Recombinant bacillus subtilis and application thereof

Abstract

The invention discloses recombinant bacillus subtilis and application thereof, and belongs to the technical field of molecular biology. According to the recombinant bacillus subtilis disclosed by the invention, 16sDNA of the bacillus subtilis is taken as an integration site, genes of D-psicose-3 epimerase from two different sources are integrated on a bacillus subtilis genome, and the food safety strain bacillus subtilis is taken as a chassis bacterium for heterologous expression, so that the recombinant bacillus subtilis is obtained. The expression of D-psicose-3 epimerase (DPE) is effectively promoted, so that the enzyme activity of the DPE produced by shake flask fermentation is 3655.42 U / ml, which is improved by 36% compared with that of an original control group, and the expression stability of the DPE in bacillus subtilis is improved.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and more particularly to a recombinant Bacillus subtilis and application thereof. Background Art

[0002] D-psicose is an important rare sugar with a sweetness similar to sucrose, but it does not undergo human metabolism and has the characteristics of low calories, so it has attracted widespread attention. At present, chemical synthesis and biosynthesis are mainly used to prepare D-psicose. The chemical synthesis method mainly uses certain chemical reactions to synthesize D-psicose. However, no matter which chemical synthesis method is used, it faces many defects such as the generation of by-products, difficulty in separation, and excessive pollution caused by complex reaction processes. The biosynthesis method uses certain specific enzymes or microbial cells as catalysts to produce D-psicose using relatively cheap monosaccharides (such as fructose and glucose) as raw materials. In this process, D-psicose-3 epimerase (DPE) is extremely important. This method uses DPE pure enzyme or DPE-producing engineered bacteria to complete the conversion reaction from D-fructose to D-psicose through whole-cell catalysis.

[0003] About 30 types of DPE have been reported, and the equilibrium conversion rate is basically between 24% and 33%. DPE mainly comes from plants and microorganisms. With the continuous development of biotechnology, people will be able to improve and optimize DPE through genetic engineering and other means to improve its catalytic efficiency and stability, so as to better meet the needs of different fields. At present, some DPE have been identified and isolated from many different strains, but the expression level of wild-type strain enzymes is far lower than expected and cannot be applied to industrial production. Therefore, constructing expression vectors and expressing them in heterologous organisms is of great significance for the study of enzyme characteristics and industrial application.

[0004] In recent years, the main engineering bacteria expression systems for expressing DPE include Escherichia coli, yeast and Bacillus subtilis expression systems. Escherichia coli has many advantages such as high gene expression level, relatively complete expression system, and easy cultivation; but in industrial production, Escherichia coli expression system is often not a good choice. On the one hand, Escherichia coli has endotoxins and is not a recognized safe (GRAS) host; on the other hand, Escherichia coli is a Gram-negative bacterium with a double membrane, so the secretion of proteins is poor. Most industrial proteins are produced inside Escherichia coli cells, which makes the purification process of DPE more complicated. Yeast can also be used as a host bacteria for DPE expression, and many yeasts are food-grade microorganisms (GRAS). The yeast expression system has the advantages of simple culture conditions and low operation difficulty. However, its cloned gene expression effect is low, the fermentation time is long, and the supernatant polysaccharide concentration is high, which is not conducive to protein purification.

[0005] In recent years, more and more researchers have begun to use Bacillus subtilis as a host bacteria to express DPE. This is mainly because Bacillus subtilis is a food-grade microorganism (GRAS), suitable for industrial production, and it is a Gram-positive bacterium with only one membrane, which is conducive to protein secretion. It also has the advantages of simple fermentation process and no codon preference.

[0006] Therefore, providing a recombinant Bacillus subtilis and its application is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0007] In view of this, the present invention provides a recombinant Bacillus subtilis and its application, which solves the problems of the safety of DPE in the selection of expression system and the instability of the expression of recombinant plasmid in host cells.

[0008] Since Bacillus subtilis has many advantages and current research uses recombinant plasmids for expression in host bacteria, in order to overcome unsafe factors such as plasmid instability and antibiotics, the present invention selects Bacillus subtilis as the expression host and integrates DPE into the genome for expression to improve the enzyme activity and stability of DPE in Bacillus subtilis.

