Application of promoter for SlMYB65 gene expression, tomato breeding method and kit

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to application of an accelerant for SlMYB65 gene expression, a tomato breeding method and a kit. The application finds that the SlMYB65 gene is an important factor for regulating and controlling the flowering time of tomato fruits, the gene expression is regulated and controlled by utilizing an experimental means of molecular biological breeding, and a result shows that the tomato can bloom in advance by enhancing the expression of the SlMYB65 gene, so that a candidate gene is provided for cultivating early-maturing tomato crop varieties. Therefore, the promoter expressed by the SlMYB65 gene can be used for regulating the flowering time of the tomato, and an important tool is provided for a tomato breeding technology.

Description

Technical Field

[0001] The present application belongs to the technical field of plant genetic engineering, and in particular relates to the application of an promoter for SlMYB65 gene expression, and a tomato breeding method and kit. Background Art

[0002] Tomato (Solanum lycopersicum.L) is an important vegetable crop with rich nutrition, which is closely related to human life and is widely planted around the world. Due to its advantages such as complete genome sequence, clear genetic map, closed pollination and short growth cycle, it has also become one of the commonly used model plants in basic and applied research fields.

[0003] Tomato flowering time is one of the important agronomic traits that affects crop growth period and yield. By studying and regulating the flowering time of tomatoes, the growth cycle can be shortened, thereby increasing tomato yield. Because tomatoes are a common model plant for studying plant growth and development, research on the flowering time regulation mechanism can also help to analyze the flowering and development process of other crops. Summary of the invention

[0004] The purpose of the present application is to provide an application of a promoter for SlMYB65 gene expression, a tomato breeding method and a kit, aiming to solve the technical problem of how to make tomatoes bloom early to better cultivate tomatoes.

[0005] In order to achieve the above application purpose, the technical solution adopted in this application is as follows:

[0006] In a first aspect, the present application provides a use of a promoter for SlMYB65 gene expression in regulating the flowering time of tomatoes.

[0007] In some embodiments, the coding region nucleotide sequence of the SlMYB65 gene is shown in SEQ ID No. 1;

[0008] And / or, the amino acid sequence of the protein encoded by the SlMYB65 gene is shown in SEQ ID No.2.

[0009] In some embodiments, the promoter comprises a recombinant vector expressing the S1MYB65 gene.

[0010] In some embodiments, the recombinant vector comprises a plant expression vector pROKII-GFP, and the plant expression vector pROKII-GFP is inserted with the CDS sequence of the SlMYB65 gene.

[0011] In a second aspect, the present application provides a tomato breeding method, comprising: promoting the expression of the SlMYB65 gene in tomatoes to make the tomatoes bloom early.

[0012] In some embodiments, the step of promoting the expression of the S1MYB65 gene in tomatoes to cause early flowering of tomatoes comprises:

[0013] Constructing a recombinant vector that promotes the expression of the SlMYB65 gene;

[0014] The recombinant vector is transferred into a tomato recipient for cultivation.

[0015] In some embodiments, the step of constructing a recombinant vector for promoting the expression of the S1MYB65 gene comprises:

[0016] The plant expression vector pROKII-GFP is digested with restriction endonucleases BamHI and KpnⅠ, and then recombined with the CDS sequence of the SlMYB65 gene to obtain the recombinant vector.

[0017] In some embodiments, the tomato recipient comprises a cotyledon of a wild-type tomato seed 7-10 days after germination.

[0018] In a third aspect, the present application provides a kit for causing tomatoes to bloom early, comprising a promoter for expressing the SlMYB65 gene of tomatoes.

[0019] In some embodiments, the promoter comprises a recombinant vector expressing the SlMYB65 gene, the recombinant vector comprises a plant expression vector pROKII-GFP, and the plant expression vector pROKII-GFP is inserted with the CDS sequence of the SlMYB65 gene.

