Compositions comprising recombinant bacillus cells and insecticides

Abstract

The present invention relates to a composition comprising (a) an ectospore-producing recombinant bacillus cell expressing a fusion protein comprising: (i) at least one plant growth stimulating protein or peptide, and (ii) a targeting sequence localizing the fusion protein to the ectospore of the bacillus cell, in a synergistically effective amount; and (b) at least one specific insecticide disclosed herein. Furthermore, the present invention relates to the use of this composition and methods for enhancing plant growth, promoting plant health and / or reducing overall damage of plants and plant parts.

Description

[0001] This application is a divisional application, the application date of the original application is September 17, 2015, the application number is 201580062511.9 (international application number PCT / US2015 / 050612), and the name is “Composition comprising recombinant Bacillus cells and an insecticide”.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority to U.S. Provisional Patent Application No. 62 / 051,919, filed on September 17, 2014, the contents of which are incorporated herein by reference in their entirety.

[0004] Regarding electronically submitted sequence listings

[0005] The official copy of the sequence listing is submitted electronically via EFS-Web as an ASCII-formatted sequence listing, with the file name "BCS149059WO_ST25.txt", created on September 14, 2015, with a size of 152 kilobytes, and submitted simultaneously with this specification. The sequence listing contained in this ASCII-formatted file is part of the specification and is incorporated herein in its entirety by reference. background Technical Field

[0007] The present invention relates to a composition comprising a synergistically effective amount of (i) recombinant Bacillus cells producing exosporiums expressing a fusion protein comprising: (x) at least one plant growth stimulating protein or peptide; and (y) a targeting sequence that localizes the fusion protein to the exospores of the Bacillus cells; and (ii) at least one insecticide selected from the specific insecticides disclosed herein, the insecticide exhibiting the ability to improve plant growth and / or health and / or activity against insects, mites, nematodes and / or plant pathogens. In addition, the present invention relates to the use of the composition and methods for enhancing plant growth, promoting plant health and / or reducing overall damage to plants and plant parts. Background Art

[0008] In crop protection, there is a continuing need for applications that enhance plant health and / or plant growth. Healthier plants generally result in higher yields and / or better quality of the plant or its products.

[0009] In order to promote plant health, fertilizers based on organic and inorganic substances are used all over the world. Fertilizers can be single substances or combinations, used to provide nutrients to plants. A major breakthrough in fertilizer application was the development of nitrogen-based fertilizers by Justus von Liebig around 1840. However, fertilizers can lead to soil acidification and unstable soil nutrient balance, including the consumption of minerals and the enrichment of salts and heavy metals. In addition, excessive fertilizer use can lead to changes in soil animal communities and contaminate surface water and groundwater. In addition, unhealthy substances (such as nitrates) may be enriched in plants and fruits.

[0010] In addition, insecticides and fungicides are used worldwide to control pests. Synthetic insecticides or fungicides are usually non-specific and therefore can act on organisms other than the target organism (including other naturally occurring beneficial organisms). Due to their chemical properties, they may also be toxic and non-biodegradable. Consumers around the world are increasingly aware of the potential environmental and health issues associated with chemical residues (particularly chemical residues in food products). This results in increasing consumer pressure to reduce the use of chemical (i.e. synthetic) pesticides or at least reduce their number. Therefore, it is necessary to manage food chain requirements while still being able to effectively control pests.

[0011] Another problem with the use of synthetic insecticides or fungicides is that repeated or exclusive application of insecticides or fungicides usually results in the selection of resistant animal pests or microorganisms. Typically, these strains also cross-resist other active ingredients with the same mode of action. Then, the use of the active compound is no longer able to effectively prevent and treat pathogens. However, the development of active ingredients with new mechanisms of action is difficult and expensive.

[0012] The use of biological control agents (BCAs) as plant health enhancers and / or plant protection agents is an alternative to fertilizers and synthetic pesticides. In some cases, the effectiveness of BCAs is not at the same level as conventional insecticides and fungicides, especially under conditions of severe infection pressure. Therefore, in some cases, biological control agents, their mutants, and metabolites produced therefrom (especially at low application rates) are not completely satisfactory. Therefore, there is a constant need to develop new plant health enhancing compositions and / or plant protection compositions, including biological control agents used in combination with synthetic fungicides and insecticides, in an effort to meet the above requirements. Summary of the invention

[0013] In view of this, in particular, an object of the present invention is to provide a composition having an enhanced ability to improve plant growth and / or enhance plant health or showing enhanced activity against insects, mites, nematodes and / or plant pathogens.

[0014] It has therefore been found that these objects are achieved with the composition of the invention as defined below. The composition is capable of enhancing (i) plant growth, plant yield and / or plant health and / or (ii) activity against insects, mites, nematodes and / or plant pathogens, preferably in a superadditive manner, by applying a) recombinant exospore-producing Bacillus cells expressing a fusion protein comprising (i) at least one plant growth stimulating protein or peptide selected from the group consisting of: enzymes involved in the production or activation of plant growth stimulating compounds, enzymes that degrade or modify bacterial, fungal or plant nutrient sources, and proteins or peptides that protect plants from pathogens or pests; and (ii) a targeting sequence that localizes the fusion protein to the exospores of the Bacillus cells; and b) at least one specific pesticide disclosed herein.

[0015] The targeting sequences, exospore proteins, exospore protein fragments, fusion proteins, and recombinant exospore-producing Bacillus cells expressing such fusion proteins mentioned herein should not be considered as independent embodiments. Instead, throughout this application, the targeting sequences, exospore proteins, exospore protein fragments, fusion proteins, and recombinant exospore-producing Bacillus cells expressing such fusion proteins mentioned should be considered to be disclosed or claimed only in combination with one or more specific pesticides described herein (and preferably in a synergistic combination). In addition, the reference to "specific pesticides disclosed herein" is intended to include the pesticides described in paragraphs [000185]-[000186] below.

[0016] The present invention relates to a composition comprising a synergistically effective amount of: a) a recombinant Bacillus cell producing exospores expressing a fusion protein comprising (i) at least one plant growth stimulating protein or peptide selected from the group consisting of enzymes involved in the production or activation of plant growth stimulating compounds, enzymes that degrade or modify bacterial, fungal or plant nutrient sources, and proteins or peptides that protect plants from pathogens; and (ii) a targeting sequence that localizes the fusion protein to the exospore of the Bacillus cell;and b) at least one insecticide selected from the group consisting of acetamiprid, aldicarb, amitraz, beta-cyfluthrin, carbaryl, clothianidin, cyfluthrin, cypermethrin, deltamethrin, endosulfan, ethion, ethiprole, chlorpyrifos ... ethoprophos, fenamiphos, fenobucarb, fenthion, fipronil, flubendiamide, flupyradifurone, fluopyram, formetanate, heptanophos, imidacloprid, metamidophos, methiocarb, methomyl, niclosamide, oxydemeton-methyl, phosalone, silafluofen, spirodiclofen, spiromesifen, spirotetramat, thiacloprid, thiodicarb, tralomethrin, triazophorone os), triflumuron, vamidothion, 1-{2-fluoro-4-methyl-5-[(R)-(2,2,2-trifluoroethyl)sulfinyl]phenyl}-3-(trifluoromethyl)-1H-1,2,4-triazol-5-amine, 1-(3-chloropyridin-2-yl)-N-[4-cyano-2-methyl-6-(methylcarbamoyl)phenyl]-3-{[5-(trifluoromethyl)-2H-tetrazol-2-yl]methyl}-1H-pyrazole-5-carboxamide, and a pesticide terpene mixture containing three terpenes: α-terpinene, p-cymene and limonene. ;

[0017] In some embodiments, the targeting sequence comprises: an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 1; a targeting sequence comprising amino acids 20-35 of SEQ ID NO: 1; a targeting sequence comprising amino acids 22-31 of SEQ ID NO: 1; a targeting sequence comprising amino acids 22-33 of SEQ ID NO: 1; a targeting sequence comprising amino acids 20-31 of SEQ ID NO: 1; a targeting sequence comprising SEQ ID NO: 1; or an exospore protein comprising an amino acid sequence having at least 85% identity to SEQ ID NO:2.

[0018] In some embodiments, the bacillus cell producing exospores is a cell of a member of the Bacillus cereus family. The recombinant bacillus cell producing exospores can be any one of: Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis, Bacillus toyoiensis and combinations thereof. In another embodiment, the recombinant bacillus cell is a cell of Bacillus thuringiensis BT013A.

[0019] In some aspects, the fusion protein comprises an enzyme involved in the production or activation of a plant growth stimulating compound, the enzyme selected from the group consisting of acetoin reductase, indole-3-acetamide hydrolase, tryptophan monooxygenase, acetolactate synthase, α-acetolactate decarboxylase, pyruvate decarboxylase, diacetyl reductase, butanediol dehydrogenase, aminotransferase, tryptophan decarboxylase, amine oxidase, indole-3-pyruvate decarboxylase, indole-3-acetaldehyde dehydrogenase, tryptophan side chain oxidase, nitrile hydrolase, nitrilase, peptidase, protease, adenosine phosphate isopentenyltransferase, phosphatase, adenosine kinase, adenine phosphoribosyltransferase, CYP735A, 5' ribonucleotide phosphohydrolase, adenosine nucleosidase, zeatin cis-trans isomerase, zeatin O-glucosyltransferase, β-glucosidase, cis-hydroxylase, CK cis-hydroxylase, CK N-glucosyltransferase, 2,5-ribonucleotide phosphohydrolase, adenosine nucleosidase, purine nucleoside phosphorylase, zeatin reductase, hydroxylamine reductase, 2-oxoglutarate dioxygenase, gibberellin 2B / 3B hydrolase, gibberellin 3-oxidase, gibberellin 20-oxidase, chitosanase, chitinase, β-1,3-glucanase, β-1,4-glucanase, β-1,6-glucanase, aminocyclopropane-1-carboxylate deaminase and enzymes involved in the production of nodulation (nod) factor.

[0020] In other aspects, the fusion protein comprises an enzyme that degrades or modifies a bacterial, fungal or plant nutrient source, the enzyme being selected from the group consisting of cellulases, lipases, lignin oxidases, proteases, glycoside hydrolases, phosphatases, nitrogenases, nucleases, amidases, nitrate reductases, nitrite reductases, amylases, ammonia oxidases, ligninases, glucosidases, phospholipases, phytases, pectinases, glucanases, sulfatases, ureases, xylanases and siderophores.

[0021] In other aspects, the fusion protein comprises a protein or peptide that protects plants from pathogens, and the protein or peptide has insecticidal activity, worm-killing activity, inhibits insect or worm predation, or a combination thereof. Such proteins may include insecticidal bacterial toxins, endotoxins, Cry toxins, protease inhibitor proteins or peptides, cysteine ​​proteases or chitinases. The protein or peptide may include VIP insecticidal toxins, trypsin inhibitors, arrowhead protease inhibitors, Cry toxins (e.g., Cry toxins from Bacillus thuringiensis).

[0022] In certain embodiments, the insecticide is selected from acetamiprid, aldicarb, amitraz, β-cyfluthrin, carbaryl, clothianidin, cyfluthrin, cypermethrin, deltamethrin, endosulfan, ethion, ethiprole, fenamiphos, fenbutyl, fenthion, fipronil, flubendiamide, flupyrazone, fluopyram, flumethrin, flufenamid, heptylphos, imidacloprid, methamidophos, methiocarb, methomyl, chloranil, sulfone, phosalone, chloranil, spirodicarb, spiromesifen, spirotetramat, thiacloprid, thiodicarb, tralomethrin, triazophos, insecticide. The pesticides selected from the group consisting of 1-{2-fluoro-4-methyl-5-[(R)-(2,2,2-trifluoroethyl)sulfinyl]phenyl}-3-(trifluoromethyl)-1H-1,2,4-triazol-5-amine, 1-(3-chloropyridin-2-yl)-N-[4-cyano-2-methyl-6-(methylcarbamoyl)phenyl]-3-{[5-(trifluoromethyl)-2H-tetrazol-2-yl]methyl}-1H-pyrazole-5-carboxamide and a pesticide terpene mixture containing three terpenes: α-terpinene, p-cymene and limonene.

[0023] In other embodiments, the insecticide is selected from clothianidin, cypermethrin, ethiprole, fipronil, fluopyram, flupyrad, imidacloprid, methiocarb, and thiodicarb.

[0024] In some embodiments, the compositions of the invention comprise a) a recombinant exospore-producing Bacillus cell expressing a fusion protein comprising (i) at least one plant growth stimulating protein or peptide selected from enzymes involved in the production or activation of plant growth stimulating compounds and enzymes that degrade or modify bacteria, fungi or plant nutrient sources or at least one protein or peptide that protects plants from pathogens; and (ii) a targeting sequence that localizes the fusion protein to the exospore of the Bacillus cell; and b) at least one pesticide selected from clothianidin, cypermethrin, ethiprole, fipronil, fluopyram, flupyrad, imidacloprid, methiocarb and thiodicarb.

[0025] In a specific aspect of the above embodiment, (i) the at least one insecticide is clothianidin; (ii) the targeting sequence comprises an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; (iii) the plant growth stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosinase, preferably having at least 95% sequence identity to SEQ ID NO: 107, 108 and 109, respectively; and (iv) the recombinant Bacillus cereus family member cell comprises a cell of Bacillus thuringiensis or Bacillus mycoides. In another specific embodiment, the recombinant Bacillus cereus family member cell is a cell of Bacillus thuringiensis BT013A.

[0026] In a specific aspect of the above embodiment, (i) the at least one insecticide is cypermethrin; (ii) the targeting sequence comprises an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; (iii) the plant growth stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosanase, preferably having at least 95% sequence identity to SEQ ID NO: 107, 108 and 109, respectively; and (iv) the recombinant Bacillus cereus family member cell comprises a cell of Bacillus thuringiensis or Bacillus mycoides. In another specific embodiment, the recombinant Bacillus cereus family member cell is a cell of Bacillus thuringiensis BT013A.