[0009] In order to achieve the above object, the present invention adopts the following technical solution:

[0010] A recombinant expression vector pWB980-16sDNA-DPE-CcDPE, which contains 16sDNA gene sequence, DPE gene sequence and CcDPE gene sequence in sequence;

[0011] The 16sDNA gene sequence is shown as SEQ ID NO.3; the DPE gene sequence is shown as SEQ ID NO.1; and the CcDPE gene sequence is shown as SEQ ID NO.2.

[0012] Furthermore, the basic vector for constructing the recombinant expression vector pWB980-16sDNA-DPE-CcDPE is the pWB980 vector.

[0013] Furthermore, the recombinant expression vector pWB980-16sDNA-DPE-CcDPE is used to improve the activity of DPE enzyme.

[0014] Furthermore, a recombinant Bacillus subtilis contains the recombinant expression vector pWB980-16sDNA-DPE-CcDPE.

[0015] Furthermore, the recombinant Bacillus subtilis is used to improve the activity of DPE enzyme.

[0016] It can be seen from the above technical scheme that compared with the prior art, the present invention discloses a recombinant Bacillus subtilis and its application. The recombinant Bacillus subtilis integrates the genes of D-psicose-3 epimerase from two different sources into the Bacillus subtilis genome by using the 16sDNA of Bacillus subtilis as the integration site, and uses the food safety strain Bacillus subtilis as the chassis bacteria for heterologous expression, thereby effectively promoting the expression of D-psicose-3 epimerase (DPE), so that the enzyme activity of DPE produced by shake flask fermentation is 3655.42 U / ml, which is 36% higher than that of the original control group, and the stability of DPE expression in Bacillus subtilis is improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0018] Figure 1 The accompanying drawing is a map of the pWB980-16sDNA-DPE-CcDPE vector of the present invention;

[0019] Figure 2 The accompanying drawing is a nucleic acid gel electrophoresis diagram of the plasmid vector pWB980-16sDNA-DPE-CcDPE constructed in the present invention for verification;

[0020] Among them, M is a 5000 bp DNA marker; #1, #2, and #3 are the PCR results of different positive clone plasmids obtained by colony screening;

[0021] Figure 3 The accompanying drawing is a nucleic acid gel electrophoresis diagram of the verification after the plasmid vector pWB980-16sDNA-DPE-CcDPE of the present invention is transformed into a Bacillus subtilis host;

[0022] Among them, M is a 5000 bp DNA marker; #1, #2, and #3 are the genomic PCR results of different positive clones obtained by colony screening;

[0023] Figure 4 The accompanying figure shows the enzyme activity determination of the recombinant strain of the present invention in high-density fermentation. DETAILED DESCRIPTION

[0024] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] The DPE gene sequence is shown in SEQ ID NO.1.

[0026] ATGAAATATGGTATTTATTACGCTTATTGGGAAAAGGAATGGAATGGAGATTACAAATATTATATAGATAAAATTTCAAAATTAGGTTTTGATATTCTGGAAATTTCTTGCGGCGCTTTTTCTGACTATTACACGAAAGATCAGGAGTTAATTGATATTGGAAAATATGCGAAAGAAAAAGGCGTAACATTGACAGCAGGGTATGGACCTCATTTTAATGAAAGCCTGTCATCTTCAGAACCCAATACGCAGAAACAAGCAATCAGTTTTTGGAAAGAGACGCTCCGGAAATTGAAGTTAATGGATATTCATATTGTTGGAGGCGCACTCTATGGTTATTGGCCTGTAGATTATTCCAAACCTTTTGATAAGAAAAGGGATTTAGAGAATTCCATTAAAAACATGAAAATTATTAGTCAGTATGCTGAAGAATATGACATAATGATGGGGATGGAAGTTCTTAACCGTTTTGAAGGCTATATGTTGAATACATGCGATGAAGCGTTGGCATACGTTGAAGAGGTTGGCTCTTCTAATGTTGGTGTTATGTTAGATACTTTTCACATGAATATAGAGGAAGATAATATAGCAGCAGCCATTCGTAAAGCAGGAGATAGGCTTTATCACTTCCATATAGGAGAAGGAAATCGTAAAGTACCAGGAAAAGGTATGCTTCCTTGGAATGAGATAGGACAGGCATTGCGAGATATAAACTACCAACATGCAGCAGTTATGGAGCCATTTGTAATGCAGGGAGGAACAGTAGGGCATGACATTAAAATATGGAGAGATATCATTGGAAACTGTTCTGAAGTTACATTAGATATGGACGCTCAAAGTGC GTTGCACTTTGTAAAACATGTATTTGAAGTCTAA ; SEQ ID NO.1.

