Application of heterologous expression Miricin2 peptide in enhancing insecticidal activity of pathogenic fungi

Abstract

The invention provides an application of a heterologous expression Miricin2 peptide in enhancing the insecticidal activity of pathogenic fungi. The invention discloses a method for promoting the killing ability of entomopathogenic fungi to insect hosts of the entomopathogenic fungi. The method comprises the step of expressing a heterologous Miricin2 peptide in the entomopathogenic fungi. The enhancement of the killing ability comprises shortening the killing time, improving the killing efficiency and the like. According to the invention, the ability of fungal cells to infect insects and parasitize the insects is effectively combined with the application of the Miricin2 peptide, so that the insect killing efficiency of the entomopathogenic fungi is greatly improved. Moreover, the production of resistance in the host is not observed.

Description

Technical Field

[0001] The present invention belongs to the field of agricultural science, and more specifically, the present invention relates to the application of heterologously expressed Moricin2 peptide in enhancing the insecticidal activity of pathogenic fungi. Background Art

[0002] Agricultural and forestry pests and insect-borne pests pose a great threat to human survival and health, such as causing crop yield reduction, spreading diseases, and endangering forestry development. For example, lepidopteran pests cause huge economic losses to agriculture and forestry every year. Diptera pests represented by mosquitoes can spread various diseases, such as malaria, dengue fever and Zika. In this field, although some biological control methods have been developed, pest control still relies on chemical pesticides to a large extent. However, chemical pesticides can pollute the living environment of humans and bring great harm to human health. In addition, the problem of pest resistance is becoming more and more serious, which limits the application of chemical pesticides.

[0003] Entomophilous fungi, such as Metarhizium and Beauveria, are effective biological control microorganisms for insect pests. They are greener, more environmentally friendly and more sustainable than chemical pesticides, but they also have the disadvantage of being slower to take effect than the latter.

[0004] For a long time, those skilled in the art have tried various methods to enhance the insecticidal effect of insect pathogenic fungi. Some studies have shown that overexpression of one or more virulence factors using genetic engineering is an effective way to improve the insecticidal toxicity of insect pathogenic fungi, in which obtaining effective virulence genes is the most critical factor. However, the number of virulence factors that can be used for strain genetic modification is limited, mainly derived from insect pathogenic fungi themselves, such as proteolytic enzymes (Pr1, Pr2), protein kinases (Snf1, Mpk1) and various toxins (beauvericin, cyclosporin). In addition, virulence factors from other species can also be used to improve the insecticidal toxicity of insect pathogenic fungi, such as Scorpine, SM1, chitinase, etc. Although some virulence factors can be used in theory, they encounter expression barriers or biological barriers / immune barriers in organisms and the effect is not ideal, which greatly limits the application of known virulence factors in the genetic modification of insect pathogenic fungi. Those skilled in the art have also attempted to simultaneously express multiple virulence factors in insect pathogenic fungi to improve their insecticidal toxicity, but due to the limited number of effective virulence genes, the shortcomings of single targeting of virulence genes and the susceptibility of pests to insecticidal proteins, it is difficult to achieve the desired effect in the long term.

[0005] The conidia of insect pathogenic fungi attach to the insect body surface, and then the spores germinate to form the infection structure - the appressorium, which is the first step to successfully complete the infection. If the spores cannot germinate normally, the insect pathogenic fungi will find it difficult to penetrate the insect body wall and enter the insect body to cause infection. How to avoid this phenomenon that makes it difficult for insect pathogenic fungi to penetrate the insect body wall is also a difficult problem in this field.

[0006] Under the above-mentioned current situation in the field, finding insecticidal effector factors that are safe, highly effective and not prone to resistance is of great significance for the genetic modification of insect pathogenic fungi and their promotion and application. Summary of the invention

[0007] The purpose of the present invention is to provide the use of heterologously expressed Moricin2 peptide in enhancing the insecticidal activity of pathogenic fungi.

[0008] In a first aspect of the present invention, a method for enhancing the killing ability of insect pathogenic fungi to their insect hosts is provided, comprising: expressing a heterologous Moricin2 peptide in the insect pathogenic fungi.

[0009] In one or more preferred embodiments, the enhancement of the killing ability of insect pathogenic fungi to their insect hosts includes: shortening the killing time and improving the killing efficiency.

[0010] In one or more preferred embodiments, the Moricin 2 peptide is expressed by heterologously introducing an expression construct into an insect pathogenic fungus.

[0011] In one or more preferred embodiments, the expression in insect pathogenic fungi is secretory expression.

[0012] In one or more preferred embodiments, the expression construct has an expression cassette for Moricin2 peptide, including: mcl1 mRNA 5′-untranslated region, MCL1 signal peptide encoding nucleic acid, and Moricin2 encoding nucleic acid.

[0013] In one or more preferred embodiments, the nucleotide sequence of the mcl1 mRNA 5′-untranslated region is shown at positions 8-104 in SEQ ID NO:2, the nucleotide sequence of the MCL1 signal peptide encoding nucleic acid is shown at positions 105-161 in SEQ ID NO:2, and the nucleotide sequence of the Moricin2 encoding nucleic acid is shown at positions 162-290 in SEQ ID NO:2.

[0014] In one or more preferred embodiments, the expression cassette comprises the nucleotide sequence shown in SEQ ID NO:2.

[0015] In one or more preferred embodiments, the expression cassette further comprises a promoter upstream of the 5′-untranslated region of mcl1 mRNA; more preferably, the promoter comprises: Aureobasidium pullulans translation elongation factor tef.

[0016] In one or more preferred embodiments, the insect pathogenic fungus is an insect pathogenic fungus that parasitizes an insect host, thereby inhibiting the insect host, or an insect pathogenic fungus that can produce metabolites, thereby inhibiting the insect host.

[0017] In one or more preferred embodiments, the insect pathogenic fungi include (but are not limited to) fungi selected from the group consisting of Chlorophyllum and Beauveria bassiana.

[0018] In one or more preferred embodiments, the insects include (but are not limited to) insects selected from the following groups: Diptera, Orthoptera, Lepidoptera, Homoptera, Coleoptera, Hemiptera, Hymenoptera, Neuroptera.

[0019] In one or more preferred embodiments, the method further comprises: culturing the insect pathogenic fungus and harvesting spores that have killing ability to insect hosts.

[0020] In one or more preferred embodiments, the Moricin2 peptide is a protein having an amino acid sequence as shown in SEQ ID NO: 1 or a conservative variant protein thereof.

[0021] In one or more embodiments, the conservative variant protein includes: (a) a derivative protein formed by replacing, deleting or adding one or more (such as 1-30 or 1-20; preferably 1-15; preferably 1-10; preferably 1-5, 1-3 or 1-2) amino acid residues of the amino acid sequence shown in SEQ ID NO:1, and having the function of the amino acid sequence protein shown in SEQ ID NO:1; (b) a derivative protein whose amino acid sequence is more than 80% (preferably more than 85%, more than 90% or more than 95%; such as more than 98% or more than 99%) identical to the amino acid sequence shown in SEQ ID NO:1, and having the function of the amino acid sequence protein shown in SEQ ID NO:1; or (c) a protein formed by adding a tag or signal peptide sequence to the N or C terminus of the amino acid sequence shown in SEQ ID NO:1.