[0027] In a specific aspect of the above embodiment, (i) the at least one pesticide is ethidium bromide; (ii) the targeting sequence comprises an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; (iii) the plant growth stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosanase, preferably having at least 95% sequence identity to SEQ ID NO: 107, 108 and 109, respectively; and (iv) the recombinant Bacillus cereus family member cell comprises a cell of Bacillus thuringiensis or Bacillus mycoides. In another specific embodiment, the recombinant Bacillus cereus family member cell is a cell of Bacillus thuringiensis BT013A.

[0028] In a specific aspect of the above embodiment, (i) the at least one insecticide is fipronil; (ii) the targeting sequence comprises an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; (iii) the plant growth stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosanase, preferably having at least 95% sequence identity to SEQ ID NO: 107, 108 and 109, respectively; and (iv) the recombinant Bacillus cereus family member cell comprises a cell of Bacillus thuringiensis or Bacillus mycoides. In another specific embodiment, the recombinant Bacillus cereus family member cell is a cell of Bacillus thuringiensis BT013A.

[0029] In a specific aspect of the above embodiment, (i) the at least one pesticide is fluopyram; (ii) the targeting sequence comprises an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; (iii) the plant growth stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosanase, preferably having at least 95% sequence identity to SEQ ID NO: 107, 108 and 109, respectively; and (iv) the recombinant Bacillus cereus family member cell comprises a cell of Bacillus thuringiensis or Bacillus mycoides. In another specific embodiment, the recombinant Bacillus cereus family member cell is a cell of Bacillus thuringiensis BT013A.

[0030] In a specific aspect of the above embodiment, (i) the at least one pesticide is flupyralidone; (ii) the targeting sequence comprises an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; (iii) the plant growth stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosanase, preferably having at least 95% sequence identity to SEQ ID NO: 107, 108 and 109, respectively; and (iv) the recombinant Bacillus cereus family member cell comprises a cell of Bacillus thuringiensis or Bacillus mycoides. In another specific embodiment, the recombinant Bacillus cereus family member cell is a cell of Bacillus thuringiensis BT013A.

[0031] In a specific aspect of the above embodiment, (i) the at least one insecticide is imidacloprid; (ii) the targeting sequence comprises an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; (iii) the plant growth stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosanase, preferably having at least 95% sequence identity to SEQ ID NO: 107, 108 and 109, respectively; and (iv) the recombinant Bacillus cereus family member cell comprises a cell of Bacillus thuringiensis or Bacillus mycoides. In another specific embodiment, the recombinant Bacillus cereus family member cell is a cell of Bacillus thuringiensis BT013A.

[0032] In a specific aspect of the above embodiment, (i) the at least one pesticide is methiocarb; (ii) the targeting sequence comprises an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; (iii) the plant growth stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosanase, preferably having at least 95% sequence identity to SEQ ID NO: 107, 108 and 109, respectively; and (iv) the recombinant Bacillus cereus family member cell comprises a cell of Bacillus thuringiensis or Bacillus mycoides. In another specific embodiment, the recombinant Bacillus cereus family member cell is a cell of Bacillus thuringiensis BT013A.

[0033] In a specific aspect of the above embodiment, (i) the at least one pesticide is thiodicarb; (ii) the targeting sequence comprises an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; (iii) the plant growth stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosanase, preferably having at least 95% sequence identity to SEQ ID NO: 107, 108 and 109, respectively; and (iv) the recombinant Bacillus cereus family member cell comprises a cell of Bacillus thuringiensis or Bacillus mycoides. In another specific embodiment, the recombinant Bacillus cereus family member cell is a cell of Bacillus thuringiensis BT013A.

[0034] In yet other embodiments, the composition further comprises at least one fungicide. The at least one fungicide may be synthetic.

[0035] In certain aspects, the composition further comprises at least one auxiliary agent selected from fillers, solvents, spontaneity promoters, carriers, emulsifiers, dispersants, frost protectants, thickeners and adjuvants.

[0036] In other aspects, the invention relates to seeds treated with any of the compositions disclosed herein.

[0037] In addition, the present invention relates to the use of the disclosed compositions as insecticides and / or fungicides. In certain aspects, the disclosed compositions are used to reduce overall damage to plants and plant parts, and to reduce losses of harvested fruits or vegetables caused by insects, mites, nematodes and / or plant pathogens. In other aspects, the disclosed compositions are used to enhance plant growth and / or promote plant health.

[0038] In addition, the present invention relates to a method for treating plants, plant parts (e.g., seeds, roots, rhizomes, bulbs, corms or tubers) and / or the locus on or near which the plants or plant parts grow (e.g., soil) to enhance plant growth and / or promote plant health, the method comprising the steps of: simultaneously or sequentially applying to the plants, plant parts and / or the locus of the plants a synergistically effective amount of: a) recombinant Bacillus cells that produce exospores expressing a fusion protein comprising (i) at least one plant growth stimulating protein or peptide selected from the group consisting of: enzymes involved in the production or activation of plant growth stimulating compounds, enzymes that degrade or modify bacteria, fungi or plant nutrient sources, and proteins or peptides that protect plants from pathogens; and (ii) a targeting sequence that localizes the fusion protein to the exospores of the Bacillus cells; and b) at least one pesticide selected from the specific pesticides disclosed herein that exhibit activity against insects, mites, nematodes and / or plant pathogens.

[0039] In another embodiment, the present invention is a method for reducing overall damage to plants and plant parts, and reducing losses of harvested fruits or vegetables caused by insects, mites, nematodes and / or plant pathogens, comprising the steps of: simultaneously or sequentially applying to the plants, plant parts (e.g., seeds, roots, rhizomes, bulbs, corms or tubers) and / or the locus on or near which the plants or plant parts grow (e.g., soil) a synergistically effective amount of: a) recombinant Bacillus cells that produce exospores expressing a fusion protein comprising (i) at least one plant growth stimulating protein or peptide selected from the group consisting of enzymes involved in the production or activation of plant growth stimulating compounds, enzymes that degrade or modify bacterial, fungal or plant nutrient sources, and proteins or peptides that protect plants from pathogens; and (ii) a targeting sequence that localizes the fusion protein to the exospores of the Bacillus cells; and b) at least one insecticide selected from the specific insecticides disclosed herein that exhibit activity against insects, mites, nematodes and / or plant pathogens.

[0040] In the above paragraphs, the term "including" or any of its derivatives may be replaced by "consisting of" or its appropriate corresponding derivatives. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 Shown is an alignment of the amino acid sequence of the amino-terminal portion of Bacillus anthracis Sterne strain BclA with corresponding regions of various exospore proteins of Bacillus cereus family members. DETAILED DESCRIPTION

[0042] In general, "pesticide" refers to the ability of a substance to increase mortality or inhibit the growth rate of plant pests. The term is used herein to describe the property of a substance that exhibits activity against insects, mites, nematodes and / or plant pathogens. In the sense of the present invention, the term "pest" includes insects, mites, nematodes and / or plant pathogens.

[0043] NRRL is the abbreviation of Agricultural Research Culture Collection, and its address is: National Agricultural Research Center, ARS, USDA, 1815 North University Street, Peoria, Illinois 61604, USA.

[0044] ATCC is the abbreviation of the American Type Culture Collection Center, and its address is: ATCC Patent Depository Center, 10801 University Avenue, Manassas, Virginia, USA, Postal Code 10110.

[0045] All strains described herein and having accession numbers prefixed with NRRL or ATCC have been deposited with the above-mentioned depositaries under the Budapest Convention on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure.

[0046] "Enzymes involved in the production or activation of plant growth stimulating compounds" include any enzyme that catalyzes any step in the biosynthetic pathway of a compound that stimulates plant growth or changes plant architecture, or any enzyme that catalyzes the conversion of an inactive or less active derivative of a compound that stimulates plant growth or changes plant architecture into an active or more active form of the compound. For example, such compounds include, but are not limited to, small molecule plant hormones (e.g., auxins and cytokinins), bioactive peptides, and small plant growth stimulating molecules synthesized by bacteria or fungi in the rhizosphere (e.g., 2,3-butanediol).

[0047] As used herein, "plant immune system enhancer protein or peptide" includes any protein or peptide that has a beneficial effect on the immune system of a plant.

[0048] As used herein, the term "plant growth stimulating protein or peptide" includes any protein or peptide that enhances plant growth in a plant exposed to the protein or peptide.

[0049] The terms "promoting plant growth" and "stimulating plant growth" are used interchangeably herein and refer to enhancing or increasing at least one of plant height, weight, leaf size, root size or stem size to increase protein production in a plant or to increase grain yield in a plant.

[0050] As used herein, a "protein or peptide that protects a plant from a pathogen" includes any protein or peptide that renders a plant exposed to the protein or peptide less susceptible to infection by the pathogen.

[0051] As used herein, a "protein or peptide that enhances stress tolerance in a plant" includes any protein or peptide that renders a plant exposed to the protein or peptide more tolerant to stress.

[0052] The term "plant binding protein or peptide" refers to any peptide or protein that is capable of binding specifically or non-specifically to any part of a plant (eg, roots or aerial parts of a plant such as leaves, stems, flowers or fruits) or plant matter.

[0053] As used herein, the term "targeting sequence" refers to a polypeptide sequence that enables the localization of a longer polypeptide or protein to the exospores of a Bacillus cereus family member.

[0054] Exospore-producing recombinant Bacillus cells expressing fusion proteins

[0055] The fusion protein comprises a targeting sequence that targets the fusion protein to the exospore of a member of the Bacillus cereus family, an exospore protein or an exospore protein fragment, and: (a) a plant growth stimulating protein or peptide; (b) a protein or peptide that protects plants from pathogens; (c) a protein or peptide that enhances plant stress tolerance; (d) a plant binding protein or peptide; or (e) a plant immune system enhancer protein or peptide. When expressed in a member of the Bacillus cereus family bacterium, these fusion proteins are targeted to the exospore layer of the spore and are physically oriented so that the protein or peptide is arranged on the outside of the spore.

[0056] This Bacillus exospore array (BEMD) system can be used to deliver peptides, enzymes and other proteins to plants (e.g., plant leaves, fruits, flowers, stems or roots) or plant growth substrates (e.g., soil). Peptides, enzymes and proteins delivered to soil or other plant growth substrates in this manner remain in the soil and exhibit activity for extended periods of time. Introducing recombinant Bacillus cells that produce exospores expressing fusion proteins described herein into soil or the rhizosphere of plants brings about beneficial enhancement of plant growth under many different soil conditions. Using BEMD to produce these enzymes allows them to continue to exert their beneficial effects on plants and the rhizosphere during the first few months of plant life.

[0057] Targeting sequences, exospore proteins, and exospore protein fragments

[0058] For ease of reference, the SEQ ID NOs of the peptide and protein sequences referred to herein are listed in Table 1 below.

[0059] Table 1. Peptide and protein sequences

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069] AA = amino acid

[0070] * Bacillus anthracis Sterne strain BclA has 100% sequence identity with Bacillus thuringiensis BclA. Thus, SEQ ID NOs: 1, 2, and 59 also represent amino acids 1-41 of Bacillus thuringiensis BclA, full-length Bacillus thuringiensis BclA, and amino acids 1-196 of Bacillus thuringiensis BclA, respectively. Similarly, SEQ ID NO: 60 also represents a methionine residue plus amino acids 20-35 of Bacillus thuringiensis BclA.

[0071] ** Bacillus mycoides hypothetical protein TIGR03720 has 100% sequence identity with Bacillus mycoides hypothetical protein WP003189234. Therefore, SEQ ID NOs: 57 and 58 also represent amino acids 1-136 of Bacillus mycoides hypothetical protein WP003189234 and the full-length Bacillus mycoides hypothetical protein WP003189234, respectively.

[0072] Bacillus is a genus of rod-shaped bacteria. The Bacillus cereus family of bacteria includes the following species: Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus toyoiensis, and Bacillus weihenstephensis. Under stressful environmental conditions, Bacillus cereus family bacteria undergo sporulation and form oval endospores that can remain dormant for a long time. The outermost layer of the endospore is called the exospore and includes a basal layer surrounded by villi of external hair-like protrusions. The filaments on the hair-like villi are mainly formed by the collagenous glycoprotein BclA, while the basal layer is composed of many different proteins. Another collagen-related protein BclB is also present in the exospore and is exposed to the endospores of members of the Bacillus cereus family.

[0073] BclA, a major component of the surface villi, has been shown to be attached to the exospore with its amino terminus (N-terminus) located at the basal layer and its carboxyl terminus (C-terminus) extending outward from the spore.

[0074] It has been previously discovered that certain sequences from the N-terminal regions of BclA and BclB can be used to target peptides or proteins to the exospores of Bacillus cereus endospores (see U.S. Patent Publication Nos. 2010 / 0233124 and 2011 / 0281316 and Thompson, et al., "Targeting of the BclA and BclB Proteins to the Bacillus anthracis Spore Surface," Molecular Microbiology, 70(2):421-34 (2008), the entire contents of each of which are incorporated herein by reference). It has also been discovered that the BetA / BAS3290 protein of Bacillus anthracis is localized to exospores.