[0027] The CcDPE gene sequence is shown in SEQ ID NO.2.

[0028] ATGAAACATGGCATCTATTATGCGTATTGGGAACAAGAATGGGAAGCGGATTATAAGTATTATATCGAAAAAGTCGCGAAACTGGGCTTTGATATACTTGAAATTGCAGCGAGCCCTTTACCGTTTTATTCAGACATCCAAATCAACGAGCTTAAAGCGTGCGCACATGGCAATGGCATTACACTGACAGTGGGACACGGACCTAGCGCAGAACAAAATCTGTCATCACCTGATCCGGATATACGCAAAAATGCGAAAGCATTTTATACTGACCTTCTTAAACGCCTGTACAAGCTGGATGTCCATCTGATCGGAGGCGCGCTGTATAGCTATTGGCCGATCGATTATACGAAAACGATTGATAAAAAAGGCGATTGGGAACGCTCTGTGGAATCAGTTCGTGAAGTTGCGAAAGTCGCGGAAGCGTGCGGAGTTGATTTTTGCCTTGAAGTGCTTAATCGCTTTGAAAATTATCTGATCAATACAGCACAAGAAGGCGTCGATTTTGTCAAACAAGTCGATCATAATAACGTCAAAGTCATGCTGGATACGTTTCACATGAATATCGAAGAAGATAGCATTGGGGGTGCAATTCGTACGGCAGGCAGCTACCTTGGACATCTTCATACAGGCGAATGCAATCGTAAAGTTCCGGGACGGGGCCGCATCCCGTGGGTTGAAATCGGCGAAGCACTTGCAGATATTGGCTATAATGGCTCAGTGGTTATGGAACCGTTTGTTCGTATGGGAGGCACGGTCGGCTCTAATATCAAAGTCTGGAGAGATATTTCTAATGGCGCGGATGAAAAAATGTTAGATAGAGAAGCACAAGCAGCGTTAGATTTTAGC CGGTATGTGTTAGAATGCCATAAACATTCTTAA ; SEQ ID NO.2.

[0029] The 16sDNA gene sequence is as shown in SEQ ID NO.3.

[0030] CTATACATGCAAGTCGAGCGGATGGAGCCAGCCGCCGAA ; SEQ ID NO.3.

[0031] Culture medium formula:

[0032] Escherichia coli culture medium (LB liquid medium): 0.5% yeast extract, 1% peptone, 1% sodium chloride, pH 7.0 (1% agar powder is added to the solid medium);

[0033] Fermentation medium formula: 1.8% yeast powder, 0.9% peptone, 72mM dipotassium hydrogen phosphate, 17mM potassium dihydrogen phosphate, 0.4% glycerol, 1mM manganese chloride.

[0034] Example 1 Construction of plasmid pWB980-DPE

[0035] The DPE gene sequence from Ruminococcus CAG55 (as shown in SEQ ID NO.1) was connected to the pWB980 vector by homologous recombination to obtain the recombinant vector pWB980-DPE. The primers used were as follows:

[0036] pWB-F1: 5'-TAATTCAGCACAATTCCAAGAAAAACACG-3'; SEQ ID NO.4;

[0037] pWB-R1: 5'-CGTTCATGTCTCCTTTTTTATGTACTGT-3'; SEQ ID NO. 5.

[0038] DPE-F:

[0039] 5'-TAAAAAAGGAGACATGAACG ATGAAATATGGTATTTATTACGCTTATTGGGAAAAG -3'; SEQ ID NO.6;

[0040] DPE-R:

[0041] 5'-CTTGGAATTGTGCTGAATTA TTAGACTTCAAATACATGTTTTACAAAGTGCAAC -3'; SEQ ID NO.7;

[0042] Plasmid pWB980 was used as a template and primers pWB-F1 / R1 were used to amplify the pWB980 vector fragment. The reaction system was: 2× PrimeSTAR Max Premix 25μL, upstream primer 2μL, downstream primer 2μL, DNA template (plasmid) 1μL, ddH2O 20μL, a total of 50μL. The reaction procedure was: 98℃ pre-denaturation for 3min; 98℃ denaturation for 10s, 58℃ annealing for 15s, 72℃ extension for 2min, 32 cycles; 72℃ final extension for 5min; 12℃ insulation.