[0022] In another aspect of the present invention, there is provided an application of Moricin2 peptide or its encoding nucleic acid, an expression cassette or an expression construct expressing Moricin2 peptide, for enhancing the killing ability of insect pathogenic fungi to their insect hosts, or for preparing insect pathogenic fungi with enhanced killing ability; preferably, the enhancement of the killing ability of insect pathogenic fungi to their insect hosts includes: shortening the killing time and improving the killing efficiency.

[0023] In another aspect of the present invention, a modified insect pathogenic fungus or spores produced therefrom is provided, wherein the insect pathogenic fungus or spores produced therefrom express a heterologous Moricin2 peptide and have an enhanced ability to kill its insect host (significantly higher than the insect pathogenic fungus or spores produced therefrom before modification).

[0024] In one or more preferred embodiments, the Moricin2 peptide is a protein having an amino acid sequence as shown in SEQ ID NO: 1 or a conservative variant protein thereof.

[0025] In one or more preferred embodiments, the insect pathogenic fungus or the spores produced therefrom include a heterologous expression construct, wherein the expression cassette having the Moricin2 peptide includes: mcl1 mRNA 5′-untranslated region, MCL1 signal peptide encoding nucleic acid, Moricin2 encoding nucleic acid; more preferably, the expression cassette also includes a promoter upstream of the mcl1 mRNA 5′-untranslated region; more preferably, the promoter includes: Aureobasidium pullulans translation elongation factor tef.

[0026] In another aspect of the present invention, there is provided a use of the insect pathogenic fungus or the spores produced thereby for controlling (injuring / killing) insects, or for preparing a composition for controlling (injuring / killing) insects; preferably, the insects include (but are not limited to) insects selected from the following group: Diptera, Orthoptera, Lepidoptera, Homoptera, Coleoptera, Hemiptera, Hymenoptera, Neuroptera.

[0027] In another aspect of the present invention, a composition for controlling (injuring / killing) insects is provided, the composition comprising: the insect pathogenic fungus or spores produced thereby; and a pesticide-acceptable carrier or excipient.

[0028] In one or more preferred embodiments, the composition contains spores of insect pathogenic fungi at a concentration of 1×10 3 ~1×10 13 spores / mL; preferably 1×10 4 ~1×1012 spores / mL; preferably 1×10 5 ~1×10 11 spores / mL (e.g. 10 6 , 10 7 , 10 8 , 10 9 , 10 10 spores / mL).

[0029] In another aspect of the present invention, a method for controlling (killing / eliminating) insects is provided, comprising: applying the insect pathogenic fungus or the spores produced thereby, or the composition to the insect or an object infected by the insect (such as a plant or a place); preferably, the insect includes (but is not limited to) insects selected from the following group: Diptera, Orthoptera, Lepidoptera, Homoptera, Coleoptera, Hemiptera, Hymenoptera, Neuroptera.

[0030] In another aspect of the present invention, a kit for controlling (injuring / killing) insects is provided, comprising the insect pathogenic fungus or the spores produced thereby, or the composition.

[0031] Other aspects of the present invention will be apparent to those skilled in the art in view of the disclosure herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 , schematic diagram of the construction of pDHt-bar-tef-TransMoricin2 plasmid.

[0033] Figure 2 , expression level determination of each Metarhizium transformant; A. Relative expression level, B. Electrophoresis diagram of the expression level of each Metarhizium transformant, the upper part is the target transformation gene Moricin2, and the lower part is the control gene Tubulin.

[0034] Figure 3 , and the survival curves of the wild type and transformants of Metarhizium Roberti against Drosophila melanogaster.

[0035] Figure 4 , and the bioassay survival curves of the wild type and transformants of Metarhizium Roberti against Culex pipiens.

[0036] Figure 5 , and the bioassay survival curves of wild type and transformants of Metarhizium Roberti against locusts. DETAILED DESCRIPTION

[0037] In order to develop safe and effective biological agents for controlling pests, the inventors, based on extensive research, have disclosed a method for enhancing the killing ability of insect pathogenic fungi to their insect hosts, including expressing heterologous Moricin2 peptides in insect pathogenic fungi. The enhanced killing ability includes shortening the killing time, improving the killing efficiency, etc. The present invention effectively combines the ability of fungal cells to infect and parasitize insects with the application of Moricin2 peptides, greatly improving the insect killing efficiency of insect pathogenic fungi. In addition, no resistance in the host was observed.

[0038] Moricin2 peptide is a polypeptide derived from silkworms. It has been used to play an antibacterial / bactericidal / sterilizing role in the past. However, it is found in the present invention that it can play a synergistic role with insect pathogenic fungi when introduced into insect pathogenic fungi, and promote the killing ability of insect pathogenic fungi to insects. It is known in the art that insects and microbial bacteria are different types of organisms, and peptides with antibacterial effects, which themselves do not kill pathogenic fungi, can be used to promote the killing effect of pathogenic fungi on insects, which is unexpected.

[0039] the term

[0040] As used in the present invention, the "insect pathogenic fungi" refers to a type of fungi, whose bodies, genes or gene products or their progeny (such as spores) can be used to reduce harmful organisms. Generally, the "insect pathogenic fungi" have fungi selected from the following characteristics: (a) can parasitize on the surface or body of insects, (b) can infect and kill insects; preferably, it is a type of insect pathogenic fungi that has the ability to infect insects and can parasitize insects. For example, Metarhizium and Beauveria bassiana, as insect pathogenic fungi, can penetrate the insect body surface, enter the blood cavity, inhibit host immunity and proliferation, kill the insect, and then produce spores on the insect body surface and carry out the next round of infection.

[0041] As used in the present invention, the "insect pathogenic fungi" are also called "entomopathogenic fungi", which refer to fungi that can invade insects, parasitize them, and cause them to become sick.

[0042] As used in the present invention, the "host" and "host" are used interchangeably and refer to insects that can be infected by the insect pathogenic fungus.

[0043] As used in the present invention, the "plant" is not particularly limited, as long as the "plant" is capable of or easily harmed by insect-borne pathogens or harmful insects (such as the host of the insect pathogenic fungi of the present invention), such as various crops, flower plants, herbaceous plants, woody plants, forestry plants, etc. The plant can be, for example (but not limited to): dicotyledonous plants, monocotyledonous plants, or gymnosperms. More specifically, the plant includes (but not limited to): grass plants, cruciferous plants, etc.

[0044] As used herein, "exogenous" or "heterologous" refers to the relationship between two or more nucleic acid or protein (polypeptide) sequences from different sources, or the relationship between nucleic acids or proteins from different sources and host cells. For example, if the combination of nucleic acid / protein and host cell does not normally occur naturally, the nucleic acid is exogenous to the host cell. A particular sequence is "exogenous" to the cell or organism into which it is inserted.

[0045] As used in the present invention, the "(expression) construct" or "(expression) construct" refers to a recombinant DNA molecule, which comprises a desired nucleic acid coding sequence, which may comprise one or more gene expression cassettes. The "construct" is usually contained in an expression vector.