[0075] Specifically, amino acids 20-35 of BclA from Bacillus anthracis Sterne strain have been found to be sufficient for targeting to exospores. A sequence alignment of amino acids 1-41 of BclA (SEQ ID NO: 1) with several other Bacillus cereus family exospore proteins with related sequences and the corresponding N-terminal regions of Bacillus cereus family proteins is shown in Figure 1 In. From Figure 1As can be seen, there is a region of high homology between all proteins in the region corresponding to amino acids 20-41 of BclA. However, in these sequences, the amino acids corresponding to amino acids 36-41 of BclA contain secondary structure and are not required for the fusion protein to be localized to the exospore. The conserved targeting sequence region of BclA (amino acids 20-35 of SEQ ID NO: 1) is Figure 1 The more highly conserved region in the targeting sequence spanning amino acids 25-35 of BclA is shown in bold in Figure 1 The sequence is underlined in and is the recognition sequence for ExsFA / BxpB / ExsFB and their homologues, which direct and assemble the proteins on the surface of the exospore. Figure 1 The amino acid sequences of SEQ ID NO. 3, 5 and 7 in the embodiment are amino acids 1-33 of Bacillus anthracis Sterne strain BetA / BAS3290, amino acids 2-43 of Bacillus anthracis Sterne strain BAS4623 followed by methionine, and amino acids 1-34 of Bacillus anthracis Sterne strain BclB, respectively. (For BAS4623, it has been found that replacing the valine present at position 1 in the native protein with methionine results in better expression.) Figure 1 As can be seen, each of these sequences contains a conserved region corresponding to amino acids 20-35 of BclA (SEQ ID NO: 1; shown in bold) and a more highly conserved region corresponding to amino acids 20-35 of BclA (underlined).

[0076] Other proteins from members of the Bacillus cereus family also contain conserved targeting regions. Figure 1SEQ ID NO: 9 is amino acids 1-30 of Bacillus anthracis Sterne strain BAS1882, SEQ ID NO: 11 is amino acids 1-39 of the gene product of Bacillus weihenstephensis KBAB4 2280, SEQ ID NO: 13 is amino acids 1-39 of the gene product of Bacillus weihenstephensis KBAB4 3572, SEQ ID NO: 15 is amino acids 1-49 of the exospore leader peptide of Bacillus cereus VD200, SEQ ID NO: 17 is amino acids 1-33 of the exospore leader peptide of Bacillus cereus VD166, SEQ ID NO: 19 is amino acids 1-39 of the hypothetical protein IKG_04663 of Bacillus cereus VD200, SEQ ID NO: 21 is amino acids 1-39 of the β-helical protein of Bacillus weihenstephensis KBAB4, SEQ ID NO: 23 is amino acids 1-39 of the β-helical protein of Bacillus weihenstephensis weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363, SEQ ID NO:25 is amino acids 1-30 of Bacillus weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131, SEQ ID NO:27 is amino acids 1-36 of Bacillus weihenstephensis KBAB4 collagen-containing triple helix repeats, SEQ ID NO:29 is amino acids 1-39 of Bacillus mycoides 2048 hypothetical protein bmyco0001_21660, SEQ ID NO:31 is amino acids 1-30 of Bacillus mycoides 2048 hypothetical protein bmyc0001_22540, SEQ ID NO:33 is amino acids 1-21 of Bacillus mycoides 2048 hypothetical protein bmyc0001_21510, SEQ ID SEQ ID NO:35 is amino acids 1-22 of Bacillus thuringiensis 35646 collagen triple helix repeat protein, SEQ ID NO:43 is amino acids 1-35 of Bacillus cereus hypothetical protein WP_69652, SEQ ID NO:45 is amino acids 1-41 of Bacillus cereus exospore leader WP016117717, SEQ ID NO:47 is amino acids 1-49 of Bacillus cereus exospore peptide WP002105192, SEQ ID NO:49 is amino acids 1-38 of Bacillus cereus hypothetical protein WP87353, SEQ ID NO:51 is amino acids 1-39 of Bacillus cereus exospore peptide 02112369, SEQ IDSEQ ID NO:53 is amino acids 1-39 of Bacillus cereus exospore protein WP016099770, SEQ ID NO:55 is amino acids 1-36 of Bacillus thuringiensis hypothetical protein YP006612525, and SEQ ID NO:57 is amino acids 1-136 of Bacillus mycoides hypothetical protein TIGR03720. Figure 1 As shown, the N-terminal regions of these proteins each contain a conserved region of amino acids 20-35 of BclA (SEQ ID NO: 1), as well as a more highly conserved region corresponding to amino acids 25-35 of BclA.

[0077] Any portion of BclA including amino acids 20-35 can be used as a targeting sequence. In addition, the full-length exospore protein or exospore protein fragments can be used to target the fusion protein to the exospore. Thus, the full-length BclA or a fragment of BclA including amino acids 20-35 can be used to target the exospore. For example, the full-length BclA (SEQ ID NO: 2) or a medium-sized fragment of BclA lacking the carboxyl terminus, such as SEQ ID NO: 59 (amino acids 1-196 of BclA), can be used to target the fusion protein to the exospore. Medium-sized fragments such as the SEQ ID NO: 59 fragment have less secondary structure than the full-length BclA and have been found to be suitable for use as targeting sequences. The targeting sequence may also include a shorter portion of BclA containing amino acids 20-35, such as SEQ ID NO: 1 (amino acids 1-41 of BclA), amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO: 1, or SEQ ID NO: 60 (a methionine residue linked to amino acids 20-35 of BclA). Even shorter fragments of BclA that include only certain of amino acids 20-35 also exhibit the ability to target the fusion protein to exospores. For example, the targeting sequence may include amino acids 22-31 of SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1, or amino acids 20-31 of SEQ ID NO: 1.

[0078] Alternatively, BetA / BAS3290, BAS4623, BclB, BAS1882, KBAB4 2280 gene product, KBAB4 3572 gene product, Bacillus cereus VD200 exospore leader peptide, Bacillus cereus VD166 exospore leader peptide, Bacillus cereus VD200 hypothetical protein IKG_04663, B. weihenstephensis KBAB4 YVTN β-helical protein, B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363, B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131, B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2147, B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2290, B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2291, B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2293, B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2294, B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2295, B. weihenstephensis KBAB4 contains triple helical repeats of collagen, Bacillus mycoides 2048 hypothetical protein bmyco0001_21660, Bacillus mycoides 2048 hypothetical protein bmyc0001_22540, Bacillus mycoides 2048 hypothetical protein bmyc0001_21510, Bacillus thuringiensis 35646 collagen triple helical repeat protein, Bacillus cereus hypothetical protein WP_69652, Bacillus cereus exogenous Any portion of spore leader WP016117717, Bacillus cereus exospore peptide WP002105192, Bacillus cereus hypothetical protein WP87353, Bacillus cereus exospore peptide 02112369, Bacillus cereus exospore protein WP016099770, Bacillus thuringiensis hypothetical protein YP006612525, or Bacillus mycoides hypothetical protein TIGR03720 can be used as a targeting sequence. Figure 1As can be seen, amino acids 12-27 of BetA / BAS3290, amino acids 23-38 of BAS4623, amino acids 13-28 of BclB, amino acids 9-24 of BAS1882, amino acids 18-33 of the KBAB4 2280 gene product, amino acids 18-33 of the KBAB4 3572 gene product, amino acids 28-43 of the exospore leader peptide of Bacillus cereus VD200, amino acids 12-27 of the exospore leader peptide of Bacillus cereus VD166, amino acids 18-33 of the Bacillus cereus VD200 hypothetical protein IKG_04663, amino acids 18-33 of the B. weihenstephensis KBAB4 YVTN β-helical protein, and amino acids 9-24 of the B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363. amino acids 9-24 of KBAB4 hypothetical protein bcerkbab4_2131, amino acids 15-30 of B. weihenstephensis KBAB4 containing triple helical repeats of collagen, amino acids 18-33 of B. mycoides 2048 hypothetical protein bmyco0001_21660, amino acids 9-24 of B. mycoides 2048 hypothetical protein bmyc0001_22540, amino acids 1-15 of B. mycoides 2048 hypothetical protein bmyc0001_21510, amino acids 1-16 of B. thuringiensis 35646 collagen triple helical repeat protein, and amino acids 1-17 of B. cereus hypothetical protein WP_69652. amino acids 14-29 of Bacillus cereus exospore leader WP016117717, amino acids 20-35 of Bacillus cereus exospore peptide WP002105192, amino acids 17-32 of Bacillus cereus hypothetical protein WP87353, amino acids 18-33 of Bacillus cereus exospore peptide 02112369, amino acids 18-33 of Bacillus cereus exospore protein WP016099770, amino acids 15-30 of Bacillus thuringiensis hypothetical protein YP006612525, and amino acids 115-130 of Bacillus mycoides hypothetical protein TIGR03720 correspond to amino acids 20-35 of BclA. Thus, any portion of these proteins containing the corresponding amino acids listed above can be used as a targeting sequence.

[0079] Additionally, any amino acid sequence containing amino acids 20-35 of BclA, or any of the corresponding amino acids listed above, can be used as a targeting sequence.

[0080] Thus, the targeting sequence may include amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO: 1, SEQ ID NO: 1, SEQ ID NO: 60, amino acids 22-31 of SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1, or amino acids 20-31 of SEQ ID NO: 1. Alternatively, the targeting sequence consists of amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO: 1, SEQ ID NO: 1, or SEQ ID NO: 60. Alternatively, the targeting sequence may consist of amino acids 22-31 of SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1, or amino acids 20-31 of SEQ ID NO: 1. Alternatively, the exospore protein may comprise full-length BclA (SEQ ID NO: 2), or the exospore protein fragment may comprise a medium-sized fragment of BclA lacking the carboxyl terminus, such as SEQ ID NO: 59 (amino acids 1-196 of BclA). Alternatively, the exospore protein fragment may consist of SEQ ID NO:59.

[0081] The targeting sequence may also include amino acids 1-27 of SEQ ID NO:3, amino acids 12-27 of SEQ ID NO:3, or SEQ ID NO:3, or the exospore protein may include full-length BetA / BAS3290 (SEQ ID NO:4). It has also been found that a methionine residue linked to amino acids 12-27 of BetA / BAS3290 can be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO:61. The targeting sequence may also include amino acids 14-23 of SEQ ID NO:3, amino acids 14-25 of SEQ ID NO:3, or amino acids 12-23 of SEQ ID NO:3.

[0082] The targeting sequence can also include amino acids 1-38 of SEQ ID NO:5, amino acids 23-38 of SEQ ID NO:5, or SEQ ID NO:5, or the exospore protein can include full-length BAS4623 (SEQ ID NO:6).

[0083] Alternatively, the targeting sequence can include amino acids 1-28 of SEQ ID NO:7, amino acids 13-28 of SEQ ID NO:7, or SEQ ID NO:7, or the exospore protein can include full-length BclB (SEQ ID NO:8).

[0084] The targeting sequence may also include amino acids 1-24 of SEQ ID NO:9, amino acids 9-24 of SEQ ID NO:9, or SEQ ID NO:9, or the exospore protein may include full-length BAS1882 (SEQ ID NO:10). A methionine residue linked to amino acids 9-24 of BAS1882 may also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO:69.

[0085] The targeting sequence can also include amino acids 1-33 of SEQ ID NO: 11, amino acids 18-33 of SEQ ID NO: 11, or SEQ ID NO: 11, or the exospore protein can include the full-length B. weihenstephensis KBAB4 2280 gene product (SEQ ID NO: 12). A methionine residue linked to amino acids 18-33 of the B. weihenstephensis KBAB4 2280 gene product can also be used as a targeting sequence. Thus, the targeting sequence can include SEQ ID NO: 62.

[0086] The targeting sequence may also include amino acids 1-33 of SEQ ID NO: 13, amino acids 18-33 of SEQ ID NO: 13, or SEQ ID NO: 13, or the exospore protein may include the full-length B. weihenstephensis KBAB4 3572 gene product (SEQ ID NO: 14). A methionine residue linked to amino acids 18-33 of the B. weihenstephensis KBAB4 3572 gene product may also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO: 63.

[0087] Alternatively, the targeting sequence can include amino acids 1-43 of SEQ ID NO: 15, amino acids 28-43 of SEQ ID NO: 15, or SEQ ID NO: 15, or the exospore protein can include the full-length Bacillus cereus VD200 exospore leader peptide (SEQ ID NO: 16).

[0088] The targeting sequence may also include amino acids 1-27 of SEQ ID NO: 17, amino acids 12-27 of SEQ ID NO: 17, or SEQ ID NO: 17, or the exospore protein may include the full-length Bacillus cereus VD166 exospore leader peptide (SEQ ID NO: 18). A methionine residue linked to amino acids 12-27 of the exospore leader peptide of Bacillus cereus VD166 may also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO: 64.

[0089] The targeting sequence can also include amino acids 1-33 of SEQ ID NO: 19, amino acids 18-33 of SEQ ID NO: 19, or SEQ ID NO: 19, or the exospore protein can include full-length Bacillus cereus VD200 hypothetical protein IKG_04663 (SEQ ID NO: 20).

[0090] Alternatively, the targeting sequence includes amino acids 1-33 of SEQ ID NO:21, amino acids 18-33 of SEQ ID NO:21, or SEQ ID NO:21, or the exospore protein may include the full-length B. weihenstephensis KBAB4 YVTN β-helical protein (SEQ ID NO:22). A methionine residue linked to amino acids 18-33 of the B. weihenstephensis KBAB4 YVTN β-helical protein may also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO:65.

[0091] The targeting sequence may also include amino acids 1-24 of SEQ ID NO: 23, amino acids 9-24 of SEQ ID NO: 23, or SEQ ID NO: 23, or the exospore protein may include the full-length B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363 (SEQ ID NO: 24). A methionine residue linked to amino acids 9-24 of the B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363 may also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO: 66.

[0092] The targeting sequence includes amino acids 1-24 of SEQ ID NO: 25, amino acids 9-24 of SEQ ID NO: 25, or SEQ ID NO: 25, or the exospore protein may include the full-length B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131 (SEQ ID NO: 26). A methionine residue linked to amino acids 9-24 of the B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131 may also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO: 67.

[0093] Alternatively, the targeting sequence includes amino acids 1-30 of SEQ ID NO:27, amino acids 15-30 of SEQ ID NO:27, or SEQ ID NO:27, or the exospore protein may include full-length B. weihenstephensis KBAB4 collagen-containing triple helix repeat (SEQ ID NO:28).

