SNP (Single Nucleotide Polymorphism) molecular marker and application thereof in improving bee germplasm resources

Abstract

The invention relates to the technical field of bee breeding, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker and application thereof in improving bee germplasm resources. The SNP molecular marker is based on a genome version PRJNA738447, the SNP molecular marker is located at the 3613559th site of the 11 # chromosome of the bee, and the polymorphism is C / T. The SNP molecular marker provided by the invention is closely linked with the length of the tarsal node of the bee, and the detection of the length of the tarsal node of the bee can be realized through a genotype detection result. The SNP molecular marker provided by the invention can be used for breeding transgenic bees and improving bee germplasm resources, and has important application value in the field of bee breeding.

Description

Technical Field

[0001] The invention relates to the technical field of bee breeding, and in particular to a SNP molecular marker and an application thereof in improving bee germplasm resources. Background Art

[0002] Chinese honey bee ( Apis cerana cerana ) is a subspecies of the Oriental honey bee, adapted to a variety of climatic conditions such as temperate and subtropical zones. The Chinese honey bee has excellent collection ability. Although its honey production is usually not as good as that of the Western honey bee, its nutritional value is higher. In different geographical environments, the Chinese honey bee exhibits different traits. Effectively judging the morphological traits of the Chinese honey bee is an important means of exploring, protecting, identifying and utilizing bee species resources.

[0003] The existing technology often uses morphological markers for bee species identification and performance evaluation. Although morphological markers have the advantages of low cost and easy operation, they have inherent disadvantages and are not applicable to Chinese bees. First, morphological markers are directly related to the individual development of bees and are easily affected by external interference factors such as nutritional conditions during development. Secondly, the morphological measurement of Chinese bees is delicate, and there are strict requirements on the accuracy of measuring instruments and the proficiency of morphological anatomy of surveyors. In addition, the workload of bee morphological measurement is huge, and the operability is not strong. Finally, the morphological measurement standards of Chinese bees are not unified, there are artificial differences between surveyors, and the phenomenon of human errors affecting the interpretation of results is serious. Tarsus length is one of the important morphological traits of bees and an important indicator on the hind legs of bees. It affects the crawling ability and pollen collection ability of bees to a certain extent. The development of molecular markers related to the tarsus length trait is conducive to the cultivation of high-quality bee species.

[0004] At present, the SNP sites associated with the length of the tarsus of Chinese honey bees are still unclear, and it is impossible to identify the trait of the tarsus length of Chinese honey bees through simple first-generation sequencing. Summary of the invention

[0005] In order to solve the problems existing in the prior art, the present invention provides a SNP molecular marker and its application in improving bee germplasm resources.

[0006] In a first aspect, the present invention provides a SNP molecular marker, which is based on the genome version PRJNA738447. The SNP molecular marker is located at position 3613559 of chromosome 11 of the honey bee, and the polymorphism is C / T.

[0007] Furthermore, the SNP molecular marker includes a nucleotide sequence as shown below: TCGCTTCAGAACTGTCAACGTTGAGAGAAAATAACAACTTTATTATTCGAAAGTTGTACAGTTTCTTCGCTTCAATCAGGCATCTACTTATCATCACAATTGTCAAAACATTCTTATTATTTAACAGAGCGATCAGAATTCATCGACAAAAGGAGCGGCAAT GTAGCACAGAAACTGTATTCAGATTTATAAATTTCGGTTACATTTCCTCTTTCAGCATCTCTCTCATTCTCTCTCTCGCTAACAAAATCATCACAATTAAGTAATTGATCACGTCACAATCGATTAAATTTAACCCCGTGACATTCTCGCGTAACAAA; There is a polymorphic site at position 169 of the nucleotide sequence, and the polymorphism is C / T.

[0008] In a second aspect, the present invention provides a primer pair for amplifying the SNP molecular marker, comprising the following nucleotide sequence: F: 5'-TCGCTTCAGAACTGTCAACG-3',

[0009] R: 5'-TTTGTTACGCGAGAATGTCAC-3'.