[0046] As used in the present invention, the "expression cassette" refers to a gene expression system containing all necessary elements required to express the target "Moricin2 peptide", which generally includes the following elements: a promoter, a gene sequence for producing the Moricin2 peptide in vivo; these elements are operably linked.

[0047] As used herein, "operably linked" refers to the functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example, a promoter region is placed at a specific position relative to the target gene nucleic acid sequence, so that the transcription of the nucleic acid sequence is guided by the promoter region, and thus the promoter region is "operably linked" to the nucleic acid sequence.

[0048] Insect pathogenic fungi

[0049] The insect pathogenic fungi described in the present invention are fungi that can parasitize an insect host, thereby inhibiting the insect host, or can produce metabolites, thereby causing disease in the insect host.

[0050] Various insect pathogenic fungi can be used in the present invention, provided that they express the Moricin2 peptide from the insect host and are able to parasitize the host or affect the host with their metabolites.

[0051] The insects involved in the present invention are generally the hosts of the insect pathogenic fungi described in the present invention. The insects include natural insects that can be infected by the insect pathogenic fungi and some insects that develop drug resistance based on natural insects. In a preferred embodiment, the insects include: Homoptera, Orthoptera, Lepidoptera, Diptera, Coleoptera, Hemiptera, Hymenoptera, etc. The insects themselves belong to the insecticidal range of the wild-type green muscardine / beauveria, etc., which are broad-spectrum insecticides. Therefore, it can be understood that the present invention can also be widely applied to these insects.

[0052] In some preferred embodiments, the insect pathogenic fungi are entomogenous fungi. In some relatively specific preferred embodiments, the insect pathogenic fungi include fungi selected from the group consisting of: Chlorella vulgaris, Beauveria bassiana, Thompson's polychaete, Verticillium lecanii, Paecilomyces farinosus, Paecilomyces carnosus, Paecilomyces lilacinus, Paecilomyces cicadae, Paecilomyces fumosorum, Gemini shell spore, Citrus whitefly shell, Cladosporium budding, Entomophthora freundii, Nomura lecanii, Chain chytrid, and Pythium guiyangensis.

[0053] Metarhizium anisopliae belongs to the kingdom Fungi, the phylum Ascomycota, the class Sordariomycetes, the orders Hypocreales, and the family Clavicipitaceae. It is a broad-spectrum insect pathogen that can parasitize insects of various orders and families, a total of about 200 species of insects, and can also parasitize mites. It can induce insects to produce green muscardine disease. The colonies of Metarhizium anisopliae are fluffy or cotton-like, initially white, and green when spores are produced, hence the name Green Mushroom. Metarhizium anisopliae invades the body of insects by germinating spores, and reproduces and forms toxins in the body, causing the death of the insects, but is not toxic to plants. After the pathogenic spores formed on the surface of dead insects are dispersed, they can infect other healthy insects again, forming repeated infections within the insect population, which can cause the death of insects within a certain period of time. The way that green fungus infects insects is that conidia attach to the host surface first. After the spores germinate, hyphae are produced, which invade the insect body by mechanical force and enzyme decomposition, secrete toxins to paralyze or kill the insect body, and finally grow a large number of hyphae and form conidia. Its more common hosts include scarab beetles, weevils, wireworms, lepidopteran insect larvae, stink bugs, etc. However, natural green fungus has some aspects that need to be improved, such as slow insecticidal effect or insufficient toxicity.

[0054] Beauveria bassiana belongs to the kingdom Fungi, phylum Ascomycota, class Sordariomycetes, order Hypocreales, family Cordycipitaceae, genus Beauveria. The hyphae have septa and branches. Beauveria bassiana can infect more than 700 species of insects and mites from 15 orders and 149 families, reproduce in large numbers, consume nutrients, destroy insect tissues, and produce toxins to disrupt metabolism and cause insect death. The infection process of Beauveria bassiana on the host generally includes: conidia attachment; spore germination; germ tube penetration of the epidermis; hyphae growth in the hemocoel; production of toxins; killing / injuring the host; hyphae invasion of all organs of the host; hyphae spread out of the epidermis; conidia production; conidia diffusion process. Beauveria bassiana mainly invades through the body wall, and can also invade or kill insects through the spiracles, wounds or digestive tract. However, it has been found in the art that the insecticidal speed of natural strains of Beauveria bassiana is not fast enough or the toxicity is not enough, which needs to be improved. In addition, after long-term application, engineered strains of Beauveria bassiana may evolve resistance to insecticidal proteins or toxins in target insects.

[0055] As a preferred mode of the present invention, the insect pathogenic fungus is Metarhizium anisopliae. According to the demonstration of the specific embodiment of the present invention, Metarhizium anisopliae is used as the starting strain, and the Moricin2 gene is heterologously expressed to obtain Metarhizium anisopliae that expresses and secretes Moricin2 peptide, which helps it to quickly germinate to form an infection structure and penetrate the insect body wall, thereby enhancing its insecticidal activity.

[0056] Although preferred control targets of Metarhizium anisopliae are listed in the embodiments of the present invention, it should be understood based on the disclosure of the present invention that other insect hosts of Metarhizium anisopliae / Beau bassiana can also be inhibited.

[0057] Moricin2 peptide

[0058] In order to improve the inhibitory efficiency of insect pathogenic fungi on their insect hosts, the inventors considered transforming exogenous genes into insect pathogenic fungal cells. After in-depth research, the inventors chose to use a technical solution of introducing Moricin2 peptides from host insects into fungal cells to increase the toxicity of the fungus while reducing the resistance of insects.

[0059] Insects have a natural immune system, mainly including humoral immunity and cellular immunity, which together resist the invasion of external pathogens such as bacteria, fungi, and viruses. Although the immune system of insects is complex, the present invention uses Moricin2 peptide to effectively enhance the killing effect of insect pathogenic fungi on insects. Moricin2 peptide is a peptide derived from silkworm (Bombyx mori) with antibacterial effect. Although there have been certain studies and applications in the field around it, there is no report on using it to enhance the insecticidal activity of insect pathogenic fungi.

[0060] In a preferred embodiment of the present invention, the inventors designed a specific promoter sequence and a signal peptide coding sequence at the 5' end of the gene sequence encoding the Moricin 2 peptide, so that the Moricin 2 peptide can be specifically and highly expressed and secreted outside the fungal cells.

[0061] The present invention provides a polynucleotide, which can encode Moricin 2 peptide. The polynucleotide can be designed according to the gene coding preference of fungi.

[0062] The polynucleotide of the present invention may include, in addition to the polynucleotide encoding the Moricin2 peptide, an additional polynucleotide encoding a signal peptide sequence and / or a ribosomal translation recognition sequence.

[0063] The present invention also relates to variants of Moricin 2 peptide or polynucleotide encoding the same.

[0064] The full-length polynucleotide sequence of the present invention or its fragments can usually be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the relevant nucleotide sequence disclosed in the present invention, especially the open reading frame sequence, and a commercially available cDNA library or a cDNA library prepared by conventional methods known to those skilled in the art is used as a template to amplify the relevant sequence.