[0094] The targeting sequence can also include amino acids 1-33 of SEQ ID NO:29, amino acids 18-33 of SEQ ID NO:29, or SEQ ID NO:29, or the exospore protein can include full-length Bacillus mycoides 2048 hypothetical protein bmyco0001_21660 (SEQ ID NO:30).

[0095] The targeting sequence may also include amino acids 1-24 of SEQ ID NO:31, amino acids 9-24 of SEQ ID NO:31, or SEQ ID NO:31, or the exospore protein may include the full-length Bacillus mycoides 2048 hypothetical protein bmyc0001_22540 (SEQ ID NO:32). A methionine residue linked to amino acids 9-24 of the Bacillus mycoides 2048 hypothetical protein bmyc0001_22540 may also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO:68.

[0096] Alternatively, the targeting sequence includes amino acids 1-15 of SEQ ID NO:33, SEQ ID NO:33, or the exospore protein includes full-length Bacillus mycoides 2048 hypothetical protein bmyc0001_21510 (SEQ ID NO:34).

[0097] The targeting sequence may also include amino acids 1-16 of SEQ ID NO:35, SEQ ID NO:35, or the exospore protein may include full-length Bacillus thuringiensis 35646 collagen triple helix repeat protein (SEQ ID NO:36).

[0098] The targeting sequence can include amino acids 1-29 of SEQ ID NO: 43, amino acids 14-29 of SEQ ID NO: 43, or SEQ ID NO: 43, or the exospore protein can include full-length Bacillus cereus hypothetical protein WP_69652 (SEQ ID NO: 44).

[0099] Alternatively, the targeting sequence may include amino acids 1-35 of SEQ ID NO:45, amino acids 20-35 of SEQ ID NO:45, or SEQ ID NO:45, or the exospore protein may include the full-length Bacillus cereus exospore leader WP016117717 (SEQ ID NO:46). A methionine residue linked to amino acids 20-35 of the Bacillus cereus exospore leader WP016117717 may also be used as a targeting sequence. Thus, the targeting sequence may include SEQ ID NO:70.

[0100] The targeting sequence may include amino acids 1-43 of SEQ ID NO:47, amino acids 28-43 of SEQ ID NO:47, or SEQ ID NO:47, or the exospore protein may include full-length Bacillus cereus exospore peptide WP002105192 (SEQ ID NO:48).

[0101] The targeting sequence may include amino acids 1-32 of SEQ ID NO:49, amino acids 17-32 of SEQ ID NO:49, or SEQ ID NO:49, or the exospore protein may include full-length Bacillus cereus hypothetical protein WP87353 (SEQ ID NO:50).

[0102] Alternatively, the targeting sequence can include amino acids 1-33 of SEQ ID NO:51, amino acids 18-33 of SEQ ID NO:51, or SEQ ID NO:51, or the exospore protein can include full-length Bacillus cereus exospore peptide 02112369 (SEQ ID NO:52).

[0103] The targeting sequence can include amino acids 1-33 of SEQ ID NO:53, amino acids 18-33 of SEQ ID NO:53, or SEQ ID NO:53, or the exospore protein can include full-length Bacillus cereus exospore protein WP016099770 (SEQ ID NO:54).

[0104] Alternatively, the targeting sequence can include amino acids 1-30 of SEQ ID NO:55, amino acids 15-30 of SEQ ID NO:55, or SEQ ID NO:55, or the exospore protein can include full-length Bacillus thuringiensis hypothetical protein YP006612525 (SEQ ID NO:56).

[0105] The targeting sequence can also include amino acids 1-130 of SEQ ID NO:57, amino acids 115-130 of SEQ ID NO:57, or SEQ ID NO:57, or the exospore protein can include full-length Bacillus mycoides hypothetical protein TIGR03720 (SEQ ID NO:58).

[0106] In addition, from Figure 1 As can be readily seen in the sequence alignment of , although amino acids 20-35 of BclA are conserved, and amino acids 25-35 are more conserved, a certain degree of variation can occur in this region without affecting the ability of the targeting sequence to target the protein to the exospore. Figure 1 The percent identity of each corresponding amino acid of each sequence to amino acids 20-35 of BclA ("20-35% identity") and amino acids 25-35 of BclA ("25-35% identity") is listed. Thus, for example, compared to amino acids 20-35 of BclA, the corresponding amino acids of BetA / BAS3290 are about 81.3% identical, the corresponding amino acids of BAS4623 are about 50.0% identical, the corresponding amino acids of BclB are about 43.8% identical, the corresponding amino acids of BAS1882 are about 62.5% identical, the corresponding amino acids of the KBAB42280 gene product are about 81.3% identical, and the corresponding amino acids of the KBAB43572 gene product are about 81.3% identical. The sequence identities for this region with the rest of the sequence are listed in Figure 1 middle.

[0107] Relative to amino acids 25-35 of BclA, the corresponding amino acids of BetA / BAS3290 are about 90.9% identical, the corresponding amino acids of BAS4623 are about 72.7% identical, the corresponding amino acids of BclB are about 54.5% identical, the corresponding amino acids of BAS1882 are about 72.7% identical, the corresponding amino acids of the KBAB4 2280 gene product are about 90.9% identical, and the corresponding amino acids of the KBAB43572 gene product are about 81.8% identical. The sequence identities of this region with the rest of the sequence are listed in Figure 1 middle.

[0108] Thus, the targeting sequence can include an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%.

[0109] The targeting sequence may also include an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%.

[0110] The targeting sequence may also include an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%.

[0111] The targeting sequence may also include an amino acid sequence having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%.

[0112] Alternatively, the targeting sequence may include an amino acid sequence having at least about 62% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%. The targeting sequence may also consist of an amino acid sequence consisting of 16 amino acids and having at least about 62% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO: 1 is at least about 72%.

[0113] The targeting sequence may include an amino acid sequence having at least 68% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least 68% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.

[0114] The targeting sequence may also include an amino acid sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO: 1 is at least about 72%.

[0115] The targeting sequence may also include an amino acid sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO: 1 is at least about 81%.

[0116] The targeting sequence may also include an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.

[0117] The targeting sequence may include an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 90%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 90%.

[0118] One skilled in the art will recognize that variants of the above sequences can also be used as targeting sequences, so long as the targeting sequence comprises amino acids 20-35 of BclA, the corresponding amino acids of BetA / BAS3290, BAS4263, BclB, BAS1882, KBAB42280 gene product, or KBAB3572 gene product, or there is a sequence containing any of the above sequence identities to amino acids 20-35 and 25-35 of BclA.

[0119] It has also been discovered that certain Bacillus cereus family exospore proteins lacking the region with homology to amino acids 25-35 of BclA can also be used to target peptides or proteins to exospores of Bacillus cereus family members. Specifically, the fusion protein may include an exospore protein comprising SEQ ID NO:71 (Bacillus mycoides InhA), an exospore protein comprising SEQ ID NO:72 (Bacillus anthracis Sterne BAS1141 (ExsY)), an exospore protein comprising SEQ ID NO:73 (Bacillus anthracis Sterne BAS1144 (BxpB / ExsFA)), an exospore protein comprising SEQ ID NO:74 (Bacillus anthracis Sterne BAS1145 (CotY)), an exospore protein comprising SEQ ID NO:75 (Bacillus anthracis SterneBAS1140), an exospore protein comprising SEQ ID NO:76 (Bacillus anthracis H9401 ExsFB), an exospore protein comprising SEQ ID NO:77 (Bacillus thuringiensis HD74 InhA1), an exospore protein comprising SEQ ID NO:78 (Bacillus cereus ATCC 10876ExsJ), an exospore protein comprising SEQ ID NO: 79 (Bacillus cereus ExsH), an exospore protein comprising SEQ ID NO: 80 (Bacillus anthracis Ames YjcA), an exospore protein comprising SEQ ID NO: 81 (Bacillus anthracis YjcB), an exospore protein comprising SEQ ID NO: 82 (Bacillus anthracis SterneBclC), an exospore protein comprising SEQ ID NO: 83 (Bacillus thuringiensis serovar konkukian strain 97-27 acid phosphatase), or an exospore protein comprising SEQ ID NO: 84 (Bacillus thuringiensis HD74 InhA2). The fusion proteins described herein, including the exospore protein comprising SEQ ID NO: 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 or 84, will achieve targeting to the exospores of Bacillus cereus family members.

[0120] In addition, exospore proteins having a high degree of sequence identity to any of the above-described full-length exospore proteins or exospore protein fragments can also be used to target peptides or proteins to the exospores of Bacillus cereus family members. Thus, the fusion protein can include an exospore protein containing amino acids having at least 85% identity to any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 59, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, and 84. Alternatively, the fusion protein may include an exospore protein that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 59, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, and 84.

[0121] Alternatively, the fusion protein may include an exospore protein fragment consisting of an amino acid sequence having at least 85% identity to SEQ ID NO: 59. Alternatively, the fusion protein may include an exospore protein fragment consisting of an amino acid sequence having at least 90%, at least 95%, at least 98%, at least 99% or 100% identity to SEQ ID NO: 59.

[0122] In any of the targeting sequences, exospore proteins, or exospore protein fragments described herein, the targeting sequence, exospore protein, or exospore protein fragment may include the amino acid sequence GXT at its carboxylic acid terminus, wherein X is any amino acid.

[0123] In any of the targeting sequences, exospore proteins, and exospore protein fragments described herein, the targeting sequence, exospore protein, or exospore protein fragment may include an alanine residue at the position of the targeting sequence corresponding to amino acid 2 of SEQ ID NO: 1.

[0124] Fusion Protein

[0125] The fusion protein may include a targeting sequence, an exospore protein or exospore protein fragment, and at least one plant growth stimulating protein or peptide. The plant growth stimulating protein or peptide may include a peptide hormone, a non-hormone peptide, an enzyme involved in the production or activation of a plant growth stimulating compound, or an enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source. The targeting sequence, exospore protein, or exospore protein fragment may be any of the above-mentioned targeting sequences, exospore proteins, or exospore protein fragments.

[0126] The fusion protein may include a targeting sequence, an exospore protein or an exospore protein fragment, and at least one protein or peptide that protects plants from pathogens. The targeting sequence, exospore protein or exospore protein fragment may be any of the above-mentioned targeting sequences, exospore proteins or exospore protein fragments.

[0127] Fusion proteins can be prepared using standard cloning and molecular biological methods known in the art. For example, the gene encoding a protein or peptide (for example, a gene encoding a plant growth stimulating protein or peptide) can be amplified by polymerase chain reaction (PCR) and connected to the DNA encoding any of the above-mentioned targeting sequences to form a DNA molecule encoding a fusion protein. The DNA molecule encoding the fusion protein can be cloned into any suitable vector, such as a plasmid vector. The vector suitably includes a multiple cloning site that can easily insert the DNA molecule encoding the fusion protein. The vector also suitably contains a selectable marker, such as an antibiotic resistance gene, so that the bacteria transformed, transfected or paired with the vector can be easily identified and separated. When the vector is a plasmid, the plasmid also suitably includes a replication origin. The DNA encoding the fusion protein is suitably under the control of a sporulation promoter, which will cause the fusion protein to be expressed on the exospores of the endospores of the Bacillus cereus family member (for example, the natural bclA promoter from the Bacillus cereus family member). Alternatively, the DNA encoding the fusion protein can be integrated into the chromosomal DNA of the Bacillus cereus family member host.

[0128] The fusion protein may also include additional polypeptide sequences that are not part of the targeting sequence, exospore protein, exospore protein fragment, or plant growth stimulating protein or peptide, protein or peptide that protects plants from pathogens, protein or peptide that enhances plant stress tolerance, or plant binding protein or peptide. For example, the fusion protein may include a tag or marker that facilitates purification or visualization of the fusion protein (e.g., a polyhistidine tag or a fluorescent protein such as GFP or YFP) or a tag or marker that facilitates visualization of spores of recombinant Bacillus cells that produce exospores expressing the fusion protein.

[0129] The use of the targeting sequences, exospore proteins, and exospore protein fragments described herein enhances fusion protein expression on exospores due to the lack of secondary structure at the amino termini of these sequences, which allows for native folding of the fusion protein and retention of activity. Proper folding can be further enhanced by including a short amino acid linker between the targeting sequence, exospore protein, exospore protein fragment, and fusion partner protein.

[0130] Thus, any fusion protein described herein can include an amino acid linker between a targeting sequence, an exospore protein, or an exospore protein fragment and a plant growth stimulating protein or peptide, a protein or peptide that protects a plant from a pathogen, a protein or peptide that enhances plant stress tolerance, or a plant binding protein or peptide.

[0131] The linker may include a polyalanine linker or a polyglycine linker. Linkers comprising a mixture of alanine and glycine residues may also be used. For example, when the targeting sequence includes SEQ ID NO: 1, the fusion protein may have one of the following structures:

[0132] No linker: SEQ ID NO: 1 - fusion partner protein

[0133] Alanine linker: SEQ ID NO: 1-An-fusion partner protein

[0134] Glycine linker: SEQ ID NO: 1-Gn-fusion partner protein

[0135] Mixed alanine and glycine linker: SEQ ID NO: 1-(A / G)n-fusion partner protein

[0136] Wherein An, Gn and (A / G)n are any number of alanine, any number of glycine, or any number of mixtures of alanine and glycine, respectively. For example, n can be 1 to 25, preferably 6 to 10. When the linker comprises a mixture of alanine and glycine residues, any combination of glycine and alanine residues can be used. In the above structure, "fusion partner protein" means a plant growth stimulating protein or peptide, a protein or peptide that protects plants from pathogens, a protein or peptide that enhances plant stress tolerance, or a plant binding protein or peptide.

[0137] Alternatively, or in addition, the linker may include a protease recognition site. The inclusion of a protease recognition site allows for targeted removal of a plant growth stimulating protein or peptide, a protein or peptide that protects plants from pathogens, a protein or peptide that enhances plant stress tolerance, or a plant binding protein or peptide when exposed to a protease that recognizes the protease recognition site.

