A molecular marker related to early heading traits in wheat and its application

Abstract

The present invention discloses a molecular marker related to the early heading trait of wheat and its application, belonging to the field of molecular genetic breeding. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a G / A mutation at position 25. The genotype of this site includes GG, AA and GA genotypes. The molecular marker provided by the present invention is used in conjunction with the early heading mutant AS2388 of Aegilops tauschii. eh The molecular markers provided by the present invention are highly significantly correlated with the early heading gene ehd1 in wheat, exhibiting tightly linked marker characteristics. They are highly accurate for molecular marker-assisted selection and can significantly improve the efficiency of selecting and identifying materials containing the ehd1 early heading gene in different genetic backgrounds, with a high success rate. The molecular markers provided by the present invention can be used to locate the early heading trait of wheat, and can also be used to quickly screen plants containing the ehd1 gene during breeding, improving breeding efficiency and providing a foundation for research on early heading genes in wheat.

Description

Technical Field

[0001] The present invention relates to the field of molecular genetic breeding, and in particular to a molecular marker related to the early heading trait of wheat and its application. Background Art

[0002] Heading time is a crucial trait that determines crop environmental adaptability and influences crop yield. A plant's heading timing is determined by the interaction between genes that promote or inhibit heading and flowering and environmental factors. Over the course of long evolutionary history, plants have developed their own adaptive mechanisms to their environment. They sense the changes in light and temperature brought about by the circadian rhythm through their leaves, thereby regulating changes in their developmental state. Flowering is a key developmental process in plants, influenced by numerous environmental factors, such as day length, light quality, ambient temperature, and available water and minerals. When a plant's internal clock rhythm matches its growth environment, it achieves optimal growth. Therefore, identifying and effectively utilizing genes involved in heading and flowering is crucial for the development of crop production.

[0003] Aegilops tauschii Coss. is the donor species for the wheat D genome. Synthetic wheat was created by crossing tetraploid wheat (AABB) with Aegilops tauschii Coss. (DD) and doubling the hybrid. Breeding and improvement of this synthetic wheat has resulted in a number of new wheat varieties, significantly enriching the genetic diversity of the wheat D genome. Therefore, gene discovery and utilization of the D genome are crucial for wheat breeding and improvement.

[0004] Molecular marker-assisted breeding does not rely on phenotypic selection, that is, it is not affected by factors such as the environment, gene interaction, or gene-environment interaction. Instead, it directly selects the genotype, thus greatly improving breeding efficiency. Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by changes such as conversion, transversion, insertion, and deletion at a specific nucleotide position in the DNA of the genome. The technology uses known sequence information to compare and find SNP sites, and then uses the discovered variant sites to design specific primers to perform PCR amplification on genomic DNA or cDNA to obtain specific polymorphic products based on the SNP sites. Finally, electrophoresis technology is used to analyze the polymorphism of the products. The advantages of SNP markers are that they are numerous and widely distributed; they are unevenly distributed in single genes and the entire genome; and the SNP allele frequency is easy to estimate.

[0005] Competitive Allele Specific PCR (KASP) is a low-cost, high-throughput genotyping technology developed by LGC (Laboratory of the Government Chemist) (http: / / www.lgcgenomics.com). It accurately types single-nucleotide polymorphisms (SNPs) and indels (InDel) by specifically matching primer terminal bases. It is widely used in molecular marker-assisted selection of crops such as rice, wheat, and soybeans. Summary of the Invention

[0006] The purpose of the present invention is to provide a molecular marker related to the early heading trait of wheat and its application, so as to solve the problems existing in the above-mentioned prior art.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a molecular marker related to the early heading trait of wheat. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a G / A mutation at position 25. The genotypes of this site include GG, AA and GA genotypes.

[0009] The present invention also provides a KASP primer set for detecting the molecular marker, comprising an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO.2, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO.3, and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO.4.

[0010] The present invention also provides a detection kit for the molecular marker, comprising the KASP primer set.

[0011] The present invention also provides an application of the KASP primer set or the detection kit in identifying the early or late heading stage traits of wheat.

[0012] The present invention also provides a method for identifying the early or late heading stage trait of wheat, comprising the following steps:

[0013] Using the genomic DNA of the wheat sample to be tested as a template, the template is amplified by fluorescent quantitative PCR using the KASP primer set or the detection kit. After the PCR amplification is completed, the fluorescent signal is read, the fluorescent signal is analyzed and converted, the genotype is identified, and the early or late heading period of the wheat is determined based on the genotype;

[0014] If the identified genotype is the AA genotype, the heading period of the wheat sample to be tested is judged to be early; if the identified genotype is the GG genotype, the heading period of the wheat sample to be tested is judged to be late.

[0015] Furthermore, the program of the fluorescent quantitative PCR amplification is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing / extension at 65°C for 60 s, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for a total of 30 cycles.