[0043] The synthesized DPE gene DNA was used as a template and primers DPE-F / R were used to amplify the DPE fragment. The reaction system was the same as above. The reaction procedure was: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 58°C annealing for 15 s, 72°C extension for 1 min, 32 cycles; 72°C final extension for 5 min; 12°C insulation.

[0044] The DPE fragment was homologously recombined with the pWB980 vector fragment using the Minerva SuperFusuon Cloning Kit. The ligation system was: 2 μL homologous recombination enzyme, 4 μL buffer, 1 μL vector fragment, 1 μL target gene fragment, 12 μL ddH2O, a total of 20 μL. The ligation procedure was 50°C for 30 min. The plasmid pWB980-DPE was constructed.

[0045] Example 2 Construction of plasmid pWB980-16sDNA-DPE-CcDPE

[0046] The 16sDNA gene sequence from Bacillus subtilis (as shown in SEQ ID NO.3), the DPE gene sequence from Ruminococcus CAG55 (as shown in SEQ ID NO.1), and the CcDPE gene sequence from Clostridium cellulolyticum H10 (as shown in SEQ ID NO.2) were sequentially connected to the pWB980 vector by homologous recombination. 43 As promoter, recombinant vector was obtained. The primers used were as follows:

[0047] 16-F: 5'-CATTATTGAGTGGATGATTA CTATACATGCAAGTCGAGCGG -3'; SEQ ID NO.8;

[0048] 16-R:5'-ACCACCTATCAAAAGGAATA TTCGGCGGCTGGCTCCAT -3'; SEQ ID NO.9;

[0049] DPE-F: Same as above;

[0050] DPE-R2:

[0051] 5'-TACTGTGTTAGCGGTCTGCTTCTTCCAGCCCTCC TTAGACTTCAAATACATGTTTTACAAAGTGC AAC -3'; SEQ ID NO.10;

[0052] CcDPE-F:

[0053] 5'-CAGACCGCTAACACAGTACATAAAAAAGGAGACATGAACG ATGAAACATGGCATCTATTATGCGT AT -3'; SEQ ID NO.11;

[0054] CcDPE-R:

[0055] 5'-CTTGGAATTGTGCTGAATTA TTAAGAATGTTTATGGCATTCTAACACATACCG -3'; SEQ ID NO.12;

[0056] pWB-P43-F: 5'-TATTCCTTTTGATAGGTGGTATGTTTTCGCTTG-3'; SEQ ID NO. 13;

[0057] pWB-P43-R: 5'-TAATCATCCACTCAATAATGCTGAGCTCG-3'; SEQ ID NO. 14.

[0058] Using plasmid pWB980 as template, primers pWB-P43-F / R were used to amplify the pWB980-P43 vector fragment. The reaction system was: 2× PrimeSTAR Max Premix 25μL, upstream primer 2μL, downstream primer 2μL, DNA template (plasmid) 1μL, ddH2O 20μL, a total of 50μL. The reaction program was: 98℃ pre-denaturation for 3min; 98℃ denaturation for 10s, 58℃ annealing for 15s, 72℃ extension for 2min 30s, 32 cycles; 72℃ final extension for 5min; 12℃ insulation.

[0059] The genomic DNA of Bacillus subtilis WB600 was used as a template and primers 16-F / R were used to amplify the 16sDNA fragment. The reaction system was the same as above. The reaction procedure was: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 58°C annealing for 15 s, 72°C extension for 1 min, 32 cycles; 72°C final extension for 5 min; 12°C insulation.

[0060] The 16sDNA fragment was homologously recombined with the vector (pWB980-P43 vector fragment) using Minerva SuperFusuon Cloning Kit. The ligation system was: 2 μL homologous recombination enzyme, 4 μL buffer, 1 μL vector fragment, 1 μL target gene fragment, 12 μL ddH2O, a total of 20 μL. The ligation procedure was 50°C for 30 min. The plasmid pWB980-16sDNA was constructed.

[0061] The pWB980-16sDNA vector fragment was amplified using the above-constructed plasmid pWB980-16sDNA as a template and primers pWB-F1 / R1. The reaction system was: 2× PrimeSTAR Max Premix 25μL, upstream primer 2μL, downstream primer 2μL, DNA template (plasmid) 1μL, ddH2O 20μL, a total of 50μL. The reaction procedure was: 98℃ pre-denaturation for 3min; 98℃ denaturation for 10s, 58℃ annealing for 15s, 72℃ extension for 3min, 32 cycles; 72℃ final extension for 5min; 12℃ insulation.