[0138] Plant Growth Stimulating Proteins and Peptides

[0139] As described above, the fusion protein may include a targeting sequence, an exospore protein or exospore protein fragment and at least one plant growth stimulating protein or peptide. For example, the plant growth stimulating protein or peptide may include a peptide hormone, a non-hormone peptide, an enzyme involved in the production or activation of a plant growth stimulating compound, or an enzyme that degrades or modifies a bacterial, fungal or plant nutrient source.

[0140] For example, when the plant growth stimulating protein or peptide comprises a peptide hormone, the peptide hormone may include phytosulfin (eg, phytosulfin-α), Arabidopsis thaliana (clavata 3, CLV3), systemin, ZmlGF, or SCR / SP11.

[0141] When the plant growth stimulating protein or peptide comprises a non-hormone peptide, the non-hormone peptide may include RKN 16D10, Hg-Syv46, eNOD40 peptide, melittin, wasp toxin, Mas7, RHPP, POLARIS or kunitz trypsin inhibitor (KTI).

[0142] Plant growth stimulating proteins or peptides may include enzymes involved in the production or activation of plant growth stimulating compounds. The enzyme involved in the production or activation of plant growth stimulating compounds may be any enzyme that catalyzes any step in the biosynthetic pathway of a compound that stimulates plant growth or changes plant structure, or any enzyme that catalyzes the conversion of an inactive or less active derivative of a compound that stimulates plant growth or changes plant structure into an active or more active form of the compound.

[0143] Plant growth stimulating compounds may include compounds produced by bacteria or fungi in the rhizosphere, for example, 2,3-butanediol.

[0144] Alternatively, the plant growth stimulating compound may include a plant growth hormone, for example, a cytokinin or a cytokinin derivative, ethylene, an auxin or an auxin derivative, gibberellic acid or a gibberellic acid derivative, abscisic acid or an abscisic acid derivative, or jasmonic acid or a jasmonic acid derivative.

[0145] When the plant growth stimulating compound comprises a cytokinin or a cytokinin derivative, the cytokinin or cytokinin derivative may comprise kinetin, cis-zeatin, trans-zeatin, 6-benzylaminopurine, dihydroxyzeatin, N6-(D2-isopentenyl)adenine, ribosylzeatin, N6-(D2-isopentenyl)adenosine, 2-methylthio-cis-ribosylzeatin, cis-ribosylzeatin, trans-ribosylzeatin, 2-methylthio-trans-ribosylzeatin, ribosylzeatin Zeatin-5-monophosphate, N6-methylaminopurine, N6-dimethylaminopurine, 2'-deoxyzeatin riboside, 4-hydroxy-3-methyl-trans-2-butenylaminopurine, ortho-topolin, meta-topolin, benzyl adenine, ortho-methyltopolin, meta-methyltopolin, ortho-methyltopolin, or a combination thereof.

[0146] When the plant growth stimulating compound comprises an auxin or an auxin derivative, the auxin or auxin derivative may comprise an active auxin, an inactive auxin, a conjugated auxin, a naturally occurring auxin, or a synthetic auxin, or a combination thereof. For example, the auxin or auxin derivative may comprise indole-3-acetic acid, indole-3-pyruvic acid, indole-3-acetaldehyde oxime, indole-3-acetamide, indole-3-acetonitrile, indole-3-ethanol, indole-3-pyruvic acid, indole-3-acetaldehyde oxime, indole-3-butyric acid, phenylacetic acid, 4-chloroindole-3-acetic acid, a glucose-conjugated auxin, or a combination thereof.

[0147] Enzymes involved in the production or activation of plant growth stimulating compounds may include acetoin reductase, indole-3-acetamide hydrolase, tryptophan monooxygenase, acetolactate synthase, α-acetolactate decarboxylase, pyruvate decarboxylase, diacetyl reductase, butanediol dehydrogenase, aminotransferase (e.g., tryptophan aminotransferase), tryptophan decarboxylase, amine oxidase, indole-3-pyruvate decarboxylase, indole-3-acetaldehyde dehydrogenase, tryptophan side chain oxidase, nitrile hydrolase, nitrilase, peptidase, protease, adenosine phosphate isopentenyl transferase, phosphatase, adenosine kinase, adenine phosphoribosyl transferase, CYP735A, 5' ribonucleotide Phosphohydrolase, adenosine nucleosidase, zeatin cis-trans isomerase, zeatin O-glucosyltransferase, β-glucosidase, cis-hydroxylase, CK cis-hydroxylase, CK N-glucosyltransferase, 2,5-ribonucleotide phosphohydrolase, adenosine nucleosidase, purine nucleoside phosphorylase, zeatin reductase, hydroxylamine reductase, 2-oxoglutarate dioxygenase, gibberellin 2B / 3B hydrolase, gibberellin 3-oxidase, gibberellin 20-oxidase, chitosanase, chitinase, β-1,3-glucanase, β-1,4-glucanase, β-1,6-glucanase, aminocyclopropane-1-carboxylic acid deaminase, or an enzyme involved in the production of nodulation factors (e.g., nodA, nodB or nodI).

[0148] When the enzyme comprises a protease or a peptidase, the protease or peptidase may be a protease or peptidase that cleaves a protein, peptide, proprotein or preproprotein to produce a biologically active peptide. The biologically active peptide may be any peptide that exerts a biological activity.

[0149] Examples of bioactive peptides include RKN 16D10 and RHPP.

[0150] Proteases or peptidases that cleave proteins, peptides, proproteins or preproproteins to produce biologically active peptides may include subtilisin, acid proteases, alkaline proteases, proteases, endopeptidases, exopeptidases, thermolysin, papain, pepsin, trypsin, pronase, carboxylase, serine protease, glutamic acid protease, aspartic acid protease, cysteine ​​protease, threonine protease, or metalloprotease.

[0151] Proteases or peptidases can cleave proteins in protein-rich diets such as soy flour or yeast extract.

[0152] Plant growth stimulating proteins can also include enzymes that degrade or modify bacteria, fungi or plant nutrition sources. Such enzymes include cellulase, lipase, lignin oxidase, protease, glycoside hydrolase, phosphatase, nitrogenase, nuclease, amidase, nitrate reductase, nitrite reductase, amylase, ammonia oxidase, lignin enzyme, glucosidase, phospholipase, phytase, pectinase, glucanase, sulfatase, urease, xylanase and siderophore. When introduced into plant growth matrix or applied to plants, seeds, or the region around plants or plant seeds, the fusion protein comprising the enzyme that degrades or modifies bacteria, fungi or plant nutrition sources can contribute to the processing of nutrients near plants, and improve the intake of nutrients by plants or the intake of nutrients by beneficial bacteria or fungi near plants.

[0153] Suitable cellulases include endocellulases (e.g., endoglucanases such as Bacillus subtilis endoglucanase, Bacillus thuringiensis endoglucanase, Bacillus cereus endoglucanase, or Bacillus clausii endoglucanase), exocellulases (e.g., Trichoderma reesei exocellulase), and β-glucosidases (e.g., Bacillus subtilis β-glucosidase, Bacillus thuringiensis β-glucosidase, Bacillus cereus β-glucosidase, or Bacillus clausii β-glucosidase).

[0154] The lipase may include Bacillus subtilis lipase, Bacillus thuringiensis lipase, Bacillus cereus lipase, or Bacillus clausii lipase.

[0155] In one embodiment, the lipase comprises a Bacillus subtilis lipase. The Bacillus subtilis lipase can be PCR amplified using the following primers: ggatccatggctgaacacaatcc (forward, SEQ ID NO: 37) and ggatccttaattcgtattctggcc (reverse, SEQ ID NO: 38).

[0156] In another embodiment, the cellulase is a Bacillus subtilis endoglucanase.The Bacillus subtilis endoglucanase can be PCR amplified using the following primers: ggatccatgaaacggtcaatc (forward, SEQ ID NO: 39) and ggatccttactaatttggttctgt (reverse, SEQ ID NO: 40).

[0157] In yet another embodiment, the fusion protein includes the E. coli protease PtrB. The E. coli protease PtrB can be PCR amplified using the following primers: ggatccatgctaccaaaagcc (forward, SEQ ID NO: 41) and ggatccttagtccgcaggcgtagc (reverse, SEQ ID NO: 42).

[0158] In certain embodiments, the fusion protein contains an endoglucanase derived from the nucleotide sequence in SEQ ID NO:104.

[0159] An exemplary endoglucanase amino acid sequence that can be fused to a targeting sequence, an exospore protein, or an exospore protein fragment, and optionally a linker sequence (e.g., a poly-A linker) is the fusion protein provided as SEQ ID NO:107.

[0160] In other embodiments, the fusion protein contains a phospholipase derived from the nucleotide sequence shown in SEQ ID NO:105.

[0161] An exemplary amino acid sequence of a phospholipase that can be fused to a targeting sequence, an exospore protein, or an exospore protein fragment, and optionally a linker sequence (e.g., a poly-A linker) is the fusion protein provided as SEQ ID NO: 108.

[0162] In yet other embodiments, the fusion protein contains a chitosanase derived from the nucleotide sequence set forth in SEQ ID NO: 106. An exemplary chitosanase amino acid sequence that can be fused to a targeting sequence, an exospore protein, or an exospore protein fragment, and optionally a linker sequence (e.g., a poly-A linker) is a fusion protein provided as SEQ ID NO: 109.

[0163] To generate a fusion construct, the gene can be fused to the native bclA promoter of Bacillus thuringiensis DNA encoding the first 35 amino acids of BclA (amino acids 1-35 of SEQ ID NO: 1) using overlap extension splicing (SOE) technology. The correct amplicon is cloned into the E. coli / Bacillus shuttle vector pHP13, and the correct clone is screened by DNA sequencing. The correct clone is electroporated into Bacillus thuringiensis (Cry-, plasmid-) and screened for chloramphenicol resistance. The correct transformant is grown overnight at 30°C in brain heart infusion, placed on nutrient agar plates, and cultured at 30°C for 3 days. Spores expressing the fusion construct (BEMD spores) can be collected from the plate by washing in phosphate buffered saline (PBS) and purified by centrifugation and washing again in PBS.

[0164] In such a fusion protein, the endoglucanase, phospholipase or chitosanase may include a nucleotide sequence encoding an amino acid sequence having at least 85% identity to SEQ ID NO: 107, 108 or 109, respectively.

[0165] In such a fusion protein, the endoglucanase, phospholipase or chitosanase can include an amino acid sequence having at least 90% identity to SEQ ID NO: 107, 108 or 109, respectively.

[0166] In such a fusion protein, the endoglucanase, phospholipase or chitosanase can include an amino acid sequence having at least 95% identity to SEQ ID NO: 107, 108 or 109, respectively.

[0167] In such a fusion protein, the endoglucanase, phospholipase or chitosanase can include an amino acid sequence having at least 98% identity to SEQ ID NO: 107, 108 or 109, respectively.

[0168] In such a fusion protein, the endoglucanase, phospholipase or chitosanase can include an amino acid sequence that is at least 99% identical to SEQ ID NO: 107, 108 or 109, respectively.

[0169] Suitable lignin oxidases include lignin peroxidase, laccase, glyoxal oxidase, ligninase, and manganese peroxidase.

[0170] The protease may include a subtilisin, an acid protease, an alkaline protease, a proteinase, a peptidase, an endopeptidase, an exopeptidase, a thermolysin, a papain, a pepsin, a trypsin, a pronase, a carboxylase, a serine protease, a glutamic acid protease, an aspartic acid protease, a cysteine ​​protease, a threonine protease, or a metalloprotease.

[0171] The phosphatase can include a phosphomonoester hydrolase, a phosphomonoesterase (e.g., PhoA4), a phosphodiester hydrolase, a phosphodiesterase, a triphosphate monoester hydrolase, a phosphoanhydrase, a pyrophosphatase, a phytase (e.g., Bacillus subtilis EE148 phytase or Bacillus thuringiensis BT013A phytase), a trimetaphosphatase, or a triphosphatase.

[0172] The nitrogenase may include a Nif family nitrogenase (eg, Paenibacillus massiliensis NifBDEHKNXV).

[0173] Proteins and peptides that protect plants from pathogens

[0174] The fusion protein may include a targeting sequence, an exospore protein, or an exospore protein fragment and at least one protein or peptide that protects a plant from a pathogen.

[0175] The protein or peptide may include a protein or peptide that stimulates a plant immune response. For example, a protein or peptide that stimulates a plant immune response may include a plant immune system enhancer protein or peptide. A plant immune system enhancer protein or peptide may be any protein or peptide that has a beneficial effect on the immune system of a plant. Suitable plant immune system enhancer proteins and peptides include harpin, alpha-elastin, beta-elastin, systemin, phenylalanine ammonia lyase, elicitors, defensins, cryptotin, flagellin, and flagellin peptides (e.g., flg22).

[0176] Alternatively, the protein or peptide that protects plants from pathogens may be a protein or peptide having antibacterial activity, antifungal activity, or both. Examples of such proteins and peptides include bacteriocins, lysozymes, lysozyme peptides (e.g., LysM), siderophores, non-ribosomal active peptides, conalbumin, albumin, lactoferrin, lactoferrin peptides (e.g., LfcinB), TasA, and streptavidin.

[0177] The protein or peptide that protects plants from pathogens can also be a protein or peptide that has insecticidal activity, worm-killing activity, inhibits insect or worm predation, or a combination thereof. For example, the protein or peptide that protects plants from pathogens can include insecticidal bacterial toxins (e.g., VIP insecticidal proteins), endotoxins, Cry toxins (e.g., Cry toxins from Bacillus thuringiensis), protease inhibitor proteins or peptides (e.g., trypsin inhibitors or arrowhead protease inhibitors), cysteine ​​proteases, or chitinases. When the Cry toxin is a Cry toxin from Bacillus thuringiensis, the Cry toxin can be a Cry5B protein or a Cry21A protein. Both Cry5B and Cry21A have both insecticidal and nematicidal activity.