[0010] In a third aspect, the present invention provides a kit comprising the SNP marker or the primer pair.

[0011] In a fourth aspect, the present invention provides the use of the SNP molecular marker, or the primer pair, or the kit in the identification of the tarsus length of honey bees.

[0012] The present invention further provides the use of the SNP molecular marker, the primer pair, or the kit in any of the following: i) breeding of genetically modified bees; ii) Molecular marker-assisted breeding of honey bees; iii) Improve high-quality honey bee germplasm resources.

[0013] Furthermore, the bee is an oriental honey bee; preferably a cerana cerana cerana.

[0014] In a fifth aspect, the present invention provides a method for detecting the length trait of the hind tarsus of a honey bee, comprising: The genomic DNA of the bee to be tested is obtained; the genomic DNA is used as a template and the primer pair is used for amplification, and the tarsus length of the bee to be tested is determined according to the amplification result.

[0015] Further, based on a total system of 25 μL, the amplification system includes: Template DNA 1~2μL, upstream primer 1~2μL, downstream primer 1~2μL, Dntp mix 1~2μL, 10×TaqBuffer 2~4μL, Taq enzyme 0.2~0.4μL, the balance is water; The amplification procedure includes: Pre-denaturation at 95℃ for 5-10min; Denaturation at 92-96°C for 30-90s, annealing at 62-65°C for 30-90s, extension at 70-75°C for 30-90s, cycle 10-15 times, with the annealing temperature decreasing by 0.4-0.6°C each time; Denaturation at 92-96°C for 30-90s, annealing at 56-60°C for 30-90s, extension at 70-75°C for 30-90s, cycle 24-36 times; Repair and extend at 70~74℃ for 10~20min.

[0016] Further, judging the tarsal length of the bee to be tested according to the amplification result includes: In the amplification results, the primer pair identified that the tarsus length of the Chinese honey bee with genotype C / C was significantly shorter than that of the Chinese honey bee with genotype C / T.

[0017] The present invention has the following beneficial effects: The present invention obtains a SNP molecular marker related to the tarsus length of honey bees through genome-wide association analysis screening, which is located at position 3613559 of chromosome 11 of honey bees, and the polymorphism is C / T. The different genotype detection results of the SNP molecular marker can reflect the tarsus length trait of honey bees. The SNP molecular marker provided by the present invention can be applied to improve honey bee germplasm resources, which is of great significance in the field of honey bee breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0019] Figure 1 This is a comparison chart of the tarsal lengths of individuals with different genotypes at the Chr11_3613559 locus of the Chinese honey bee provided in Example 2 of the present invention.

[0020] Figure 2It is a gel electrophoresis diagram of the amplification result (targeting site 3613559 of honey bee chromosome 11) of the primer pair provided in Example 3 of the present invention; the left band is the marker, and the right three bands are the amplification products. DETAILED DESCRIPTION

[0021] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] The experimental methods involved in the following examples, unless otherwise mentioned, are all conventional methods in the art, for example, reference may be made to experimental manuals in the art, or the conditions recommended in the manufacturer's instructions.

[0023] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0024] Example 1

[0025] The present invention provides a method for screening SNP molecular markers related to honey bee tarsus length based on whole genome association analysis, and the specific process is as follows: 1. The analysis samples of the present invention are samples of 110 groups of Chinese honey bees, and one worker bee is selected from each group of bees to measure the length of its front tarsus. For the above-mentioned dissected worker bees, the genomic DNA of the worker bee chest tissue is extracted, and then the library is constructed using the Truseq Nano DNA HT kit (Illumina, USA). The DNA is randomly broken into 350bp fragments, and the DNA library is obtained through end repair, ployA tailing, sequencing adapter addition, amplification, purification and other steps. The insert size of the library is quality inspected using Agilent 2100, and the effective concentration of the library is accurately quantified using the qPCR method. The DNA library construction is completed after the quality meets the standard.