[0020] The application of the first aspect of the present application is based on the discovery that the SlMYB65 gene is an important factor in regulating the flowering time of tomato fruit. By using molecular biological breeding experimental means to regulate the expression of the gene, the results show that enhancing the expression of the SlMYB65 gene can make tomatoes bloom earlier, which provides a candidate gene for breeding early-maturing tomato crop varieties. Therefore, the promoter of the SlMYB65 gene expression can be used to regulate the flowering time of tomatoes, providing an important tool for tomato breeding technology.

[0021] The tomato breeding method provided in the second aspect of the present application includes promoting the expression of the SlMYB65 gene in tomatoes to make the tomatoes bloom early. Because the overexpression of the SlMYB65 gene can make tomatoes bloom early, the tomato breeding method provided in the present application can obtain early-maturing tomato crop varieties by enhancing the expression of the SlMYB65 gene.

[0022] The third aspect of the present application provides a kit, which contains a promoter for expressing the SlMYB65 gene of tomatoes; therefore, the kit provided by the present application can make tomatoes bloom early and can be used for tomato breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 This is a PCR electrophoresis verification diagram of three tomato tissue culture regeneration seedlings obtained by transgenic cloning in the embodiment of the present application; wherein 1, 2, and 3 correspond to the electrophoresis lanes of the three tomato plants respectively;

[0025] Figure 2 This is a relative expression detection diagram of the SlMYB65 gene in three tomato tissue culture regeneration seedlings obtained by transgenic cloning in the embodiment of the present application; wherein WT represents wild-type tomato; OE1, OE2, and OE3 represent three tomato plants obtained by transgenic cloning, respectively;

[0026] Figure 3 This is a phenotypic comparison diagram of tomato tissue culture regeneration seedlings obtained by transgenic cloning in the embodiment of the present application and wild-type tomatoes; wherein WT represents wild-type tomatoes; 35S:SlMYB65 represents tomatoes obtained by transgenic cloning;

[0027] Figure 4 This is a comparison chart of the flowering time of three tomato tissue culture regenerated seedlings obtained by transgenic cloning in the example of the present application and wild-type tomatoes; wherein WT represents wild-type tomatoes; OE1, OE2, and OE3 represent three tomato plants obtained by transgenic cloning, respectively; * represents significant differences, and ** represents extremely significant differences. DETAILED DESCRIPTION

[0028] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0029] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0030] In the present application, "at least one" means one or more, "more than one" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single or plural items.

[0031] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0032] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms "a", "said" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.

[0033] The weight of the relevant components mentioned in the embodiment description of the present application can not only refer to the specific content of each component, but also represent the proportional relationship between the weights of the components. Therefore, as long as the content of the relevant components is proportionally enlarged or reduced according to the embodiment description of the present application, it is within the scope disclosed in the embodiment description of the present application. Specifically, the mass described in the embodiment description of the present application can be a mass unit known in the chemical industry such as μg, mg, g, kg, etc.

[0034] The terms "first" and "second" are used only for descriptive purposes to distinguish objects such as substances from each other, and should not be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features. For example, without departing from the scope of the embodiments of the present application, the first XX may also be referred to as the second XX, and similarly, the second XX may also be referred to as the first XX. Thus, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features.

[0035] R2R3MYB transcription factors play an important regulatory role in the development of flower organs and the regulation of flowering time of horticultural crops. When studying the function of tomato R2R3MYB transcription factors, the present application found that the SlMYB65 gene is an important factor in regulating the flowering time of tomatoes. By studying the overexpression of the SlMYB65 gene, the flowering time of tomatoes is significantly shortened, which provides a candidate gene for changing the flowering time of crops. Because by regulating the flowering time of tomatoes, market demand can be better met. Therefore, by cultivating early-maturing tomato varieties, tomatoes can be supplied earlier in the early spring season to meet the market demand for fresh tomatoes.

[0036] Specifically, the SlMYB65 gene information is as follows:

[0037] Gene ID: Solyc01g009070;

[0038] Gene name: MYB transcription factor65;

[0039] Basic information: SlMYB65 is a nuclear gene located at 3075589-3080069 on tomato chromosome 1. The gene is 4480 bp long with a 3' non-coding region; the DNA coding sequence is 4671 bp long with 3 exons and 2 introns, and the mature mRNA encodes 537 amino acid residues. The SlMYB65 protein has a typical R2R3MYB protein domain and belongs to the R2R3MYB transcription factor gene family.