[0178] The protein that protects plants from pathogens may include enzymes. Suitable enzymes include proteases and lactonases. Proteases and lactonases may be specific for bacterial signal molecules (e.g., bacterial lactone homoserine signal molecules).

[0179] When the enzyme is a lactonase, the lactonase may include 1,4-lactonase, 2-pyrone-4,6-dicarboxylate lactonase, 3-oxoadipate enol-lactonase, actinomycin lactonase, deoxycitrate A-ring-lactonase, gluconolactonase L-rhamnolic acid-1,4-lactonase, limonin-D-ring-lactonase, steroid-lactonase, triacetate-lactonase, or xylonate-1,4-lactonase.

[0180] The enzyme may also be an enzyme specific to a bacterial or fungal cell component. For example, the enzyme may include β-1,3-glucanase, β-1,4-glucanase, β-1,6-glucanase, chitosanase, chitinase, chitosanase-like enzyme, lytic enzyme, peptidase, protease, protease (e.g., alkaline protease, acid protease, or neutral protease), mutanolysin, stapholysin or lysozyme.

[0181] Proteins and peptides that enhance plant stress tolerance

[0182] The fusion protein may include a targeting sequence, an exospore protein, or an exospore protein fragment and at least one protein or peptide that enhances plant stress tolerance.

[0183] For example, the protein or peptide that enhances plant stress tolerance includes an enzyme that degrades stress-related compounds. The stress-related compounds include but are not limited to aminocyclopropane-1-carboxylic acid (ACC), reactive oxygen species, nitric oxide, oxylipins and phenols. Concrete reactive oxygen species include hydroxyl, hydrogen peroxide, oxygen and superoxide. The enzyme that degrades stress-related compounds may include superoxide dismutase, oxidase, catalase, aminocyclopropane-1-carboxylic acid deaminase, peroxidase, antioxidant enzyme or antioxidant peptide.

[0184] The albumen or peptide that strengthen plant stress tolerance can also comprise the albumen or peptide that protection plant is exempted from environmental stress.For example, environmental stress can comprise: drought, waterlogging, heat, freezing, salt, heavy metal, low pH, high pH, ​​or its combination.For example, the albumen or peptide that protection plant is exempted from environmental stress can comprise ice nucleoprotein, proline enzyme, phenylalanine ammonia lyase, isochorismate synthetase, isochorismate pyruvate lyase or choline dehydrogenase.

[0185] Plant Binding Proteins and Peptides

[0186] The fusion protein may include a targeting sequence, an exospore protein, or an exospore protein fragment, and at least a plant binding protein or peptide. The plant binding protein or peptide may be any protein or peptide that is capable of specifically or non-specifically binding to any part of a plant (e.g., a plant root or an aerial part of a plant such as a leaf, stem, flower, or fruit) or plant matter. Thus, for example, the plant binding protein or peptide may be a root binding protein or peptide, or a leaf binding protein or peptide.

[0187] Suitable plant binding proteins and peptides include adhesins (e.g., rhicadhesin), flagellins, omptins, lectins, expansins, biofilm structural proteins (e.g., TasA or YuaB), fimbriae proteins, curlus proteins, tight adhesins, invasins, lectins, and afimbrial proteins.

[0188] Recombinant Bacillus expressing fusion protein

[0189] The fusion proteins described herein can be expressed by recombinant Bacillus cells that produce exospores. The fusion protein can be any fusion protein discussed above.

[0190] The recombinant Bacillus cells producing exospores can co-express two or more of any of the fusion proteins discussed above. For example, the recombinant Bacillus cells producing exospores can co-express at least one fusion protein comprising a plant binding protein or peptide, and at least one fusion protein comprising a plant growth stimulating protein or peptide, at least one fusion protein comprising a protein or peptide that protects a plant from pathogens, or at least one protein or peptide that enhances plant stress tolerance.

[0191] The recombinant Bacillus cell producing exospores may include Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis, Bacillus toyoiensis, or a combination thereof. For example, the recombinant Bacillus cell producing exospores may include Bacillus cereus, Bacillus thuringiensis, Bacillus pseudomycoides, or Bacillus mycoides. Specifically, the recombinant Bacillus cell producing exospores may include Bacillus thuringiensis or Bacillus mycoides.

[0192] In order to produce recombinant bacillus cells expressing fusion proteins, any Bacillus cereus family member can be conjugated, transduced or transformed with a vector encoding the fusion protein using standard methods known in the art (e.g., by electroporation). Bacteria can then be screened by any method known in the art to identify transformants. For example, when the vector contains an antibiotic resistance gene, the antibiotic resistance of the bacteria can be screened. Alternatively, the DNA encoding the fusion protein can be integrated into the chromosomal DNA of the Bacillus cereus family member host. Then, the recombinant bacillus cells producing exospores can be exposed to conditions that will cause spore formation. Suitable conditions for causing spore formation are known in the art. For example, the recombinant bacillus cells producing exospores can be placed on an agar plate and cultured for several days (e.g., 3 days) at a temperature of about 30°C.

[0193] Inactive strains, non-toxic strains or genetically manipulated strains of any of the above species can also be used appropriately. For example, Bacillus thuringiensis lacking Cry toxins can be used. Alternatively, or in addition, once recombinant Bacillus cereus family spores expressing fusion proteins are produced, they can be inactivated to prevent re-germination during use. Any method known in the art for inactivating bacterial spores can be used. Suitable methods include, but are not limited to, heat treatment, gamma irradiation, x- ray irradiation, UV-A irradiation, UV-B irradiation, chemical treatment (e.g., treatment with glutaraldehyde, formaldehyde, hydrogen peroxide, acetic acid, bleach or any combination thereof), or a combination thereof. Alternatively, spores derived from non-toxic strains or genetically or physically inactivated strains can be used.

[0194] Exospore-producing recombinant Bacillus cells having plant growth promoting effects and / or other beneficial characteristics

[0195] Many Bacillus cereus family member strains have inherent beneficial characteristics. For example, certain strains have plant growth promoting effects. Any fusion protein described herein can be expressed in these strains.

[0196] For example, the recombinant Bacillus cell that produces exospores can include a plant growth promoting strain of the bacteria.

[0197] Plant growth promoting strains of bacteria may include strains of bacteria that produce insecticidal toxins (e.g., Cry toxins), produce fungicidal compounds (e.g., β-1,3-glucanase, chitosanase, lytic enzymes, or combinations thereof), produce nematicidal compounds (e.g., Cry toxins), produce bactericidal compounds that are resistant to one or more antibiotics, contain one or more freely replicating plasmids, bind to plant roots, colonize plant roots, form biofilms, solubilize nutrients, secrete organic acids, or combinations thereof.

[0198] For example, when the recombinant Bacillus cell producing exospores includes a plant growth promoting strain of bacteria, the plant growth promoting strain of bacteria may include Bacillus mycoides BT155 (NRRL No. B-50921), Bacillus mycoides EE118 (NRRL No. B-50918), Bacillus mycoides EE141 (NRRL No. B-50916), Bacillus mycoides BT46-3 (NRRL No. B-50922), Bacillus cereus family member EE128 (NRRL No. B-50917), Bacillus thuringiensis BT013A (NRRL No. B-50924), or Bacillus cereus family member EE349 (NRRL No. B-50928). Bacillus thuringiensis BT013A is also known as Bacillus thuringiensis 4Q7. Each of these strains was deposited with the United States Department of Agriculture (USDA) Agricultural Research Service (ARS), 1815 North University Street, Peoria, IL 61604, USA, on March 10, 2014, and is identified by the NRRL accession number provided in parentheses.

[0199] These plant growth promoting strains were isolated from the rhizosphere of various vigorous plants, identified by their 16S rRNA and by biochemical tests. The strains were identified at least to their genus name by conventional biochemical and morphological indicators. Biochemical tests for confirmed Gram-positive strains (e.g., Bacillus) include growth on PEA medium and nutrient agar, microscopic observation, growth on 5% and 7.5% NaCl medium, growth at pH 5 and pH 9, growth at 42°C and 50°C, the ability to produce acid when fermented with cellobiose, lactose, glycerol, glucose, sucrose, d-mannitol and starch; fluorescent pigment production; gelatin hydrolysis; nitrate reduction; catalase production; starch hydrolysis; oxidase reaction, urease production and motility.

[0200] For example, the recombinant Bacillus cell producing exospores including plant growth promoting strains of bacteria can include Bacillus mycoides BT155, Bacillus mycoides EE141, or Bacillus thuringiensis BT013A. The recombinant Bacillus cell producing exospores can express any of the above-mentioned fusion proteins, for example, a fusion protein comprising a targeting sequence of SEQ ID NO: 60 and a non-hormone peptide (e.g., kunitz trypsin inhibitor (KTI)), an enzyme involved in the production or activation of a plant growth stimulating compound (e.g., chitosanase), a plant binding protein or peptide (e.g., TasA); a protein or peptide that protects a plant from pathogens (e.g., TasA), or an enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source (e.g., a phosphatase such as PhoA or a phytase or an endoglucanase).

[0201] Promoter

[0202] In the recombinant Bacillus cells that produce exospores as described herein, the fusion protein can be expressed under the control of a promoter that is native to the targeting sequence of the fusion protein, the exospore protein, or the exospore protein fragment. For example, when the fusion protein includes a targeting sequence derived from Bacillus anthracis Sterne BclA (e.g., amino acids 20-35 of SEQ ID NO: 1, amino acids 1-35 of SEQ ID NO: 1, SEQ ID NO: 1, or SEQ ID NO: 60) or when the fusion protein includes full-length BclA (SEQ ID NO: 2) or a fragment of full-length BclA (e.g., SEQ ID NO: 59), the fusion protein can be expressed under the control of a promoter that is normally associated with the BclA gene in the Bacillus anthracis Sterne genome (e.g., the promoter of SEQ ID NO: 85).

[0203] Alternatively, the fusion protein can be expressed under the control of a high expression sporulation promoter. In some cases, the promoter native to the targeting sequence, exospore protein, or exospore protein fragment will be a high expression sporulation promoter. In other cases, the promoter native to the targeting sequence, exospore protein, or exospore protein fragment will not be a high expression sporulation promoter. In the latter case, it may be advantageous to replace the native promoter with a high expression sporulation promoter. Expression of the fusion protein under the control of a high expression sporulation promoter provides increased expression of the fusion protein on exospores of Bacillus cereus family members.

[0204] The high-expressing sporulation promoter may include one or more sigma-K sporulation-specific polymerase promoter sequences.

[0205] Suitable high-expressing sporulation promoters for expressing fusion proteins in Bacillus cereus family members include those listed in Table 2 below:

[0206] Table 2. Promoter sequences

[0207]

[0208]

[0209]

[0210]

[0211] In the promoter sequences listed above in Table 2, the position of the σ-K sporulation-specific polymerase promoter sequence is marked in bold and underlined. The Cry1A promoter (Bacillus thuringiensis HD-73; SEQ ID NO: 90) has a total of four σ-K sequences, two of which overlap with each other, as marked with double underlines in Table 2.

[0212] Preferred high-expressing spore-forming promoters for expressing fusion proteins in Bacillus cereus family members include the BetA promoter (Bacillus anthracis Sterne; SEQ ID NO:86), the BclA promoter (Bacillus anthracis Sterne; SEQ ID NO:85), the BclA cluster glycosyltransferase operon 1 and 2 promoters (Bacillus anthracis Sterne; SEQ ID NOs:101 and 102), and the YVTN β-helical protein promoter (B. weihenstephensis KBAB 4; SEQ ID NO:89).

[0213] In any of the recombinant Bacillus cells producing exospores described herein, the fusion protein can be expressed under the control of a sporulation promoter comprising a nucleic acid sequence that is at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of any one of SEQ ID NOs: 85-103.

[0214] When the sporulation promoter comprises a nucleic acid sequence that is at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 85-103, the sigma-K sporulation-specific polymerase promoter sequence preferably has 100% identity to the corresponding nucleotides of SEQ ID NOs: 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, or 103. For example, as shown in Table 2 above, the BclA promoter of Bacillus anthracis Sterne (SEQ ID NO: 85) has sigma-K sporulation-specific polymerase promoter sequences at nucleotides 24-32, 35-43, and 129-137. Thus, if the sporulation promoter comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:85, then preferably the nucleotides of the sporulation promoter corresponding to nucleotides 24-32, 35-43 and 129-137 of SEQ ID NO:85 are 100% identical to nucleotides 24-32, 35-43 and 129-137 of SEQ ID NO:85.

[0215] In any of the methods of stimulating plant growth described herein, plants grown in a plant growth medium comprising recombinant Bacillus cells that produce exospores and at least one pesticide selected from the specific pesticides disclosed herein exhibit increased growth compared to the growth of plants grown in the same plant growth medium without the recombinant Bacillus cells that produce exospores.

[0216] In any of the compositions and methods for stimulating plant growth described herein, the recombinant Bacillus cells that produce exospores can include any of the recombinant plant growth promoting strains of bacteria described above.

[0217] In any of the compositions or methods for stimulating plant growth disclosed herein, the fusion protein can be expressed under the control of any of the promoters described above.

[0218] Insecticides

[0219] "Insecticide" and the term "insecticide" refer to the ability of a substance to increase the mortality rate of insects or inhibit their growth rate. In this specification, the term "insect" includes all organisms of the class Insecta. The term "pre-adult" insect refers to any form of an organism before the adult stage, including, for example, eggs, larvae, and nymphs. As used herein, the terms "insecticide" and "insecticide" also encompass "nematicides" and "nematicides" as well as "acaricides" and "acaricides".

[0220] "Nematicide" and "nematicidal" refer to the ability of a substance to increase mortality or inhibit the growth rate of nematodes. In general, the term "nematode" includes eggs, larvae, juveniles, and adult forms of the organism.