[0026] 2. Genome sequencing, alignment and SNPs identification: After the sample library was successfully constructed, the sample library was sequenced based on the Illumina HiseqPE150 platform (Illumina, USA). During the sequencing process, low-quality reads were deleted to ensure the quality of the results [quality control standards: delete reads containing more than 10% unknown nucleotides, delete reads containing adapter sequences, delete reads with low quality (phred quality <5) base content exceeding 50% of the length in the sequencing], and finally a single bee sample generated more than 4.5G high-quality paired-end clean reads, with Q20 and Q30 above 90% and 85%, respectively.

[0027] 3. The obtained high-quality paired-end clean reads were aligned to the reference genome Apis cerana (Genbank accession number: PRJNA738447) using BWA 0.7.8 software. The alignment results were deduplicated using SAMTOOLS 1.15 software, and the average alignment rate of the population samples was guaranteed to be above 95%, and the average sequencing depth of the genome was above 20X.

[0028] 4. The Bayesian model in SAMTOOLS 1.15 software was used to detect group SNPs, and high-quality SNPs were screened according to the quality control standards [delete SNPs with sequencing error rate >1% (Q20 quality control), delete SNPs with base spacing <5 between adjacent SNP sites, delete SNPs with coverage depth exceeding 1 / 3~5 times the average depth]. ANNOVAR 20130520 software was used to annotate the detected SNPs, identify exon regions, intron regions, variable splicing sites, upstream and downstream regions of genes, and intergenic regions, and distinguish between synonymous mutation SNPs and non-synonymous mutation SNPs.

[0029] 5. Genome-wide association analysis: Genome-wide association studies (GWAS) were conducted based on mrMLM 1.3 software to clarify the association between tarsal length and SNPs. The SNPs quality control standard was MAF>5%, and the multi-locus random mixed linear model was selected as the model.

[0030] Based on the above method, the present invention finally screened out a SNP molecular marker Chr11_3613559 related to the tarsus length of honey bees. The SNP molecular marker is located at position 3613559 of chromosome 11 of the honey bee, and the polymorphism is C / T. The polymorphism detection based on the SNP molecular marker can realize the identification of the tarsus length trait of the honey bee and improve the germplasm resources applied to honey bees.

[0031] Example 2

[0032] The present invention selects 106 Chinese honey bee samples to carry out verification work, and verifies that Example 1 involves the application of SNP molecular markers in the identification of honey bee traits. Specifically, the 106 Chinese honey bees are sequenced, and the tarsus lengths of the 106 honey bees are measured using a microscopic measurement system to obtain the tarsus length data and SNP data of the 106 honey bees. The present invention groups the animals according to the genotype types on the SNP molecular markers, and further uses SPSS 16.0 software to perform a significant difference analysis on the tarsal length data of different groups to compare whether there are differences in tarsal length between different genotypes.

[0033] Finally, 66 Chinese bees showed C / C genotype and 40 Chinese bees showed C / T genotype. The results were analyzed by independent sample T test. Figure 1 As shown: C / C genotype and C / T genotype showed significant difference ( P <0.05), the tarsus length of C / C genotype Chinese honey bees was significantly smaller than that of C / T genotype Chinese honey bees.

[0034] Table 1 Comparison of tarsus length among different genotypes of Apis cerana SNP molecular markers

[0035] Example 3

[0036] The present invention uses three samples of Chinese honey bees to amplify the SNP molecular markers involved in Example 1 by PCR, which specifically includes the following process: 1. Use the following primer pairs: Upstream primer: 5'-TCGCTTCAGAACTGTCAACG-3',

[0037] Downstream primer: 5′-TTTGTTACGCGAGAATGTCAC-3′.