[0016] Furthermore, the fluorescent quantitative PCR amplification system is: 5 μL Master Mix, 1.4 μL mixed primers, 5 ng template DNA, and double-distilled water added to a total of 10 μL; the volume ratio of the upstream primer F1, the upstream primer F2, and the downstream primer R in the mixed primer is 4:4:1.

[0017] The present invention also provides an application of the KASP primer set or the detection kit in screening wheat with early heading traits.

[0018] The present invention also provides an application of the KASP primer set or the detection kit in molecular marker-assisted breeding of wheat with early heading traits.

[0019] The present invention discloses the following technical effects:

[0020] Molecular markers provided by the present invention and early heading mutant AS2388 of Aegilops tauschii eh It is extremely significantly correlated with the early heading gene ehd1 of rice, showing the characteristics of a tightly linked marker, and has high accuracy in molecular marker-assisted selection. It can significantly improve the efficiency of selecting and identifying materials containing the ehd1 early heading gene in different genetic backgrounds, and has a high success rate.

[0021] The molecular marker provided by the present invention can be used to locate the early heading trait of wheat, and can also be used to quickly screen plants containing the ehd1 gene during breeding, thereby improving breeding efficiency and providing a basis for research on early heading genes in wheat. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0023] Figure 1 AS2388 eh The fluorescence reading results of SNP site detection in the F2 generation strains of ×AS2407; among them, FAM (blue square, 'AS2388 eh') fluorescence indicates early heading lines, HEX (orange circle, 'AS2407') fluorescence indicates late heading lines; green triangle fluorescence indicates heterozygous lines; black diamond fluorescence indicates blank control;

[0024] Figure 2 The fluorescence readings of SNP site detection in a hexaploid background are shown, where FAM (blue square) fluorescence represents the early heading mutant AS2388. eh and Langdon and AS2388 eh The artificial wheat formed by hybridization, HEX (orange circle) fluorescence is AS2388 wild type, AS2388 WT The artificial wheat formed by hybridization with Langdon and 20

[0025] Common wheat. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] The Aegilops tauschii germplasms AS2388 and AS2407, tetraploid durum wheat Langdon, China Spring, Shumai 830, Shumai 580, Shumai 969, Shumai 114, Zhongke Nuomai 2168, Chuan Zimai 925, Nei Zimai 232, Chuanyu 72 and Chuannong 32 in the present invention were provided by the Wheat Research Institute of Sichuan Agricultural University.

[0032] Example 1: Acquisition of SNP sites associated with early heading traits and design of KASP primers

[0033] The inventors used EMS to mutate the Aegilops tauschii germplasm AS2388 to obtain an early heading mutant AS2388 eh The inventors based on mutant AS2388 eh A SNP site closely linked to the early heading gene ehd1 was developed based on the gene sequence of Aegilops tauschii AL8 / 78 reference genome (Aegilops tauschii Aet-v4.0). The gene sequence containing the SNP site is shown in SEQ ID NO. 1:

[0034] ATTGTATAATGCAGGGTGGTGAAGRCGACTGCTTTTATGTTGTTGGGAATGGTGAGT TTGG (Note: the 25th base of the sequence shown in SEQ ID NO.1 is a SNP site, which has a G / A mutation, and R represents A or G).

[0035] Based on the sequence information of SEQ ID NO.1, three primers were designed using online software: upstream primer F1 (SEQ ID NO.2), upstream primer F2 (SEQ ID NO.3), and downstream primer R (SEQ ID NO.4). F1 and F2 contain FAM and HEX fluorescent linker sequences (underlined), respectively. The sequences are as follows:

[0036] Upstream primer F1 with FAM linker sequence (SEQ ID NO.2):

[0037] 5'- GAAGGTGACCAAGTTCATGCT ATAATGCAGGGTGGTGAAGA-3';

[0038] Upstream primer F2 with HEX linker sequence (SEQ ID NO.3):

[0039] 5'- GAAGGTCGGAGTCAACGGATTATAATGCAGGGTGGTGAAGG-3';

[0040] Downstream primer R (SEQ ID NO. 4): 5'-CCAAACTCACCATTCCCAACA-3'.

[0041] Example 2 Application of SNP sites in selecting the gene ehd1 that controls early heading

[0042] (1) Using mutant material AS2388 eh As the female parent, the common Aegilops tauschii material AS2407 was used as the male parent to construct the F2 generation population. 2:3 100 lines were selected from the offspring lines and the F 2:3 The heading period traits of the families were investigated.

[0043] (2) SNP site detection was performed on the 100 strains obtained. The specific method was as follows: DNA of the 100 strains was extracted using the CTAB method at the seedling stage; the DNA was used as a substrate template and fluorescence quantitative PCR amplification was performed using the KASP primer pair designed in Example 1.