[0040] SlMYB65 gene sequence:

[0041] 3' non-coding region:

[0042] CAGTTTTGAAGTTTTGGTAACATCTTTCGATACAACAGGTTGTTATCTAATGACACT GAGCATGTAATATGAAAACACTTCTGGATTTTCCTGTGTGCTTCGGTTTAAGGCAATTTA GAGACAAACAATGAAACTTTTTTTAATGTGGGATCAAATTGGAC;

[0043] DNA coding region (exons are underlined), SEQ ID No. 1:

[0044]

[0045]

[0046]

[0047] The amino acid sequence of the protein encoded by the SlMYB65 gene, SEQ ID No.2:.

[0048] In a first aspect, the embodiments of the present application provide a use of a promoter for SlMYB65 gene expression in regulating the flowering time of tomatoes.

[0049] The promoter of the embodiment of the present application refers to an agent or substance that can promote the expression of the SlMYB65 gene in tomatoes relative to the wild type. Based on the fact that the SlMYB65 gene is an important factor in regulating the flowering time of tomato fruits, the expression of the gene is regulated by the experimental means of molecular biological breeding. The results show that enhancing the expression of the SlMYB65 gene can make tomatoes bloom in advance, which provides a candidate gene for cultivating early-maturing tomato crop varieties. Therefore, the promoter of the SlMYB65 gene expression can be used to regulate the flowering time of tomatoes, providing an important tool for tomato breeding technology.

[0050] In some embodiments, the nucleotide sequence of the coding region of the SlMYB65 gene is shown as SEQ ID No. 1. The amino acid sequence of the protein encoded by the SlMYB65 gene is shown as SEQ ID No. 2.

[0051] In some embodiments, the promoter includes a recombinant vector expressing the S1MYB65 gene. The recombinant vector is used in transgenic technology to obtain a transgenic tomato overexpressing the S1MYB65 gene.

[0052] In some embodiments, the recombinant vector includes a plant expression vector pROKII-GFP, and the plant expression vector pROKII-GFP is inserted with the CDS sequence of the SlMYB65 gene (i.e., the gene sequence encoding the protein product). The recombinant vector can well transform Agrobacterium and further obtain transgenic tomato plants.

[0053] In a second aspect, the present application provides a tomato breeding method, comprising: promoting the expression of the SlMYB65 gene in tomatoes to make the tomatoes bloom early. Since the overexpression of the SlMYB65 gene can make tomatoes bloom early, the tomato breeding method provided in the present application can obtain an early-maturing tomato crop variety by enhancing the expression of the SlMYB65 gene.

[0054] In some embodiments, the step of promoting the expression of the SlMYB65 gene in tomatoes to make tomatoes bloom early includes: constructing a recombinant vector that promotes the expression of the SlMYB65 gene; and transferring the recombinant vector into a tomato recipient for cultivation.

[0055] In some embodiments, the step of constructing a recombinant vector for promoting the expression of the SlMYB65 gene includes: digesting the plant expression vector pROKII-GFP with restriction endonucleases BamHI and KpnⅠ, and then recombining and connecting with the CDS sequence of the SlMYB65 gene to obtain a recombinant vector.

[0056] In some embodiments, the tomato recipient comprises a cotyledon 7-10 days after germination of a wild-type tomato seed.

[0057] In a third aspect, the present application provides a kit for making tomatoes bloom early, comprising a promoter for expressing the S1MYB65 gene of tomatoes. The kit provided in the present application can make tomatoes bloom early and can be used for tomato breeding.

[0058] In some embodiments, the promoter includes a recombinant vector expressing the SlMYB65 gene, the recombinant vector includes a plant expression vector pROKII-GFP, and the plant expression vector pROKII-GFP is inserted with a CDS sequence of the SlMYB65 gene.