[0221] "Acaricide" or "acaricidal" refers to the ability of a substance to increase mortality or inhibit the growth rate of ectoparasites belonging to the subclass Acari of the class Arachnida.

[0222] The active ingredients specified herein by their “common name” are known and described, for example, in the Pesticide Manual (“The Pesticide Manual”, 16th edition, British Crop Protection Council 2012) or can be found on the Internet (eg http: / / www.alanwood.net / pesticides).

[0223] In some embodiments, the insecticide is selected from acetamiprid, aldicarb, amitraz, β-cyfluthrin, carbaryl, clothianidin, cyfluthrin, cypermethrin, deltamethrin, endosulfan, ethion, ethiprole, fenamiphos, fenbutyl, fenthion, fipronil, flubendiamide, flupyrazone, fluopyram, flumethrin, heptylphos, imidacloprid, methamidophos, methiocarb, methomyl, chloranil, sulfone, phosalone, chloranil, sulfone, chloranil ... -{2-fluoro-4-methyl-5-[(R)-(2,2,2-trifluoroethyl)sulfinyl]phenyl}-3-(trifluoromethyl)-1H-1,2,4-triazol-5-amine, 1-(3-chloropyridin-2-yl)-N-[4-cyano-2-methyl-6-(methylcarbamoyl)phenyl]-3-{[5-(trifluoromethyl)-2H-tetrazol-2-yl]methyl}-1H-pyrazole-5-carboxamide and a pesticide terpene mixture containing three terpenes of α-terpinene, p-cymene and limonene, and optionally a minimum terpene component, including: A simulated natural pesticide sold containing a mixture of three terpenes, namely α-terpinene, p-cymene and limonene.

[0224] According to a preferred embodiment of the present invention, the insecticide is selected from clothianidin, cypermethrin, ethiprole, fipronil, fluopyram, flupyrazone, imidacloprid, methiocarb and thiodicarb.

[0225] Compositions of the present invention

[0226] According to the present invention, the composition comprises a) a recombinant Bacillus cell producing exospores expressing a fusion protein comprising (i) at least one plant growth stimulating protein or peptide selected from the group consisting of enzymes involved in the production or activation of plant growth stimulating compounds, enzymes that degrade or modify bacterial, fungal or plant nutrient sources, and proteins or peptides that protect plants from pathogens; and (ii) a targeting sequence that localizes the fusion protein to the exospore of the Bacillus cell; and b) at least one specific pesticide disclosed herein.

[0227] According to the present invention, a "synergistically effective amount" represents a combination of a certain amount of recombinant Bacillus cells expressing a fusion protein and producing exospores and at least one insecticide described herein, which is more effective than a single recombinant Bacillus cell expressing a fusion protein or a single insecticide in resisting insects, mites, nematodes and / or plant pathogens. According to the present invention, a "synergistically effective amount" also represents a certain amount of recombinant Bacillus cells expressing a fusion protein and producing exospores and at least one specific insecticide disclosed herein, which is more effective than a single recombinant Bacillus cell expressing a fusion protein or a single insecticide in enhancing plant growth and / or promoting plant health.

[0228] The present invention includes each and every combination of each specific pesticide disclosed herein and a recombinant exospore-producing Bacillus cell.

[0229] In a highly preferred embodiment, the present invention relates to a composition comprising a synergistically effective amount of a) a recombinant Bacillus cell producing exospores expressing a fusion protein comprising (i) at least one plant growth stimulating protein or peptide selected from the group consisting of: enzymes involved in the production or activation of plant growth stimulating compounds, enzymes that degrade or modify bacterial, fungal or plant nutrient sources, and proteins or peptides that protect plants from pathogens or pests; and (ii) a targeting sequence that localizes the fusion protein to the exospores of the Bacillus cell; and b) at least one specific insecticide disclosed herein, and the at least one insecticide is selected from the group consisting of acetamiprid, aldicarb, amitraz, beta-cyfluthrin, carbaryl, clothianidin, cyfluthrin, cypermethrin, deltamethrin, endosulfan, ethion, ethiprole, , chloranil, fenamiphos, fenbutyl, fenthion, fipronil, flubendiamide, flupyrazone, fluopyram, flufenicol, heptenophos, imidacloprid, methamidophos, methiocarb, methomyl, niclosamide, sulfone, phosalone, insecticide silane, spirodicarb, spiromesicarb, spirotetramat, thiacloprid, thiodicarb, tralomethrin, triazophos, chloranil, aphidoxim, 1-{2-fluoro-4-methyl- 5-[(R)-(2,2,2-trifluoroethyl)sulfinyl]phenyl}-3-(trifluoromethyl)-1H-1,2,4-triazol-5-amine and 1-(3-chloropyridin-2-yl)-N-[4-cyano-2-methyl-6-(methylcarbamoyl)phenyl]-3-{[5-(trifluoromethyl)-2H-tetrazol-2-yl]methyl}-1H-pyrazole-5-carboxamide.

[0230] In a preferred embodiment, the composition of the present invention further comprises at least one fungicide.

[0231] In general, "fungicide" refers to the ability of a substance to increase the mortality of fungi or inhibit their growth rate. The term "fungus" includes a wide range of spore-bearing, nucleated organisms that lack chlorophyll. Examples of fungi include yeast, mold, mildew, rust, and mushrooms.

[0232] Other additives

[0233] One aspect of the present invention provides the above-mentioned composition, which further comprises at least one auxiliary agent selected from fillers, solvents, spontaneity promoters, carriers, emulsifiers, dispersants, anti-frost agents, thickeners and adjuvants. These compositions are called preparations.

[0234] Therefore, in one aspect of the invention, the formulation and the application forms prepared therefrom are provided as crop protection agents and / or pesticides comprising the composition of the invention, such as immersions, drops and sprays. The application forms may include other crop protection agents and / or pesticides, and / or adjuvants that enhance activity, such as penetrants, examples of which are vegetable oils (such as rapeseed oil, sunflower seed oil), mineral oils (such as liquid paraffin), plant fatty acid alkyl esters (such as rapeseed oil methyl ester or soybean oil methyl ester) or alkanol alkoxylates, and / or spreaders such as alkylsiloxanes and / or salts, examples of which are organic or inorganic ammonium salts or phosphonium salts (examples are ammonium sulfate or diammonium hydrogen phosphate), and / or retention promoters, such as dioctyl sulfosuccinate or hydroxypropyl guar polymers, and / or humectants such as glycerol, and / or fertilizers, such as ammonium fertilizers, potash fertilizers or phosphate fertilizers.

[0235] Examples of typical formulations include water-soluble liquids (SL), emulsifiable concentrates (EC), aqueous emulsions (EW), suspension concentrates (SC, SE, FS, OD), water-dispersible granules (WG), granules (GR) and capsule concentrates (CS); these and other possible types of formulations are described by Crop Life International and in Pesticide Specifications, Manual on development and use of FAO and WHO specifications for pesticides, FAO Plant Production and Protection Papers-173 (prepared by the FAO / WHO Joint Meeting on Pesticide Manual, 2004, ISBN: 9251048576). In addition to one or more active compounds of the present invention, the formulations may also include agrochemical active compounds.

[0236] The formulation or application form in question preferably comprises auxiliary agents, such as fillers, solvents, spontaneity promoters, carriers, emulsifiers, dispersants, antifrost agents, biocides, thickeners and / or other auxiliary agents, such as adjuvants. In this article, an adjuvant is a component that enhances the biological effect of the formulation, which component itself has no biological effect. Examples of adjuvants are agents that promote retention, diffusion, attachment to the leaf surface or penetration.

[0237] These preparations are prepared in a known manner, for example by mixing the active compound with adjuvants, for example extenders, solvents and / or solid carriers and / or other adjuvants such as surfactants. The preparations are either prepared in suitable equipment or are prepared before or during application.

[0238] Suitable for use as adjuvants are substances which are suitable for imparting particular properties (for example certain physical, technical and / or biological properties) to the formulations of the active compounds or to the application forms prepared from these formulations (for example useful crop protection agents, such as spray liquors or seed dressings).

[0239] Suitable extenders are, for example, water, polar and nonpolar organic chemical liquids, such as aromatic and nonaromatic hydrocarbons (for example paraffins, alkylbenzenes, alkylnaphthalenes, chlorobenzenes), alcohols and polyols (which, if appropriate, may also be substituted, etherified and / or esterified), ketones (for example acetone, cyclohexanone), esters (including fats and oils) and (poly)ethers, unsubstituted or substituted amines, amides, lactams (for example N-alkylpyrrolidones) and lactones, sulfones and sulfoxides (for example dimethyl sulfoxide).

[0240] If the extender used is water, it is also possible to use, for example, organic solvents as auxiliary solvents. In principle, suitable liquid solvents are: aromatic compounds such as xylene, toluene or alkylnaphthalenes; chlorinated aromatic and aliphatic hydrocarbons such as chlorobenzene, vinyl chloride or methylene chloride; aliphatic hydrocarbons such as cyclohexane or paraffin; for example petroleum fractions; mineral oils and vegetable oils; alcohols such as butanol or ethylene glycol and their ethers and esters; ketones such as acetone, methyl ethyl ketone, methyl isobutyl ketone or cyclohexanone; strongly polar solvents such as dimethylformamide and dimethyl sulfoxide, and water.

[0241] In principle, all suitable solvents can be used. Suitable solvents are, for example, aromatic hydrocarbons such as xylene, toluene or alkylnaphthalenes; chlorinated aromatic or aliphatic hydrocarbons such as chlorobenzene, vinyl chloride or methylene chloride; aliphatic hydrocarbons such as cyclohexane; paraffins; petroleum fractions; mineral and vegetable oils; alcohols such as methanol, ethanol, isopropanol, butanol or ethylene glycol, and their ethers and esters; ketones such as acetone, methyl ethyl ketone, methyl isobutyl ketone or cyclohexanone; strongly polar solvents such as dimethyl sulfoxide and water.

[0242] In principle, all suitable carriers can be used. Suitable carriers are, for example, ammonium salts and ground natural minerals, such as kaolin, clay, talc, chalk, quartz, attapulgite, montmorillonite or diatomaceous earth, and ground synthetic minerals, such as finely dispersed silicon dioxide, aluminum oxide and natural or synthetic silicates, resins, waxes and / or solid fertilizers. Mixtures of these carriers can also be used. Suitable carriers for particles include the following: for example, ground and classified natural minerals, such as calcite, marble, pumice, sepiolite, dolomite, and synthetic particles of inorganic and organic powders, as well as particles of organic materials such as sawdust, paper, coconut shells, corn cobs and tobacco straw.

[0243] Liquefied gaseous extenders or solvents may also be used. Particularly suitable extenders or carriers are gaseous at standard temperature and standard pressure, examples of which are aerosol propellants, such as halogenated hydrocarbons, and butane, propane, nitrogen and carbon dioxide.

[0244] Examples of emulsifiers and / or foam formers, dispersants or wetting agents with ionic or nonionic properties, or mixtures of these surface-active substances are: polyacrylates, ligninsulfonates, benzenesulfonates or naphthalenesulfonates, polycondensates of ethylene oxide with fatty alcohols or with fatty acids or with fatty amines, with substituted phenols (preferably alkylphenols or arylphenols), salts of sulfosuccinates, taurine derivatives (preferably alkyltaurates), phosphoric esters of polyethoxylated alcohols or phenols, fatty acid esters of polyols, and derivatives of compounds containing sulfates, sulfonates and phosphates, examples of which are alkylaryl polyglycol ethers, alkylsulfonates, alkyl sulfates, arylsulfonates, protein hydrolysates, ligninsulfite waste liquors and methylcellulose. The presence of a surface-active substance is advantageous if one of the active compounds and / or one of the inert carriers is insoluble in water and application takes place in water.

[0245] Other auxiliaries that may be present in the formulations and application forms derived therefrom include colorants, such as inorganic pigments, examples of which are iron oxide, titanium oxide, Prussian blue, and organic dyes, such as alizarin dyes, azo dyes and metal phthalocyanine dyes, and nutrients and trace nutrients, such as iron salts, manganese salts, boron salts, copper salts, cobalt salts, molybdenum salts and zinc salts.

[0246] Stabilizers, such as low-temperature stabilizers, preservatives, antioxidants, light stabilizers or other agents that improve chemical and / or physical stability may also be present. In addition, foam formers or defoamers may be present.

[0247] In addition, the preparation and the application form derived therefrom may also include, as additional adjuvants, adhesives such as carboxymethylcellulose, powdered, granular or latex-like natural and synthetic polymers such as gum arabic, polyvinyl alcohol, polyvinyl acetate, and natural phospholipids such as cephalin and lecithin, and synthetic phospholipids. Other possible adjuvants include mineral oils and vegetable oils.

[0248] Other adjuvants may be present in the formulations and the application forms derived therefrom. Examples of such additives include fragrances, protective colloids, binders, adhesives, thickeners, thixotropic substances, penetrants, retention promoters, stabilizers, sequestrants, complexing agents, humectants and spreading agents. In general, the active compound may be combined with any solid or liquid additive commonly used for formulation purposes.

[0249] Suitable retention promoters include all those substances which reduce the dynamic surface tension, such as dioctyl sulfosuccinate, or those substances which increase the viscoelasticity, such as hydroxypropyl guar polymers.

[0250] Suitable penetrants herein include all those substances which are usually used to enhance the penetration of active agrochemical compounds into plants. In the present context, a penetrant is defined as one which is able to penetrate the plant epidermis from the (usually aqueous) application liquid and / or from the spray coating, thereby increasing the migration of the active compound in the epidermis. This property can be determined using the method described in the literature (Baur et al., 1997, Pesticide Science 51, 131-152). Examples include alcohol alkoxylates, such as coconut fat ethoxylate (10) or isotridecyl ethoxylate (12); fatty acid esters, such as rapeseed oil methyl ester or soybean oil methyl ester; fatty amine alkoxylates, such as tallow fatty amine ethoxylate (15); or ammonium and / or phosphonium salts, such as ammonium sulfate or diammonium hydrogen phosphate.