[0065] Once the polynucleotide sequence of the present invention is obtained, the sequence can be obtained in large quantities by recombinant methods, which is usually cloned into a vector, then transferred into cells, and then the sequence is isolated from the propagated host cells by conventional methods.

[0066] In addition, the polynucleotide sequence of the present invention can also be synthesized by artificial synthesis, and the artificial synthesis can be a single synthesis (suitable for the case of shorter fragment length) or multiple synthesis (i.e., synthesizing multiple small fragments first and then connecting them). At present, the DNA sequence encoding Moricin2 peptide can be obtained completely by artificial synthesis. Then the DNA sequence can be introduced into appropriate DNA molecules (such as vectors) and cells.

[0067] Modified insect pathogenic fungi

[0068] The present invention also provides a modified insect pathogenic fungus or spores produced therefrom, which express heterologous Moricin2 peptides and have enhanced killing ability to their insect hosts, and their killing ability is significantly higher than that of the insect pathogenic fungus or spores produced therefrom before modification. The enhanced killing ability of the insect pathogenic fungus to its insect host includes: shortening the killing time and improving the killing efficiency.

[0069] In the present invention, an expression construct (expression vector) is provided for achieving good expression in pathogenic fungi. The expression construct has an expression cassette of Moricin2 peptide, including: mcl1mRNA 5′-untranslated region, MCL1 signal peptide encoding nucleic acid, Moricin2 encoding nucleic acid. The signal peptide guides the secretory expression of Moricin2 peptide. The mcl1mRNA 5′-untranslated region (5′UTR) is a sequence located upstream of the coding sequence on the mRNA, which can regulate the translation process.

[0070] Methods well known to those skilled in the art can be used to construct expression vectors containing the promoter and / or target gene sequence of the present invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0071] The construct (expression vector) containing the above-mentioned appropriate DNA sequence and appropriate promoter or control sequence can be used to transform insect pathogenic fungi so that they can express the Moricin2 peptide. The present invention has no particular limitation on the method of transformation. For example, it can be the Agrobacterium method or the fungal protoplast method. The method of screening transformants is well known to those skilled in the art.

[0072] After obtaining a genetically stable fungal cell recombinant (recombinant fungal strain), the recombinant fungal strain can be inoculated into an appropriate culture medium, so that the fungal strain can reproduce and / or produce spores, or also produce other metabolites. The recombinant fungal spores and / or metabolites can be made into an insect control preparation, thereby being used to kill insects.

[0073] Composition for controlling insects and control method

[0074] The present invention also provides a composition for controlling insects (such as a pesticide composition), the composition comprising: an effective amount of the recombinant fungus or its conidia or its metabolites. More preferably, the composition further comprises a pesticide-acceptable carrier.

[0075] The insect control composition of the present invention can be prepared into any suitable dosage form. For example, the form of the composition includes (but is not limited to): powder, granule, oil, emulsion, wettable powder, microcapsule, non-woven fabric agent.

[0076] In preparing the composition, suitable solid diluents include, but are not limited to, diatomaceous earth, corn husks, tricalcium phosphate, cork powder, clays such as kaolin, bentonite or attapulgite, or water-soluble polymers.

[0077] The solid composition may also contain one or more compatible wetting agents, dispersants, emulsifiers or pigments which in the solid state may also act as diluents.

[0078] The liquid composition may be in the form of a solution, suspension or emulsion, or may be encapsulated in a natural or synthetic polymer and may contain a wetting agent, dispersant or emulsifier. Such emulsions, suspensions or solutions may be prepared with aqueous, organic or aqueous-organic diluents for the preparation of water-soluble polymers (and mixtures of the above diluents). In addition, the diluent may contain, for example, an ionic or nonionic wetting agent, dispersant or emulsifier, or a mixture thereof, as described above.

[0079] The composition may be in concentrated form or diluted form. As a preferred embodiment of the present invention, the composition contains 1×10 3 ~1×10 13 / ml (liquid) or 1×10 3 ~1×10 13 spores of the recombinant fungal strain; more preferably, the composition contains 1×10 4 ~1×10 12 / ml (liquid) or 1×10 4 ~1×10 12 spores of the recombinant fungal strain; further preferably, the composition contains 1×10 5 ~1×10 11 / ml (liquid) or 1×10 5 ~1×10 11 The content of spores in the composition can be appropriately increased or decreased according to the actual situation of the dosage form.

[0080] The objects or places suitable for the composition of the present invention to exert their effects (inhibitory effects, killing / killing effects) are not particularly limited, and may be (but not limited to): cereal crops (e.g., corn, wheat, rice, sorghum); ornamental crops, plantation crops and forest trees in fields, forests, plantations, greenhouses, orchards and vineyards, such as: cotton, tobacco, vegetables (e.g., beans, rapeseed, gourds, lettuce, onions, tomatoes, peppers), field crops (e.g., potatoes, beets, peanuts, soybeans, rapeseed), sugarcane, grasslands and forest trees (e.g., corn, sorghum, alfalfa), plantation crops (tea, coffee, cocoa, bananas, oil palm, coconut, rubber, spices), orchards and groves (e.g., stone fruits, citrus, kiwifruit, avocados, mangoes, olives, walnuts), vineyards, ornamental crops in greenhouses, gardens or parks, flowers and shrubs, and trees in forests, plantations and flower gardens (including deciduous trees and evergreen trees).

[0081] The present invention also provides a method for controlling insects, the method comprising: administering an effective amount of the modified insect pathogenic fungus or spores produced thereby to an object in need of controlling insects. In a preferred embodiment, the composition is directly administered to the object in need of controlling insects.

[0082] Suitable methods of applying the spore composition to growing plants include solid broadcasting, foliar spraying, liquid irrigation, etc. The preferred mode of application is foliar application.

[0083] It will be appreciated by those skilled in the art that the application of the composition must vary with external conditions such as temperature, humidity, area to be treated, and plants to be treated. Therefore, the application ratio should vary within a wide range. The frequency of use of the composition of the present invention can be selected by farmers, disease control professionals, or other skilled in the art based on the desired effect.

[0084] The recombinant fungal spores can be used to prepare a composition (pesticide) for controlling insects. The composition is easy to apply, has high killing efficiency on harmful insects, and has no harm to the environment and other animals and plants except insects. It is an environmentally friendly composition.

[0085] The technical solution of the present invention can be well applied to the transformation of insect pathogenic fungi, thereby making the products of insect pathogenic fungi insecticides more durable and effective, and has important application value.

[0086] The invention can accelerate the infection of green muscardine to insects, so that various pests can be killed in a shorter time.

[0087] The invention has better effect on locusts, which are important Orthopteran pests in agriculture and animal husbandry, and can kill them quickly.

[0088] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning Experiment Guide, 3rd Edition, Science Press, or according to the conditions recommended by the manufacturer.

[0089] Materials and methods

[0090] 1. Preparation and transformation of Agrobacterium tumefaciens AGL-1 competent cells

[0091] Agrobacterium tumefaciens AGL-1 was used for transformation.