[0059] In the present application, the SlMYB65 gene is used as a tool gene for early flowering. Plant transgenic technology is used to overexpress the tool gene in the target crop, which will produce new germplasm of crops that bloom early, and then through phenotypic screening, strains that meet the expected traits are left. Subsequently, it can be hybridized with strains with other excellent traits (such as disease resistance) to gradually cultivate new crop varieties with excellent traits.

[0060] In addition, the SlMYB65 gene has a very high similarity with the protein sequence in Solanaceae crops eggplant, pepper and potato. Its application in early flowering of tomatoes can also provide new breeding ideas for early flowering and increased yield of other Solanaceae crops.

[0061] The following is a description of the specific examples. The test materials used in the examples of this application are as follows:

[0062] (1) Plant materials: Wild-type tomatoes (Solanum lycopersicum L.), Micro-Tom. Wild-type tomatoes were cultured in a plant growth chamber with a temperature-light cycle of 18°C-8h at night and 24°C-16h during the day.

[0063] (2) Engineered bacterial strains: Escherichia coli DH5α, Agrobacterium tumefaciens LBA4404 strain.

[0064] (3) Vector material: plant expression vector pROKII-GFP, a binary vector with kanamycin resistance.

[0065] (4) Culture medium:

[0066] 1 / 2MS medium (based on 1L): MS (without agar and sucrose) 2.37g, sucrose 15g, agar 7g, pH 5.8-5.85.

[0067] Preculture medium (1 L): MS (without agar and sucrose) 4.74 g, sucrose 30 g, agar 7 g, zeatin (ZT) solution 1 mL, pH 5.8-5.85; after sterilization (121°C, 15-20 min), add auxin (IAA) solution 1 mL.

[0068] Co-culture medium (1 L): MS (without agar and sucrose) 4.74 g, sucrose 30 g, agar 7 g, zeatin (ZT) solution 1 mL, pH 5.8-5.85; after sterilization (121°C, 15-20 min), add auxin (IAA) solution 1 mL and acetosyringone (AS) solution 5-10 mL.

[0069] Differentiation medium (1 L): MS (without agar and sucrose) 4.74 g, sucrose 30 g, agar 7 g, zeatin (ZT) solution 1 mL, pH 5.8-5.85; after sterilization (121 ° C, 15-20 min), add auxin (IAA) solution 1 mL, carbenicillin sodium (CB) solution 2 mL, and kanamycin (Kanamycin) solution 1 mL or 0.5 mL.

[0070] Rooting medium (1 L): MS (without agar and sucrose) 4.74 g, sucrose 30 g, agar 7 g, pH 5.8-5.85; after sterilization (121°C, 15-20 min), add 200 μL of auxin (IAA) solution and 2 mL of carbenicillin sodium (CB) solution.

[0071] In the above-mentioned various prepared culture media, the ZT concentration in the zeatin solution is 2 mg / mL, the IAA concentration in the auxin solution is 0.5 mg / mL, the AS concentration in the acetosyringone solution is 1.96 mg / mL, the Kanamycin concentration in the kanamycin solution is 100 mg / mL, and the CB concentration in the carbenicillin sodium solution is 200 mg / mL.

[0072] LB liquid culture medium components (1 L): tryptone 10 g, yeast extract 5 g, sodium chloride 10 g.

[0073] MS (without agar and sucrose) component: purchased from Haibo Bio-MS medium (without agar and sucrose), product number HB8469-5.

[0074] Example 1 Construction of plant expression recombinant vector

[0075] 1. Total RNA extraction. Take 0.5 g of wild-type tomato leaves, grind them with liquid nitrogen, and extract total RNA using Trizol reagent. The integrity of the obtained total RNA is detected by agarose gel electrophoresis, and the concentration of RNA is measured by a nucleic acid spectrophotometer.

[0076] 2. Obtain cDNA. Using the PrimeScript kit TM RT reagent Kit with gDNA Eraser first removes genomic DNA from total RNA, and then uses it as a template to obtain cDNA products through reverse transcription reaction.

[0077] 3. Cloning of SlMYB65 gene: Take 1 μl cDNA as template and use the following specific primers to clone the full-length CDS sequence of SlMYB65 gene.

