous walls. The primers with homologous walls are as follows:

[0050] Upstream homology arm primer:

[0051] 5'F: gcatgactggtggacagcaaatgggtcgcggatccATGGGTTCCTTAGAAAACACCC; (SEQ IDNO.5)

[0052] Downstream homology arm primer:

[0053] 3'R: aagcttgtcgacggagctcgaattcggatccTTAAACATTATTCTTGAGAAACTCC; (SEQ IDNO.6)

[0054] The lowercase letters in the above upstream homology arm primer (SEQ ID NO.5) and downstream homology arm primer (shown in SEQ ID NO.6) represent the pET28a homology arms, and the uppercase letters represent the primer sequences for amplifying the Zonata fetoxomethyltransferase AgOMT03 gene.

[0055] (3) Construction and identification of gene recombination vectors

[0056] A schematic diagram of homologous recombination is shown in Figure 2 First, linearize the vector pET28a and use BamH I enzyme to perform single enzyme digestion to obtain the linearized vector. During homologous recombination, assemble according to the operating instructions of the homologous recombination enzyme, and then calculate the amount of each component according to the concentration of the insert and the vector and the recombination instructions; finally, add each component to the PCR reaction tube on ice. After assembly, the results are tested and sent to the company for sequencing. The electrophoresis test results after assembly are shown in Figure 3 , indicating that the assembly is successful. Reassemble the operation according to the following process:

[0057] Table 1 Candidate genes Recombination System

[0058]

[0059] Where X = (0.02 × pET28a base pairs) ng / linearized pET28a concentration ng / μL; Y = (0.02 × pET28a base pairs) ng / AgOMT03 recovery concentration ng / μL;

[0060] (4) SDS-PAGE protein electrophoresis detection

[0061] After a small protein expression test, the protein induction conditions of AgOMT03 were determined to be: 18°C, 0.1mM IPTG, 220r / min, induction for 12h; then shake vigorously, collect bacteria, break the cell wall, obtain protein supernatant after high-speed centrifugation (12000r / min), and then use SDS-PAGE protein electrophoresis and detection. The test results are shown in Figure 4 , Figure 4 It shows that AgOMT03 protein can be eluted and purified in 250mmol / L imidazole elution buffer.

[0062] (5) Enzyme activity reaction

[0063] AgOMT03 enzyme activity was determined by methylation reaction to synthesize bergenin in a 1.5 mL centrifuge tube. The reaction system contained 2 μL of 100 mM S-adenosyl-methionine, 2 μL of 100 μM nor-bergenin, 40 μg of purified zoea feto-oxygen methyltransferase AgOMT03 protein, and 50 mM Tris-HCl buffer (pH 8.0) was added to a total volume of 100 μL. The total volume of the reaction system was 100 μL. After incubation at 32 ° C for 2 hours, an equal volume of 1 M hydrochloric acid was used to terminate the reaction, and the supernatant was taken after brief centrifugation (12000 r / min). Finally, the reaction products were detected by HPLC and LC-MS / MS analysis.

[0064] Control group (CK) reaction system: 2 μL of 100 mM norbergenin, 2 μL of 100 mM S-adenosyl-methionine, 40 μg of inactivated purified Zostera fetomethyltransferase AgOMT03 protein, 50 mM Tris-HCl buffer (pH 8.0) was added to a total volume of 100 μL, and the total volume of the reaction system was 100 μL.

[0065] Standard products: 50 μl of 10 mM norbergenin, 50 μl of 10 mM bergenin.

[0066] (6) Product testing

[0067] HPLC detection conditions are as follows:

[0068] The instrument used for HPLC detection is Agilent 1290 ultra-high performance liquid chromatograph. The chromatographic column is XBridge ShieldRP18 (4.6×250mm, 5μm), and the mobile phase for the determination of bergenin is 0.01% formic acid aqueous solution (A)-acetonitrile (B), with gradient elution: 0-8min, 1%-5% B; 8-13min, 5%-10% B; 13-20min, 10%-20% B; 20-25min, 20%-45% B; 25-35min, 45%-90% B; 35-40min, 90%-90% B; the detection wavelength is 270nm. The test results are shown in Figure 5 , indicating the production of bergenin.

[0069] LC-MS detection conditions are as follows:

[0070] In order to further confirm the reaction products detected by HPLC, Agilent 1290UPLC / 6540Q-TOF liquid chromatography-mass spectrometry (LC / MS) was used for detection. The detection method was as follows: Mass spectrometry conditions: the ion source used was negative ion mode, voltage: 3500 V; fragmentation voltage: 135 V; cone voltage: 60 V; radio frequency voltage: 750 V, scanning range: 100-1000 m / z. Chromatographic conditions: The chromatographic column was XBridge Shield RP18 (4.6×250mm, 5μm), the mobile phase for the determination of bergenin was 0.01% formic acid aqueous solution (A)-acetonitrile (B), gradient elution: 0-8min, 1%-5% B; 8-13min, 5%-10% B; 13-20min, 10%-20% B; 20-25min, 20%-45% B; 25-35min, 45%-90% B; 35-40min, 90%-90% B; detection wavelength 270nm. Detection results are shown in Figure 6 to Figure 9 From the results, it can be seen that the peak time and characteristic peak of the reaction product are consistent with the peak time and characteristic peak of the standard substance bergenin, which further confirms that the generated product is bergenin.

[0071] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A kind of fetal oxygen methyltransferase AgOMT03 A gene characterized by Fetomethyltransferase AgOMT03 The nucleic acid sequence of the gene is shown in SEQ ID NO.

1.

2. The fetomethyltransferase according to claim 1 AgOMT03 The gene encodes a protein characterized in that The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. A composition containing the fetomethyltransferase according to claim 1. AgOMT03 Recombinant plasmid of gene.

4. The method according to claim 3 containing fetomethyltransferase AgOMT03 A recombinant plasmid of a gene, characterized in that Fetomethyltransferase AgOMT03 The gene was homologously recombined with the pET28a vector to obtain pET28a - AgOMT03 heavy Plasmid .

5. A genetically modified bacteria, characterized in that: Containing the recombinant plasmid of claim 3 or 4, or the genome of the genetically engineered bacteria is integrated with the exogenous zomatous fetomethyltransferase of claim 1 AgOMT03 Gene.

6. The genetically modified bacteria according to claim 5, characterized in that: The transgenic engineering bacteria are Escherichia coli BL21 (DE3) strains.

7. The fetomethyltransferase of claim 1 AgOMT03 Application of genes in the preparation of bergenin.

8. The fetomethyltransferase according to claim 7 AgOMT03 The application of the gene in the preparation of bergenin is characterized in that: Fetomethyltransferase AgOMT03 Under the catalysis of the Zomafetomethyltransferase obtained from the gene, gallic acid is first glycosylated at the C-2 position in Saccharomyces cerevisiae. After intramolecular dehydration, it is rearranged and ring-closed to form nor-bergenin. Finally, the 4-hydroxyl group is methylated by the Zomafetomethyltransferase to form bergenin.

Images