[0092] (I) Preparation of competent Agrobacterium AGL-1 strain

[0093] 1. Pick a single colony of the AGL-1 strain from a YEB plate (containing 50ug / mL carbenicillin (Carb)) and add it to 10mL of YEB liquid medium with a final concentration of 50ug / mL Carb. Shake the flask at 220rpm and 28℃ for overnight culture.

[0094] 2. Pipette 2 mL of the above bacterial solution and transfer it to 50 mL of YEB liquid medium containing a final concentration of 50 ug / mL Carb. Culture the culture in a shaking bottle at 28°C and 220 rpm. After 4 hours, measure the concentration of the bacterial solution until the OD 600 =0.5 Stop sterilization.

[0095] 3. Pre-cool the above bacterial solution on ice for 30 minutes.

[0096] Centrifuge at 4.4℃ and 5000rpm for 5 min to collect the bacteria.

[0097] 5. Discard the supernatant and resuspend the cells in 10 mL of 20 mM CaCl2.

[0098] 6. Repeat steps 4-5 above once.

[0099] 7. Remove the supernatant, resuspend the cells with 3 mL of 20 mM CaCl2 solution, and add glycerol to a final concentration of 20%.

[0100] 8. Aliquot into 100 μL tubes, freeze quickly in liquid nitrogen and store at -80°C.

[0101] (ii) Plasmid transfer into Agrobacterium AGL-1

[0102] 1. Take the competent AGL-1 Agrobacterium and place it on ice for 10 minutes to thaw.

[0103] 2. Add 1 μg of plasmid to the competent medium, mix well, and place on ice for 30 minutes.

[0104] 3. Quickly freeze in liquid nitrogen for 5 minutes, then place in a 37°C water bath for 5 minutes, and then place on ice for 3 minutes.

[0105] 4. Add 1 mL of antibiotic-free YEB liquid culture medium to the clean bench and culture in a shaking incubator at 220 rpm and 28°C for 3 hours.

[0106] 5. Centrifuge at 5000rpm for 5min to collect the precipitate and discard the supernatant.

[0107] 6. Resuspend the precipitate with 100 μL sterile water, spread on YEB plates (containing 50 μg / mL Carb and 50 μg / mL Kan), and culture at 28°C for 3 days.

[0108] 7. Pick a single colony and culture it in 5 mL YEB (containing 50 μg / mL Carb and 50 μg / mL Kan) medium at 220 rpm and 28°C overnight.

[0109] 8. Take an appropriate amount of bacterial solution for co-culture, mix the remaining bacterial solution with 15% glycerol to preserve the bacteria, and freeze it at -80℃.

[0110] 2. Genetic transformation of Metarhizium robertsii

[0111] (I) Preparation of conidia suspension of Metarhizium Robertsii

[0112] 1. Scrape the conidia of Metarhizium Robertsii from the PDA plate cultured for 14 days and place them in a sterile EP tube containing 0.05% Tween 20 solution. Prepare a spore suspension by pipetting with a pipette or vortexing with an oscillator.

[0113] 2. Filter the bacterial suspension with absorbent cotton and collect the filtered spore suspension in a sterile centrifuge tube.

[0114] 3. Collect spores by centrifugation at 5000 rpm for 5 min, discard the supernatant and resuspend the spores in sterile 0.05% Tween 20.

[0115] 4. Use a hemacytometer to count the spores and adjust the spore concentration to an appropriate level.

[0116] (II) Agrobacterium co-culture transformation of Metarhizium conidia

[0117] 1. Take a single AGL-1 bacteria transformed with the target plasmid and inoculate it into 6 mL YEB (containing 50 μg / mL Carb and 50 μg / mL Kan) culture medium and culture it at 28°C and 220 rpm for 12 to 16 hours.

[0118] 2. Centrifuge at 5000 rpm for 5 min to collect the bacteria and discard the supernatant.

[0119] 3. Use 6 mL of IM liquid culture medium to resuspend the cells and adjust the OD 600 To 0.2.

[0120] 4. Incubate at 28℃ for 6-8 hours at 220rpm and measure OD 600 0.5-0.8 is enough.

[0121] 5. Preparation of spore suspension 5×10 5 conidia / mL, take 500 μL of spore suspension and 500 μL of the above Agrobacterium and mix them evenly.

[0122] 6. Take 100 μL and spread it on IM plate, and culture it at 25℃ in the dark for two days.

[0123] 7. Cover with 15 mL of M-100 solid culture medium (containing 300 μg / mL thiophanate-methyl and 250 ug / mL glufosinate or 3.5 μg / mL benomyl). Culture at 25°C for 5 to 7 days until resistant colonies are produced.

[0124] 8. Pick the transformants with a toothpick and transfer them to M-100 plates with the same resistance, culture them for about 4 days, and then conduct the second screening.

[0125] 9. Pick resistant colonies from the secondary screening plate for PCR verification.

[0126] (III) Extraction of Metarhizium genome

[0127] 1. Take a small amount of mycelium in a 2 mL EP tube, add porcelain beads and crush it in a FastPrep disruptor at an oscillation frequency of 5 M / s for two times, each time for 30 seconds.

[0128] 2. Add 550 μL of CTAB DNA extraction solution to the tube, and add 5 μL of β-mercaptoethanol, invert to mix, and incubate at 65°C for 30 minutes.

[0129] 3. Add 550 μL of phenol / chloroform / isoamyl alcohol (25:24:1), mix by inversion, and centrifuge at 5500 rpm for 5 min.

[0130] 4. Pipette the supernatant into a 1.5 mL centrifuge tube, add an equal volume of chloroform / isoamyl alcohol (24:1), gently invert to mix, centrifuge at 5500 rpm for 5 min, and repeat this step once.

[0131] 5. Pipette the supernatant into a new centrifuge tube, add an equal volume of isopropanol, invert to mix, and let stand at -20℃ for 1 hour.

[0132] 6. Centrifuge the tube at 12000 rpm, 4°C for 10 min and remove the supernatant.

[0133] 7. Add 1 mL of 70% ethanol (pre-cooled) to the precipitate, gently invert to wash the precipitate, centrifuge at 12000 rpm for 1 min, remove the supernatant, and repeat this step once.

[0134] 8. Evaporate the residual alcohol at room temperature, add 100 μL dd H2O to dissolve the DNA precipitate.

[0135] (IV) Gene transformation verification

[0136] 1. Pick the mycelium, extract DNA by simple method, and verify by PCR test (wild type and corresponding constructed vector are used as controls).

[0137] 2. Select 2 to 3 positive colonies and continue to culture until spores are produced.

[0138] 3. Prepare spore suspension, dilute appropriately, spread on PDA plate, and culture at 25℃ for three days.

[0139] 4. Pick 3 single colonies from each plate and continue to culture on PDA plates.

[0140] 5. After 3 days of cultivation, pick the mycelium, extract the genome, and verify it by PCR.