[0078] SlMYB65-BamHI-F, SEQ ID No.3:

[0079] 5'-acgggggactctagaggatccATGAGCATCAAAAGTGAAACCGA-3'.

[0080] SlMYB65-KpnI-R, SEQ ID No.4:

[0081] 5'-gcccttgctcaccatggtaccTCATAATCTCATTCTTCCTGTTGCTT-3'.

[0082] The PCR reaction system is as shown in Table 1:

[0083] Table 1

[0084]

[0085] Detect the PCR results by agarose gel electrophoresis. If the band size is appropriate, use an agarose gel recovery kit to recover the cloned target DNA fragment and save it for later use.

[0086] 4. Construction of plant expression recombinant vector. Linearize the plant expression vector pROKII-GFP with restriction endonucleases BamHI and KpnⅠ (1μl each of BamHI and KpnⅠ, 100μg of empty vector, 4μl buffer, add water to 40μl, keep at 37℃ for 10 minutes), detect by agarose gel electrophoresis, and recover the linearized vector with an agarose gel recovery kit. Take 1μl of linearized vector, 4μl of DNA insert fragment (i.e., the full-length CDS sequence of the SlMYB65 gene cloned above), and 5μl of homologous recombinase reagent, a total of 10μl; mix well and keep at 50℃ for 20 minutes. After the reaction is completed, add 50μl of melted Escherichia coli competent cells to the reaction solution, precool on ice for 20 minutes, place in a 42℃ water bath for 45 seconds, add 1ml of sterile LB liquid culture medium to the workbench, and shake at 37℃ for 30 minutes. Centrifuge and discard most of the supernatant, resuspend the cells and apply them on kanamycin (50 mg / kg) solid culture medium, and invert and culture at 37°C for 10 hours. Select positive cells and verify the true positive clones through bacterial liquid PCR, send them to the sequencing company for sequencing to confirm that there are no base mismatches. Use a plasmid extraction kit to extract the correctly sequenced plant expression recombinant vector and save it for later use.

[0087] Example 2 Transgenic plant breeding of tomatoes

[0088] 1. Transform Agrobacterium with plant expression vector.

[0089] Take 5 μl of the above plant expression recombinant vector and mix it with 20 μl of Agrobacterium competent cells, put it in an ice bath for 5 minutes, heat shock at 37℃ for 4 minutes, and keep it on ice for 5 minutes; add 1 ml of LB liquid medium, shake at 28℃ for 1 hour; centrifuge and discard most of the supernatant, resuspend the bacteria and spread them on the resistant (kanamycin 50 mg / kg, rifampicin 50 mg / kg) solid medium. Incubate at 28℃ for 2 days, take the positive clones and verify the true positive bacteria through bacterial liquid PCR, and save them for later use.

[0090] 2. Obtain transgenic plants.

[0091] Place tomato seeds in a 50ml conical flask and disinfect with 1% sodium hypochlorite for 15 minutes, then wash the seeds three times with sterile water, sow them on 1 / 2MS culture medium, and place them in a light incubator (24℃-16h, 18℃-8h). About 7-10 days after seed germination, the cotyledons are fully unfolded. Cut the hypocotyls and the middle part of the cotyledons close to the cotyledons with a scalpel and place them in the pre-culture medium, and culture them in the dark at 28℃ for 1 day. Then immerse the pre-cultured explants in the Agrobacterium infection solution (OD=0.6) containing the target plasmid for 15 minutes, shake 3-4 times during the period, so that it is fully infected. Use tweezers to place the explants on sterile filter paper to absorb the residual infection solution, transfer to the co-culture medium, and culture them in the dark at 28℃ for 2 days. Then transfer the explants to the differentiation medium, place them in a light incubator (24℃-16h, 18℃-8h) to culture and induce differentiation, and change the differentiation culture plate every 10 to 15 days. The differentiated regenerated seedlings were transferred to the rooting medium and cultured in a light incubator (24°C-16h, 18°C-8h) to induce rooting. The rooted seedlings were transplanted and placed in a plant room for culture (24°C-16h, 18°C-8h).