[0062] The synthesized DPE gene DNA was used as a template and primer DPE-F / R2 was used to amplify the DPE fragment. The reaction system was the same as above. The reaction procedure was: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 58°C annealing for 15 s, 72°C extension for 1 min, 32 cycles; 72°C final extension for 5 min; 12°C insulation.

[0063] The synthesized CcDPE gene was used as a template and primers CcDPE-F / R were used to amplify the CcDPE fragment. The reaction system was the same as above. The reaction procedure was: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 58°C annealing for 15 s, 72°C extension for 1 min, 32 cycles; 72°C final extension for 5 min; 12°C insulation.

[0064] The DPE, CcDPE fragments and vector (pWB980-16sDNA vector fragment) were homologously recombined using Minerva SuperFusuon CloningKit. The ligation system was: 2 μL homologous recombination enzyme, 4 μL buffer, 1 μL pWB980 vector fragment, 1 μL each of two target gene fragments, 11 μL ddH2O, a total of 20 μL. The ligation procedure was 50°C for 30 min.

[0065] The ligated vector pWB980-16sDNA-DPE-CcDPE (vector map see Figure 1 ) was transformed into E. coli DH5α competent cells, ice bathed for 30min, 42℃45s, 900μL LB liquid medium was added, 37℃220r / min 60min, 100μL supernatant was retained after centrifugation, mixed with bacteria and all coated on LB solid plate containing 50μg / ml kanamycin, inverted and cultured at 37℃ overnight (about 16h), single clone colonies were picked, plasmids were extracted, and PCR verification was performed. The verification primers were pWB980-CX-F / R. The specific sequences are as follows:

[0066] pWB980-CX-F: 5'-GGCAAGGGTTTAAAGGTGGAGAT-3'; SEQ ID NO. 15;

[0067] pWB980-CX-R: 5'-CACTTCAACGCACCTTTCAGCAA-3'; SEQ ID NO. 16.

[0068] Reaction system: 2× Prime STARMax Premix 5μL, upstream and downstream primers 1μL each, plasmid template 1μL, ddH2O to 10μL. Reaction procedure: 98℃ pre-denaturation 3min; 98℃ denaturation 10s, 58℃ annealing 15s, 72℃ extension 2min, 32 cycles; 72℃ final extension 5min; 4℃ insulation. PCR verification results are shown in Figure 2 .

[0069] Example 3 Construction of recombinant strains

[0070] Add 50ng plasmid pWB980-16sDNA-DPE-CcDPE (1-8μl) to 60μl Bacillus subtilis WB600 competent cells, incubate on ice for 2min, add to the pre-cooled electroporation cup (1mm), and electroporate once. Electroporation instrument settings: 2.0kv, 1mm, 1 electroporation; after the electroporation, remove the cup and immediately add 1ml RM (LB liquid medium + 0.5M sorbitol + 0.38M mannitol), 37℃, 200rpm, after 3h of recovery, centrifuge and leave 100μL supernatant, mix with the bacteria and spread all on the LB solid plate containing 50μg / ml kanamycin, and culture in a 37℃ incubator overnight. The colony was screened for positive clones through resistance, and the genome was extracted for PCR verification, and the verification primer was 16s-genome-F / pw-cx-R. The specific sequence is as follows:

[0071] 16s-genome-F: 5'-GTCAAACTAGGGCCTGCACGA-3'; SEQ ID NO.17;

[0072] pw-cx-R: 5'-CCAATGATACACGAAATCACGGC-3'; SEQ ID NO. 18.

[0073] Reaction system: 2× Prime STAR Max Premix 5μL, upstream and downstream primers 1μL each, genomic template 1μL, ddH2O to 10μL. Reaction procedure: 98℃ pre-denaturation 3min; 98℃ denaturation 10s, 60℃ annealing 15s, 72℃ extension 1min, 32 cycles; 72℃ final extension 5min; 12℃ insulation. PCR verification results are shown inFigure 3 The constructed strain was named Ba.-pWB980-16sDNA-DPE-CcDPE.