[0141] 3. Selection of Metarhizium muscardine transformants with high expression of Moricin2

[0142] (I) Extraction of RNA from Metarhizium anisopliae

[0143] 1. The materials used mainly include: spores of Metarhizium anisopliae cultured on PDA plates for 14 days (conidia on PDA); hyphae cultured in SDB liquid for 3 days (hyphae in SDB). Wash with pure water (hyphae) three times, take an appropriate amount of sample into RNase free FastPrep tube, add porcelain beads and 800μL TRIzol, invert and mix to allow full contact for 5 minutes.

[0144] 2. Use FastPrep disruptor, 5M / s, shake for 30 seconds to disrupt, place on ice for 5 minutes, and repeat once.

[0145] 3. Add 400 μL of chloroform, vortex on a shaker for 30 seconds, place on ice for 5 minutes, and centrifuge at 12,000 rpm for 15 minutes at 4°C.

[0146] 4. Pipette 400 μL of the upper aqueous phase into a new RNase free Eppendorf tube, add 200 μL of isopropanol, gently invert to mix, place on ice for 10 min. Centrifuge at 12000 rpm, 4°C for 10 min, and remove the supernatant.

[0147] 5. Add 75% ethanol, centrifuge at 12000 rpm, 4°C for 5 min, and remove the supernatant.

[0148] 6. Open the lid, let stand at room temperature for 5 minutes, add 50μL RNase free water, dissolve at room temperature, and store at -80℃.

[0149] (ii) cDNA synthesis

[0150] Using TOYOBO ReverTra qPCR RT Master Mix with gDNA Remover kit

[0151] 1. Place RNA in a 65°C water bath for 5 minutes and quickly place on ice for 2 minutes.

[0152] 2. Remove DNA (8 μL) and react at 37°C for 5 min. The system is as shown in Table 1.

[0153] Table 1

[0154] RNA 0.5pg-0.5μg 4×DN Master Mix(add gDNA Remover) 2μL <![CDATA[RNase free H2O]]> Make up to 8 μL

[0155] 3. Reverse transcription reaction (10 μL), add 2 μL of 5×RT Master Mix II to the above reaction solution. The reaction procedure is as shown in Table 2, and the reaction is stored at -20℃ after completion.

[0156] Table 2

[0157] 37℃ 15min 50℃ 5min 98℃ 5min

[0158] (III) Expression level determination

[0159] qPCR primers are shown in Table 3.

[0160] Table 3

[0161]

[0162] The qPCR reaction system is shown in Table 4.

[0163] Table 4

[0164] SYBR Green Mix 5μL Primer F / R 0.2μL template 1μL <![CDATA[RNase free H2O]]> Make up to 10 μL

[0165] The reaction procedure is shown in Table 5.

[0166] Table 5

[0167] Step 1 95℃ 5min Step 2 95℃ 15s Step 3 60℃ 25s Step 4 60℃ 30s ×40 cycles Step 2-Step 3

[0168] IV. Culture Media and Reagents

[0169] LB medium (for E. coli culture) is shown in Table 6.

[0170] Table 6

[0171]

[0172]

[0173] The solid culture medium was added with 1.5% agar powder and sterilized at 121°C for 20 min. YEB medium (for Agrobacterium culture) is shown in Table 7.

[0174] Table 7

[0175] Yeast Extract 1g / L Peptone 10g / L <![CDATA[MgSO4]]> 0.5g / L sucrose 5g / L pH 7.0

[0176] Solid medium was added with 1.5% agar powder and sterilized at 121°C for 20 min. 2.5×MM (for fungal co-culture transformation) is shown in Table 8.

[0177] Table 8

[0178] <![CDATA[CaCl2.2H2O]]> 0.165g <![CDATA[KH2PO4]]> 3.625g <![CDATA[K2HPO4]]> 5.125g <![CDATA[MgSO4.7H2O]]> 1.250g <![CDATA[FeSO4.7H2O]]> 0.0062g NaCl 0.375g <![CDATA[(NH4)2SO4]]> 1.250g

[0179] Add ddH2O to fully dissolve and adjust the volume to 1L.

[0180] M-100 trace element solution (for fungal transformation coverage) is shown in Table 9.

[0181] Table 9

[0182] <![CDATA[CuSO4.5H2O]]> 400mg <![CDATA[FeCl3.6H2O]]> 100mg <![CDATA[H3BO3]]> 60mg <![CDATA[Na2MoO4.2H2O]]> 40mg <![CDATA[MnCl2.4H2O]]> 140mg <![CDATA[ZnCl2]]> 400mg

[0183] Add ddH2O to fully dissolve and adjust the volume to 1L.

[0184] M-100Salt solution is shown in Table 10.

[0185] Table 10

[0186] <![CDATA[CaCl2]]> 0.25g <![CDATA[KH2PO4]]> 4g <![CDATA[MgSO4.7H2O]]> 0.5g <![CDATA[Na2SO4]]> 1g KCl 2g M-100Trace Element Solution 2mL

[0187] Add ddH2O to fully dissolve and adjust the volume to 250 mL.

[0188] IM (Induction Medium) (liquid) is as shown in Table 11.

[0189] Table 11

[0190] 10 mM glucose 0.18g 1 x MM salt 40mL of 2.5×MM 0.5% Glycerol 0.5mL

[0191] Add ddH2O to fully dissolve and adjust the volume to 96 mL. Sterilize at 121℃ for 15 min.

[0192] After sterilization, cool to about 60°C and add the ingredients listed in Table 12.

[0193] Table 12

[0194] 40mM MES 8 mL of 0.5 M MES stock 200 μM AS 1 mL of 20 mM AS stock

[0195] IM (Induction Medium) (solid) is shown in Table 13.

[0196] Table 13

[0197] 5 mM glucose 0.09g 1 x MM salt 40mL of 2.5×MM 0.5% Glycerol 0.5mL

[0198] Add 1.5% agar powder to the solid medium, add ddH2O to fully dissolve, and adjust the volume to 94 mL. Sterilize at 121°C for 15 min.

[0199] After sterilization, cool to about 60°C and add the ingredients listed in Table 14.

[0200] Table 14

[0201] 40mM MES 8 mL of 1M MES stock 200 μM AS 1 mL of 20 mM AS stock

[0202] M-100 culture medium is shown in Table 15.

[0203] Table 15

[0204] glucose 1g M-100salt solution 6.25mL <![CDATA[KNO3]]> 0.3g

[0205] Add 1.5% agar powder to the solid medium, add ddH2O to fully dissolve, and make up to a final volume of 100 mL. Sterilize at 121°C for 15 min.

[0206] CTAB genome extraction reagent is shown in Table 16.

[0207] Table 16

[0208] CTAB 8g NaCl 32.728g Tris-HCl (1M, PH=8.0) 40mL EDTA (0.5M, PH = 8.0) 16mL PVP 8g

[0209] Add ddH2O to fully dissolve and adjust the volume to 400 mL. Sterilize at 121℃ for 15 min.