[0038] 2. The PCR system is as follows:

[0039] The PCR program is as follows:

[0040] 3. Test results

[0041] The final result is as follows Figure 2As shown in the figure, it can be seen from the amplification results that the electrophoresis bands of the amplified products are clear and bright without any mixed bands. This shows that the primers, amplification system and program provided by the present invention have strong specificity and can achieve the purpose of detecting the target SNP molecular marker. The polymorphism of specific SNP molecular markers can also be detected by sequencing in the future, and then used for the detection of honey bee tarsal length and germplasm resource improvement.

[0042] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. SNP molecular marker, characterized in that: The SNP molecular marker is based on the genome version PRJNA738447, and the SNP molecular marker is located at position 3613559 of chromosome 11 of the honey bee, and the polymorphism is C / T.

2. SNP molecular marker, characterized in that: The SNP molecular marker includes a nucleotide sequence as shown below: TCGCTTCAGAACTGTCAACGTTGAGAGAAAATAACAACTTTATTATTCGAAAGTTGTACAGTTTCTTCGCTTCAATCAGGCATCTACTTATCATCACAATTGTCAAAACATTCTTATTATTTAACAGAGCGATCAGAATTCATCGACAAAAGGAGCGGCAAT GTAGCACAGAAACTGTATTCAGATTTATAAATTTCGGTTACATTTCCTCTTTCAGCATCTCTCTCATTCTCTCTCTCGCTAACAAAATCATCACAATTAAGTAATTGATCACGTCACAATCGATTAAATTTAACCCCGTGACATTCTCGCGTAACAAA; There is a polymorphic site at position 169 of the nucleotide sequence, and the polymorphism is C / T.

3. A primer pair for amplifying the SNP molecular marker according to claim 1 or 2, characterized in that: Includes the following nucleotide sequences: F: 5'-TCGCTTCAGAACTGTCAACG-3', R: 5'-TTTGTTACGCGAGAATGTCAC-3'.

4. A kit, characterized in that: include: The SNP molecular marker according to claim 1 or 2, or the primer pair according to claim 3.

5. Use of the SNP molecular marker according to claim 1 or 2, or the primer pair according to claim 3, or the kit according to claim 4 in the identification of the tarsus length trait of honey bees.

6. Use of the SNP molecular marker according to claim 1 or 2, or the primer pair according to claim 3, or the kit according to claim 4 in any of the following: i) breeding of genetically modified bees; ii) Molecular marker-assisted breeding of honey bees; iii) Improve high-quality honey bee germplasm resources.

7. The use according to claim 5 or 6, characterized in that: The honey bee is an oriental honey bee; preferably a cerana ....

8. A method for detecting the length of the tarsal segment of a honey bee, characterized in that: include: Obtaining genomic DNA of the bees to be tested; The genomic DNA is used as a template and the primer pair described in claim 3 is used for amplification, and the tarsus length of the bee to be tested is determined according to the amplification result.

9. The method according to claim 8, characterized in that Taking the total system as 25 μL, the amplification system includes: Template DNA 1~2μL, upstream primer 1~2μL, downstream primer 1~2μL, Dntp mix 1~2μL, 10×Taq Buffer 2~4μL, Taq enzyme 0.2~0.4μL, and the balance is water; The amplification procedure includes: Pre-denaturation at 95℃ for 5-10min; Denaturation at 92-96°C for 30-90s, annealing at 62-65°C for 30-90s, extension at 70-75°C for 30-90s, cycle 10-15 times, with the annealing temperature decreasing by 0.4-0.6°C each time; Denaturation at 92-96°C for 30-90s, annealing at 56-60°C for 30-90s, extension at 70-75°C for 30-90s, cycle 24-36 times; Repair and extend at 70~74℃ for 10~20min.

10. The method according to claim 8 or 9, characterized in that: The step of determining the tarsal length of the bee to be tested according to the amplification result comprises: In the amplification results, the primer pair identified that the tarsus length of the Chinese honey bee with genotype C / C was significantly shorter than that of the Chinese honey bee with genotype C / T.

Images