[0074] Example 4 Fermentation of recombinant strains and enzyme activity determination

[0075] Fermentation culture:

[0076] Pick a single colony grown on the plate and transfer it to a liquid culture tube (5 ml LB liquid culture medium + 50 μg / ml kanamycin), culture at 37°C, 220 rpm for 10 h or overnight, and obtain the OD 600 The seed solution was inoculated with 1‰ of the seed solution into 30 ml of fermentation medium containing 1‰ kanamycin (50 mg / ml) and cultured for 48 hours. The activity of D-psicose-3 epimerase in the fermentation broth of each transformant was determined by the following method.

[0077] D-psicose-3-epimerase activity assay:

[0078] (1) Definition of D-psicose-3-epimerase activity unit

[0079] At 55°C and pH 7.5, the amount of enzyme required to produce 1 μmol of D-psicose per minute is one enzyme activity unit (U).

[0080] (2) Measurement method

[0081] Take fresh fermentation broth and centrifuge it, and the clear liquid is the sample to be tested. Take a 1ml centrifuge tube, add 960μl of potassium dihydrogen phosphate-potassium dihydrogen phosphate buffer (72mM potassium dihydrogen phosphate, 17mM potassium dihydrogen phosphate), add 20μl of 50% fructose solution, add 10μl of manganese chloride solution (100mM), and finally add 10μl of clear liquid and shake well. Turn on the induction cooker for heating and set aside. Quickly place it in a 55℃ water bath, after a 10min water bath, put it in a heated induction cooker, boil for 5min, take it out, cool, and centrifuge it again to obtain the supernatant. The supernatant enters the liquid phase, the fructose peak time is about 12 minutes, the D-psicose peak time is about 19 minutes, and the liquid phase setting time is 25min.

[0082] (3) Enzyme activity assay results

[0083] According to the above enzyme activity determination method, the D-psicose-3 epimerase activity was determined using Ba.-pWB980-DPE (pWB980-DPE transformed into Bacillus subtilis competent cells, the same operation as above) as a control. The results showed that the enzyme activity in the control group (Ba.-pWB980-DPE) transformants reached 2688.40 U / ml; the fermentation enzyme activity in the experimental group (Ba.-pWB980-16sDNA-DPE-CcDPE) transformants reached 3655.42 U / ml, and the enzyme activity in the experimental group increased by 36% compared with the control group.

[0084] Example 5 High-density fermentation of recombinant strains and enzyme activity determination

[0085] Pick a single colony from the strain Ba.-pWB980-16sDNA-DPE-CcDPE plate and transfer it to a test tube (5 mL LB liquid medium) and culture at 37°C for 9-10 h; OD 600 At 4:00, transfer to a large shake flask (2L LB liquid medium), inoculate with 0.5‰ of bacterial solution, and culture for 12-14h. OD 600 When the cells grow to 3, transfer to a fermenter (containing 10 LLB liquid medium). Before each inoculation, add 1‰ of a separately sterilized 50 mg / ml kanamycin solution. 600 When the growth reaches 4 hours, 50% glucose solution is added to supplement the carbon source, and the reducing sugar is maintained at 0.3-0.5g / 100mL by adding sugar solution. Ammonia water is used to adjust the pH to 7.0. The fermentation cycle is 48h.

[0086] At the end of the fermentation, the bacterial concentration and enzyme activity were measured according to Example 3. The results are as follows: Figure 4 It shows that the bacterial concentration increases with time. When the fermentation reaches 46h, the bacterial concentration OD 600 Reached 111.8, and DPE enzyme activity reached 14830.40U / ml.

[0087] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A recombinant expression vector pWB980-16sDNA-DPE-CcDPE, characterized in that: It contains 16sDNA gene sequence, DPE gene sequence, and CcDPE gene sequence in sequence; The 16sDNA gene sequence is shown as SEQ ID NO.3; the DPE gene sequence is shown as SEQ ID NO.1; and the CcDPE gene sequence is shown as SEQ ID NO.

2.

2. A recombinant expression vector pWB980-16sDNA-DPE-Cc DPE according to claim 1, characterized in that: The base vector is pWB980 vector.

3. Use of the recombinant expression vector pWB980-16sDNA-DPE-CcDPE according to claim 1 or 2 in improving DPE enzyme activity.

4. A recombinant Bacillus subtilis, characterized in that: Contains the recombinant expression vector pWB980-16sDNA-DPE-CcDPE according to claim 1 or 2.

5. Use of the recombinant Bacillus subtilis according to claim 4 in improving DPE enzyme activity.

Images