[0210] Example 1: Construction of silkworm Moricin2 peptide expression vector

[0211] 1. Establishment of recombinant plasmid

[0212] The amino acid sequence of the silkworm Moricin2 peptide is as follows (SEQ ID NO: 1):

[0213] AKIPIKAIKTVGKAVGKGLRAINIASTANDVFNFLKPKKRKH

[0214] To express the Moricin2 peptide, the gene fragment required for synthesizing the expression of the silkworm Moricin2 peptide is as follows (SEQ ID NO: 2):

[0215] TtctagaTGTTCATGGAACATCACACTCGCTGACTCTGGACACCAACTGTATTCACTCGCTAATTCGTTCCTGGCTCAAATTCTTTTCCGTTCCCTAGACCATCATGCGTGAACTTTCTTCGGTTCTCGCCCTTTCGGGCTTGCTGGCCCTGGCGTCGGCA GCCAAGATCCCATCAAGGCCATCAAGACCGTCGGCAAGGCCGTCGGCAAGGGCCTCCG CGCCATCAACATCGCCTCCACCGCCAACGACGTCTTCAACTTCCTCAAGCCCAAGAAGCGCAAGCACTAA tctagaG

[0216] The fragment consists of three parts: mcl1 mRNA (positions 8-104 in the above nucleotide sequence, which are the 5′-untranslated region of mcl1 mRNA), MCL1 signal peptide (MRELSSVLALSGLLALASA (SEQ ID NO: 3)) coding sequence (positions 105-161), Moricin2 (positions 162-290) and restriction sites at both ends. The “tctaga” at both ends are restriction sites.

[0217] Using the above synthetic sequence as a template, PCR amplification was performed using primers TransMoricin2 F / R, as shown in Table 17.

[0218] Table 17

[0219]

[0220] The PCR reaction system is shown in Table 18.

[0221] Table 18

[0222] Phanta Master MIX 25μL <![CDATA[ddH2O]]> 20μL Primer F / R (10uM) 2μL DNA 1μL

[0223] The PCR reaction program is shown in Table 19.

[0224] Table 19

[0225] Step 1 95℃ 5min Step 2 95℃ 30s Step 3 54℃ 30s Step 4 72℃ 1min Step 5 72℃ 7min ×30 cycles Step 2–Step 4

[0226] The target fragment is recovered by a gel recovery kit for later use. The plasmid used in the present invention is pDHt-bar-tef for fungal mutant construction, and the plasmid is linearized by restriction endonuclease Xba I. The method for establishing pDHt-bar-tef is as follows: pDHt-SK is used as a backbone vector, a glufosinate resistance screening site Bar and a strong promoter tef are added, and an appropriate multiple cloning site is set.

[0227] The homologous recombinase of Nanjing Novozymes was used to digest the vector and connect the fragments. The reaction system is shown in Table 20.

[0228] Table 20

[0229] Target fragment amplification product 10~200ng Linearized vector 150ng 5×CE Entry Buffer 4μL Exnase Entry 2μL <![CDATA[ddH2O]]> Up to 20μL

[0230] The entire plasmid construction process is as follows Figure 1 shown.

[0231] 2. Plasmid Transformation into E. coli

[0232] 1. Take out the competent Escherichia coli Top10 strain (Vidi Biotech) stored at -80℃ and thaw it on ice.

[0233] 2. Add the recombinant ligation product, mix gently with a pipette tip, and let stand on ice for 25 minutes.

[0234] 3. Heat shock in a 42℃ metal bath or water bath for 45 seconds, then quickly put it in ice and let it stand for 2 minutes.

[0235] 4. Add antibiotic-free LB liquid culture medium to a final volume of 1 mL, shake to mix, and place in a shaker at 37°C for 1 h to recover.

[0236] 5. Centrifuge the resuscitated bacterial solution at 5500rpm for 5 minutes to collect the bacteria.

[0237] 6. Discard the supernatant, take an appropriate amount of sterile water to resuspend the bacteria, use a coating rod to spread on the LB solid plate containing the corresponding resistance, and invert it in the incubator at 37°C for culture.

[0238] Transformants were picked and the connection was verified by conventional PCR, as shown in Table 21.

[0239] Table 21

[0240] 2×Taq master mix 10μL <![CDATA[ddH2O]]> 9μL Primer F / R (10uM) 0.5μL DNA 1μL

[0241] The PCR reaction procedure was the same as above.

[0242] After successful verification, the plasmid was extracted using the rapid plasmid extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. and used to transform Agrobacterium.

[0243] Agrobacterium transformed with plasmid was obtained by the method described in the above "Materials and Methods".

[0244] Using Agrobacterium transformed with a plasmid, the transformation of Metarhizium Robertsii was carried out as described above, and it was verified that genetically transformed Metarhizium Robertsii was obtained.

[0245] Using Agrobacterium transformed with plasmid, Metarhizium highly expressing Moricin2 was prepared as described above to obtain TransMoricin2 transgenic strain. According to the results of the method analysis, M2 and M7 transformants were the two transformants with relatively high expression levels.

[0246] Example 2: Determination of insecticidal activity of transgenic strains of Metarhizium anisopliae expressing Bombyx mori Moricin2 peptide

[0247] The insecticidal toxicity of the transgenic strains M2 and M7 of TransMoricin2 was tested by immersion bioassay. The immersion bioassay completely simulates the whole process of pathogenic fungi infecting insects, as follows: the insects are anesthetized by freezing on ice in advance, a fungal spore suspension is prepared, and the insects are sprayed with a small spray bottle, or the insects are placed in the spore suspension and then taken out for moisturizing (the tube containing the insects (with cotton plugs on it) is placed in a square box, covered with soaked gauze, and water is added to the box to ensure that the gauze remains moist, the lid is closed, and the box is placed in an incubator) and the number of deaths is counted every 12 hours.

[0248] 1. Determination of insecticidal activity against the Diptera fruit pest Drosophila

[0249] Bioassays were performed using male Drosophila suzukii. The concentration of spore suspensions of wild-type and transformant M. anisopliae was 3 × 10 7 spores / ml, keep moist for 12h.

[0250] The results showed that the half-lethal time (LT) of wild-type M. anisopliae in treating Drosophila was 50 The half-lethal time of the transformant M2 that highly expressed the silkworm Moricin2 peptide was 132±4.387h when the fruit flies were treated with the transformant M7 that highly expressed the silkworm Moricin2 peptide, and the half-lethal time of the fruit flies was 132±6.810h.

[0251] Therefore, the Roberts' Metarhizium transformants with high expression of Bombyx mori Moricin2 can kill the Diptera fruit pest Drosophila more quickly, and the half-lethal time is greatly shortened by 36h compared with the wild type, with significant difference (P<0.05). In addition, the two transformants can almost completely kill the Drosophila within the statistical time, as shown in Table 22 and Figure 3Furthermore, no resistance was observed in spotted-wing drosophila after repeated or long-term insecticide treatment.

[0252] Table 22

[0253]

[0254]

[0255] 2. Determination of insecticidal activity against the dipteran vector pest Culex pipiens

[0256] Bioassays were performed using female Culex mosquitoes. The concentration of spore suspensions of wild-type and transformant M. anisopliae was 3 × 10 7 spores / ml, moisturize for 24 hours.

[0257] The results showed that the half-lethal time of the wild-type M. anisopliae to treat female Culex pipiens was 120±4.815h. The half-lethal time of the transformant M2 to treat female Culex pipiens that highly expressed the Bombyx mori Moricin2 peptide was 84±2.603h. The half-lethal time of the transformant M7 to treat female Culex pipiens was 84±3.294h.