[0044] The amplification system for fluorescent quantitative PCR amplification is as follows: 5 μL Master Mix, 1.4 μL mixed primers, 5 ng template DNA, and double-distilled water added to a total of 10 μL. At the same time, at least three independent blanks with double-distilled water instead of DNA template should be added. The upstream primer F1, upstream primer F2, and downstream primer R were added at a concentration of 10 ng / μL, 120 μL, 120 μL, and 300 μL, respectively. 460 μL of ddH2O was added to mix and used as a mixed primer.

[0045] The program for fluorescence quantitative PCR amplification is as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing / extension at 65°C for 60 s, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for a total of 30 cycles; after completion, fluorescence reading is performed. Figure 1 ), will detect the AS2388 eh Plants with consistent FAM (blue) fluorescence were designated "A" for their genotype. The genotype at the SNP locus was AA, indicating an early heading homozygous line. Plants exhibiting HEX (orange) fluorescence, like AS2407, were designated "B" for their genotype. The genotype at the SNP locus was GG, indicating a late heading homozygous line. Plants with green triangle fluorescence were heterozygous, designated "H" for their genotype. The genotype at the SNP locus was GA. The genotypes and field phenotypic values ​​for each line are shown in Table 1. Comparison of heading date trait data revealed that the line genotypes were consistent with the heading date phenotypic data.

[0046] Table 1AS2407 / AS2388 eh F2 generation strains and F 2:3 Statistics of family genotype and field phenotype results

[0047]

[0048]

[0049]

[0050] Example 3 Applicability Detection of SNP Sites in Hexaploid Wheat Background

[0051] Tetraploid durum wheat Langdon was used as the female parent and the wild type Aegilops tauschii AS2388 (AS2388 WT ) early heading mutant AS2388 eh Hybridization was performed and artificial hexaploid wheat was obtained after doubling, and multiple wheat varieties (a total of 20 samples) as shown in Table 2 were used as controls for detection and verification.

[0052] The specific method is as follows: DNA of all the wheat varieties mentioned above is extracted by CTAB method at the seedling stage; using it as a substrate template, fluorescence quantitative PCR amplification is performed using the KASP primer pair designed in Example 1. The amplification system and amplification procedure are the same as in Example 2. After the fluorescence quantitative PCR amplification is completed, the fluorescence reading is performed, and the fluorescence reading results are shown in FIG. Figure 2 and Table 2.

[0053] Table 2 Materials (hexaploid background) for verifying the availability of SNP sites and genotyping results

[0054]

[0055]

[0056] From Table 2 and Figure 2 It can be seen that the SNP site is still available in the hexaploid background, providing a basis for the next step of molecular marker-assisted breeding.

[0057] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A KASP primer set for detecting molecular markers associated with early heading traits in wheat, characterized in that: It includes an upstream primer F1 having a nucleotide sequence as shown in SEQ ID NO.2, an upstream primer F2 having a nucleotide sequence as shown in SEQ ID NO.3, and a downstream primer R having a nucleotide sequence as shown in SEQ ID NO.4; The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, and there is a G / A mutation at position 25. The genotypes of this site include GG, AA and GA genotypes.

2. A detection kit for molecular markers related to early heading traits of wheat, characterized in that: Comprising the KASP primer set of claim 1; The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, and there is a G / A mutation at position 25. The genotypes of this site include GG, AA and GA genotypes.

3. Use of the KASP primer set according to claim 1 or the detection kit according to claim 2 in identifying the early or late heading stage traits of wheat.

4. A method for identifying the early or late heading stage of wheat, characterized in that: The steps include: Using the genomic DNA of the wheat sample to be tested as a template, performing fluorescent quantitative PCR amplification on the template using the KASP primer set described in claim 1 or the detection kit described in claim 2, reading the fluorescent signal after the PCR amplification is completed, analyzing and converting the fluorescent signal, identifying the genotype, and judging the early or late heading period of the wheat based on the genotype; If the identified genotype is the AA genotype, the heading period of the wheat sample to be tested is judged to be early; if the identified genotype is the GG genotype, the heading period of the wheat sample to be tested is judged to be late.

5. The method according to claim 4, characterized in that The program of the fluorescent quantitative PCR amplification was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing / extension at 65°C for 60 s, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for a total of 30 cycles.

6. The method according to claim 4, characterized in that The fluorescent quantitative PCR amplification system is as follows: 5 μL Master Mix, 1.4 μL mixed primers, 5 ng template DNA, and double-distilled water added to a total of 10 μL; the volume ratio of the upstream primer F1, the upstream primer F2, and the downstream primer R in the mixed primer is 4:4:

1.

7. Use of the KASP primer set according to claim 1 or the detection kit according to claim 2 in screening wheat for early heading trait.

8. Use of the KASP primer set according to claim 1 or the detection kit according to claim 2 in molecular marker-assisted breeding of wheat with early heading traits.

Images