[0092] Take T0 generation seedling leaves and extract total DNA using the CTAB method (2% CTAB, 1% PVP K30, 1.4M NaCl, 100mM Tris-HCl, 20mM EDTA-Na2). Use PCR amplification technology to screen T0 generation transgenic plants by PCR amplification using the following specific primers according to the system in Table 2, and detect the expression of SlMYB65 gene at the same time. Screen homozygous T2 generation transgenic seeds for subsequent research.

[0093] 35S-F, SEQ ID No.5: 5'-GACCAAAGGGCAATTGAGAC-3';

[0094] SlMYB65-R, SEQ ID No. 6: 5'-AACCAAAAGGATCTTTCGAAGC-3'.

[0095] Table 2

[0096]

[0097] 3. Flowering time statistics.

[0098] The first inflorescence of the wild-type tomato and three transgenic tomato plants was photographed when it bloomed, the flowering time was counted, and the data were graphed using GraphPad Prism 9.0.

[0099] Figure 1 This is the PCR verification result of T0 generation transgenic seedlings, indicating that the target DNA bands can be cloned from the tissue culture regeneration seedlings of three transgenic tomato plants. Figure 2 The expression level of SlMYB65 gene was detected in three transgenic tomato tissue culture regenerated seedlings, indicating that the transgenic tomatoes overexpressed the SlMYB65 gene. Figure 3 and Figure 4 The results showed that after overexpressing the SlMYB65 gene in tomatoes, the flowering time (i.e. the number of days from seed germination to flowering of tomato plants) of the three transgenic lines was significantly advanced compared with the wild type, that is, overexpression of the SlMYB65 gene has the biological function of promoting early flowering of tomato plants.

[0100] In view of the biological function of the above-mentioned tomato SlMYB65 gene overexpression in regulating flowering time, in the process of crop genetic improvement and breeding of new varieties and new germplasm, molecular biological breeding methods can be used to enhance the expression of SlMYB65 gene in target crops, and their offspring will bloom earlier, which provides a new breeding idea for breeding early-maturing crop varieties.

[0101] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. Application of a promoter of SlMYB65 gene expression in regulating the flowering time of tomatoes.

2. The use according to claim 1, It is characterized in that The nucleotide sequence of the coding region of the SlMYB65 gene is shown in SEQ ID No. 1; And / or, the amino acid sequence of the protein encoded by the SlMYB65 gene is shown in SEQ ID No.

2.

3. The use according to claim 1 or 2, It is characterized in that The promoter includes a recombinant vector expressing the SlMYB65 gene.

4. The use according to claim 3, It is characterized in that The recombinant vector comprises a plant expression vector pROKII-GFP, and the CDS sequence of the SlMYB65 gene is inserted into the plant expression vector pROKII-GFP.

5. A tomato breeding method, It is characterized in that include: Promoting the expression of the SlMYB65 gene in tomatoes causes them to flower earlier.

6. The tomato breeding method according to claim 5, It is characterized in that The step of promoting the expression of the S1MYB65 gene in tomatoes to make tomatoes bloom early comprises: Constructing a recombinant vector that promotes the expression of the SlMYB65 gene; The recombinant vector is transferred into a tomato recipient for cultivation.

7. The tomato breeding method according to claim 6, It is characterized in that The steps of constructing a recombinant vector for promoting the expression of the SlMYB65 gene include: The plant expression vector pROKII-GFP is digested with restriction endonucleases BamHI and KpnⅠ, and then recombined with the CDS sequence of the SlMYB65 gene to obtain the recombinant vector.

8. The tomato breeding method according to claim 6 or 7, It is characterized in that The tomato recipients include cotyledons of wild-type tomato seeds 7-10 days after germination.

9. A kit for causing tomatoes to bloom early. It is characterized in that Included is a promoter for expression of the S1MYB65 gene of tomato.

10. The kit according to claim 9, It is characterized in that The promoter comprises a recombinant vector for expressing the SlMYB65 gene, wherein the recombinant vector comprises a plant expression vector pROKII-GFP, and the CDS sequence of the SlMYB65 gene is inserted into the plant expression vector pROKII-GFP.

Images