[0258] Therefore, the Roberts' Metarhizium transformants that highly expressed the silkworm Moricin2 peptide could kill the dipteran vector pest Culex pipiens faster, and the half-lethal time was greatly shortened by 36h, with a very significant difference (P<0.01). In addition, the two transformants could almost completely kill Culex pipiens within the statistical time, as shown in Table 23 and Figure 4 Furthermore, no resistance was observed in Culex pipiens after repeated or long-term insecticide treatment.

[0259] Table 23

[0260]

[0261] 3. Determination of insecticidal activity against locusts, important orthoptera pests in agriculture and animal husbandry

[0262] Locust was used for bioassay. The concentration of spore suspension of wild-type and transformant M. anisopliae was 2×10 7 spores / ml, moisturize for 24 hours.

[0263] The results showed that the half-lethal time of locusts treated with wild-type M. anisopliae was 70±2.567h. The half-lethal time of locusts treated with transformants M2 and M7 that highly expressed Bombyx mori Moricin2 peptide was less than 60h (measured in 60h).

[0264] Therefore, the Roberts Metarhizium transformants with high expression of silkworm Moricin2 peptide can kill locusts, an important Orthoptera pest in agriculture and animal husbandry, faster, and the half-lethal time is shortened by more than 10 hours. The difference is very significant (P<0.01), and two transformants can completely kill locusts within the statistical time, as shown in Table 24 and Figure 5 Furthermore, no resistance was observed in locusts after repeated or long-term insecticide treatment.

[0265] Table 24

[0266]

[0267] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims. At the same time, all the documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference separately.

Claims

1. A method for enhancing the killing ability of insect pathogenic fungi to their insect hosts, comprising: Expression of heterologous Moricin2 peptides in insect pathogenic fungi; Preferably, the enhancement of the killing ability of insect pathogenic fungi to their insect hosts includes: shortening the killing time and improving the killing efficiency.

2. The method according to claim 1, characterized in that Expression of Moricin2 peptide by heterologous introduction of expression constructs in insect pathogenic fungi; Preferably, the expression in insect pathogenic fungi is secretory expression; Preferably, the expression construct has an expression cassette for the Moricin2 peptide, comprising: mcl1 mRNA 5′-untranslated region, MCL1 signal peptide encoding nucleic acid, Moricin2 encoding nucleic acid; More preferably, the nucleotide sequence of the mcl1 mRNA 5′-untranslated region is as shown in positions 8-104 of SEQ ID NO:2, the nucleotide sequence of the MCL1 signal peptide encoding nucleic acid is as shown in positions 105-161 of SEQ ID NO:2, and the nucleotide sequence of the Moricin2 encoding nucleic acid is as shown in positions 162-290 of SEQ ID NO:2; More preferably, the expression cassette comprises the nucleotide sequence shown in SEQ ID NO: 2; More preferably, the expression cassette further comprises a promoter upstream of the 5′-untranslated region of mcl1 mRNA; more preferably, the promoter comprises: Aureobasidium pullulans translation elongation factor tef.

3. The method according to claim 1, characterized in that The insect pathogenic fungus is an insect pathogenic fungus that parasitizes an insect host, thereby inhibiting the insect host, or an insect pathogenic fungus that can produce metabolites, thereby inhibiting the insect host; Preferably, the insect pathogenic fungi include fungi selected from the group consisting of Chlorophyllum and Beauveria bassiana.

4. The method according to claim 1, characterized in that The insects include insects selected from the group consisting of Diptera, Orthoptera, Lepidoptera, Homoptera, Coleoptera, Hemiptera, Hymenoptera, and Neuroptera.

5. The method according to claim 1, characterized in that The method further comprises: culturing the insect pathogenic fungus and harvesting spores that have killing ability to insect hosts.

6. The method according to claim 1, characterized in that The Moricin2 peptide is a protein having an amino acid sequence as shown in SEQ ID NO: 1 or a conservative variant protein thereof; Preferably, the conservative variant protein includes one selected from: (a) a derivative protein formed by replacing, deleting or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 1 and having the function of the protein with the amino acid sequence shown in SEQ ID NO: 1; (b) a derivative protein having an amino acid sequence that is more than 80% identical to the amino acid sequence of SEQ ID NO: 1 and having the function of the protein of the amino acid sequence of SEQ ID NO: 1; or (c) A protein formed by adding a tag or a signal peptide sequence to the N- or C-terminus of the amino acid sequence shown in SEQ ID NO:

1.

7. Use of Moricin2 peptide or its encoding nucleic acid, expression cassette or expression construct for expressing Moricin2 peptide for enhancing the killing ability of insect pathogenic fungi to their insect hosts, or for preparing insect pathogenic fungi with enhanced killing ability; preferably, the enhancing the killing ability of insect pathogenic fungi to their insect hosts comprises: Shorten the killing time and improve the killing efficiency.

8. A modified insect pathogenic fungus or spores produced therefrom, which express a heterologous Moricin2 peptide and have enhanced killing ability to its insect host.

9. The insect pathogenic fungus or spores produced therefrom according to claim 8, characterized in that The Moricin2 peptide is a protein having an amino acid sequence as shown in SEQ ID NO: 1 or a conservative variant protein thereof; or The insect pathogenic fungus or the spores produced therefrom include a heterologous expression construct, which has an expression cassette for the Moricin2 peptide, including: mcl1 mRNA 5′-untranslated region, MCL1 signal peptide encoding nucleic acid, and Moricin2 encoding nucleic acid; more preferably, the expression cassette also includes a promoter upstream of the mcl1 mRNA 5′-untranslated region; more preferably, the promoter includes: Aureobasidium pullulans translation elongation factor tef.

10. Use of the insect pathogenic fungus according to claim 8 or 9 or the spores produced therefrom for controlling insects, or for preparing a composition for controlling insects; preferably, the insects include insects selected from the following groups: Diptera, Orthoptera, Lepidoptera, Homoptera, Coleoptera, Hemiptera, Hymenoptera, Neuroptera.

11. A composition for controlling insects, comprising: The insect pathogenic fungus according to claim 8 or 9 or the spores produced therefrom; and a pesticide-acceptable carrier or excipient.

12. The composition according to claim 11, characterized in that The composition contains spores of insect pathogenic fungi at a concentration of 1×10 3 ~1×10 13 spores / mL; preferably 1×10 4 ~1×10 12 spores / mL; preferably 1×10 5 ~1×10 11 spores / mL.

13. A method for controlling insects, comprising: The insect pathogenic fungus of claim 8 or 9 or the spores produced thereby, or the composition of claim 11 or 12 is applied to the insect or an object infected by the insect; preferably, the insect includes insects selected from the following groups: Diptera, Orthoptera, Lepidoptera, Homoptera, Coleoptera, Hemiptera, Hymenoptera, Neuroptera.

14. A kit for controlling insects, comprising: The insect pathogenic fungus according to claim 8 or 9 or the spores produced therefrom, or the composition according to claim 11 or 12.

Images