[0251] Based on the weight of the formulation, the formulation preferably comprises 0.0001 to 98% by weight of the active compound, or particularly preferably, 0.01 to 95% by weight of the active compound, more preferably, 0.5 to 90% by weight of the active compound. The content of the active compound is defined as the sum of the recombinant bacillus cells producing exospores and at least one specific pesticide disclosed herein.

[0252] The content of active compound in the application forms (crop protection products) prepared from the formulations can vary within a wide range. The active compound concentration of the application forms can generally be from 0.0001 to 95% by weight of active compound, preferably from 0.0001 to 1% by weight, based on the weight of the application form. Application is carried out in a customary manner suitable for the application form.

[0253] Furthermore, in one aspect of the present invention, a kit of parts is provided, comprising synergistically effective amounts of spatially separated exospore-producing recombinant Bacillus cells and at least one specific pesticide disclosed herein.

[0254] In another embodiment of the present invention, the kit further comprises at least one other fungicide and / or at least one specific insecticide disclosed herein. The fungicide and / or insecticide may be present in the recombinant Bacillus cell component producing exospores of the kit, or in the insecticide component of the kit separated spatially, or in both of these components. Preferably, the fungicide and / or insecticide is present in the recombinant Bacillus cell component producing exospores.

[0255] In addition, the kit of parts of the present invention may further comprise at least one auxiliary agent selected from the group consisting of fillers, solvents, spontaneous promoters, carriers, emulsifiers, dispersants, anti-frost agents, thickeners and adjuvants described below. The at least one auxiliary agent may be present in the recombinant bacillus cell component producing exospores of the kit of parts, or in the insecticide component of the kit of parts separated spatially, or in both of these components.

[0256] In another aspect of the invention, the above composition is used to reduce overall damage to plants and plant parts and losses in harvested fruits or vegetables caused by insects, mites, nematodes and / or phytopathogens.

[0257] Furthermore, in another aspect of the present invention, the composition increases overall plant health.

[0258] The term "plant health" generally includes a variety of plant improvements that are not related to pest control. For example, favorable properties that may be mentioned are improved crop characteristics, including: emergence, crop yield, protein content, oil content, starch content, more developed root system, improved root growth, improved root size maintenance, improved root efficiency, improved stress tolerance (e.g., tolerance to drought, heat, salt, UV, water, cold), reduced ethylene (reduced production and / or inhibited uptake), increased tillering, increased plant height, larger leaves, reduced dead leaves at the base, stronger tillers, greener leaf color, pigment content, photosynthetic activity, reduced input required (e.g., fertilizer or water), reduced seeds required, more productive tillers, earlier flowering, earlier grain maturity, reduced plant lodging, faster seedling growth, increased plant vigor, increased plant stand, earlier and better germination.

[0259] For purposes of the present invention, improved plant health preferably refers to improved plant characteristics including: crop yield, a more developed root system (improved root growth), improved root size maintenance, improved root efficiency, increased tillering, increased plant height, larger leaves, reduced basal dead leaves, stronger tillers, greener leaf color, photosynthetic activity, more productive tillers, increased plant vigor and increased plant resilience.

[0260] For the present invention, improved plant health preferably refers in particular to improved plant characteristics selected from the group consisting of: crop yield, a more developed root system, improved root growth, improved root size maintenance, improved root efficiency, increased tillering and increased plant height.

[0261] As defined herein, the effect of the composition of the present invention on plant health can be determined by comparing plants grown under the same environmental conditions, wherein one part of the plant is treated with the composition of the present invention and another part of the plant is not treated with the composition of the present invention. In contrast, the other part is not treated at all, or is treated with a placebo (i.e., without the application of the composition of the present invention, for example, without the application of all active ingredients (i.e., without the application of the recombinant Bacillus family member-based exospore-producing biological control agent described herein and without the application of the pesticide described herein), or without the application of the recombinant Bacillus family member-based exospore-producing biological control agent described herein, or without the application of the pesticide described herein.

[0262] The composition of the present invention can be applied in any desired manner, for example in the form of seed coating, soil drench, and / or direct application in furrows and / or foliar spray, and can be used before emergence, after emergence or at the same time. In other words, the composition can be applied to seeds, plants or harvested fruits and vegetables, or applied to the soil where the plant grows or is expected to grow (plant growing area).

[0263] Reducing overall damage to plants and plant parts generally results in healthier plants and / or increased plant vigor and yield.

[0264] Preferably, the composition according to the invention is used for treating conventional plants or transgenic plants or their seeds.

[0265] The present invention also relates to methods for stimulating plant growth using any of the above compositions, the compositions comprising recombinant Bacillus cells that produce exospores expressing a fusion protein and at least one specific pesticide disclosed herein. The method for stimulating plant growth comprises applying a composition to a plant, a plant part, a location around a plant, or a location where the plant will be planted (e.g., soil or other growth substrate), the composition comprising a synergistically effective amount of recombinant Bacillus cells that produce exospores expressing a fusion protein comprising (i) at least one plant growth stimulating protein or peptide, and (ii) a targeting sequence, an exospore protein, or an exospore protein fragment, and at least one other specific pesticide disclosed herein.

[0266] In another aspect of the present invention, a method for reducing overall damage to plants or plant parts and reducing losses in harvested fruits or vegetables caused by insects, mites, nematodes and / or plant pathogens is provided, the method comprising the steps of: simultaneously or sequentially applying a synergistically effective amount of recombinant Bacillus cells producing exospores and at least one specific pesticide disclosed herein.

[0267] In another embodiment of the present invention, the composition comprises at least one fungicide and / or at least one insecticide in addition to the exospore-producing recombinant Bacillus cells and the specific insecticides disclosed herein. In one embodiment, the at least one fungicide is a synthetic fungicide.

[0268] The methods of the present invention include the following application methods, that is, the recombinant Bacillus cells that produce exospores and at least one specific pesticide disclosed herein can be prepared as a single, stable composition with an agriculturally acceptable shelf life (referred to as a "single formulation"), or combined together before or at the time of use (referred to as a "combination formulation").

[0269] If not mentioned otherwise, the expression "combination" represents various combinations of recombinant Bacillus cells producing exospores and at least one insecticide, and optionally at least one fungicide, in a single formulation, a single "mix and go" form, a combined spray mixture consisting of a single formulation (e.g., a "tank mix"), in particular when the individual active ingredients are used in combination when applied in a sequential manner, i.e., one ingredient is applied after another ingredient within a reasonably short period of time (e.g., a few hours or days, such as 2 hours to 7 days). The order of applying the compositions of the present invention is not essential for carrying out the present invention. Therefore, the term "combination" also includes recombinant Bacillus cells producing exospores and at least one specific insecticide disclosed herein, and optionally at least one fungicide present on or in the plant to be treated or its environment, habitat or storage space, for example, after the recombinant Bacillus cells producing exospores and at least one specific insecticide disclosed herein, and optionally at least one fungicide are applied to the plant or its environment, habitat or storage space simultaneously or sequentially.

[0270] If the exospore-producing recombinant Bacillus cells and at least one specific insecticide disclosed herein, and optionally at least one fungicide, are applied or used sequentially, the plants or plant parts (including seeds and plants germinated from seeds), harvested fruits and vegetables are preferably treated according to the following method: first , applying at least one specific pesticide disclosed herein and optionally at least one fungicide and / or at least one other pesticide to a plant or plant part; Secondly , the recombinant Bacillus cells producing exospores are applied to the same plant or plant part. By this mode of application, the amount of pesticide / fungicide residues on the plant at harvest is as low as possible. The time interval between the first application and the second application can be different within a (crop) growth cycle and depends on the effect to be achieved. For example, the first application is to prevent the plant or plant part from being attacked by insects, mites, nematodes and / or plant pathogens (this is particularly the case for treating seeds), or to deal with insect, nematode and / or plant pathogen infection (this is particularly the case for treating plants and plant parts); while the second application is to prevent or control insect, mite, nematode and / or plant pathogen infection and / or promote plant growth. In this context, "control" means that the recombinant Bacillus cells producing exospores cannot completely eradicate pests or plant pathogens, but can keep the infection at an acceptable level.

[0271] The present invention also provides the method for killing, suppressing, preventing and / or resisting activity of improving the present composition by multiple application.In some other embodiments, at any desired growth stage or under any predetermined pest pressure, at intervals of about 1 hour, about 5 hours, about 10 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, about 1 week, about 10 days, about 2 weeks, about 3 weeks, about 1 month or longer, the composition of the present invention is applied to plants and / or plant parts twice.In some embodiments, at any desired growth stage or under any predetermined pest pressure, at intervals of about 1 hour, about 5 hours, about 10 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, about 1 week, about 10 days, about 2 weeks, about 3 weeks, about 1 month or longer, the composition of the present invention is applied to plants and / or plant parts more than twice, for example, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, or more times. If desired, the interval between each application can be varied. Depending on the plant species, plant pest species and other factors, one skilled in the art will be able to determine the number of applications and the length of the intervals.

[0272] By following the foregoing steps, very low levels of residues of the at least one fungicide and / or at least one specific insecticide disclosed herein and / or other insecticides can be achieved on treated plants, plant parts, and harvested fruits and vegetables.

[0273] If not mentioned otherwise, the treatment of plants or plant parts (including seeds and plants germinated from seeds), harvested fruits and vegetables with the composition of the present invention is carried out directly or by acting on their environment, habitat or storage space, using conventional treatment methods, such as soaking, spraying, atomizing, irrigation, evaporation, dusting, fogging, sowing, foaming, coating, painting, watering (irrigation), drip irrigation. The recombinant bacillus cells producing exospores, at least one specific insecticide disclosed herein and optionally at least one fungicide can also be applied as a single formulation or a combined formulation by the ultra-low volume method, or the composition of the present invention can be injected into the soil as a composition or a single formulation (in-furrow).

[0274] The term "plant to be treated" includes every part of the plant, including its root system and a radius of at least 10 cm, 20 cm, 30 cm around the main stem or trunk of the plant to be treated, or a radius of at least 10 cm, 20 cm, 30 cm around the root system of the plant to be treated (e.g. soil and nutrient medium).

[0275] The amount of recombinant Bacillus cells producing exospores used or applied in combination with at least one specific insecticide disclosed herein, optionally in the presence of at least one fungicide, depends on the final formulation and the size or type of the plant, plant part, seed, harvested fruit and vegetable to be treated. Typically, the recombinant Bacillus cells producing exospores applied or used according to the present invention are present in a single formulation or a combined formulation with the at least one specific insecticide disclosed herein and optionally a fungicide, at about 1% to about 80% (w / w), preferably about 1% to about 60% (w / w), more preferably about 10% to about 50% (w / w).

[0276] Likewise, the amount of at least one specific insecticide disclosed herein used in combination with the recombinant Bacillus cells producing exospores, optionally in the presence of at least one fungicide, depends on the final formulation and the size or species of the plant, plant part, seed, harvested fruit and vegetable to be treated. Typically, the recombinant Bacillus cells producing exospores applied or used according to the present invention are present in a single formulation or in a combined formulation with the at least one specific insecticide disclosed herein and optionally a fungicide, at about 1% to about 80% (w / w), preferably about 1% to about 60% (w / w), more preferably about 10% to about 50% (w / w).

[0277] The application of the recombinant Bacillus cells producing exospores can be carried out as a foliar spray, soil treatment and / or seed treatment / coating. In one embodiment, when used as a foliar treatment, about 1 / 16 to about 5 gallons of whole broth are applied per acre. In one embodiment, when used as a soil treatment, about 1 to about 5 gallons of whole broth are applied per acre. When used for seed treatment, about 1 / 32 to about 1 / 4 gallon of whole broth are applied per acre. For seed treatment, the final formulation contains 1x 10 4 , at least 1x 10 5 , at least 1x 10 6 , 1x 10 7 , at least 1x 10 8 , at least 1x 10 9 or at least 1x 10 10 colony forming units / g.

[0278] The recombinant Bacillus cells producing exospores and at least one specific insecticide disclosed herein and, if present (preferably), also a fungicide are used in a synergistic weight ratio. The skilled person is able to find the synergistic weight ratio of the present invention by conventional methods. The skilled person understands that these ratios refer to the ratio of the recombinant Bacillus cells producing exospores described herein and at least one specific insecticide disclosed herein in a combined formulation and the calculated ratio when the two components are applied to the plant to be treated in a single formulation. Because the volume and amount of the recombinant Bacillus cells producing exospores and at least one specific insecticide disclosed herein in a single formulation are known to the skilled person, the skilled person can calculate the ratio by simple mathematical calculations.

[0279] The ratio can be calculated based on the amount of the at least one specific pesticide disclosed herein at the time point when the components of the combination of the present invention are applied to the plant or plant part, and the amount of recombinant Bacillus cells producing exospores at or shortly before (e.g., 48 h, 24 h, 12 h, 6 h, 2 h, 1 h before) the time point when the components of the combination of the present invention are applied to the plant or plant part.

[0280] The application of the recombinant Bacillus cells producing exospores and at least one specific pesticide disclosed herein to plants or plant parts can be performed simultaneously or at different times, as long as both components are on or in the plant after application. In the case where the recombinant Bacillus cells producing exospores and the pesticide are applied at different times, and the pesticide is applied significantly before the recombinant Bacillus cells producing exospores, the concentration of the pesticide applied to the plant / in the plant can be determined by chemical analysis known in the art at or shortly before the time point of applying the recombinant Bacillus cells producing exospores. Vice versa, when the recombinant Bacillus cells producing exospores are first applied to the plant, the concentration of the recombinant Bacillus cells producing exospores can be determined by tests known in the art at or shortly before the time point of applying the pesticide.

[0281] Specifically, in one embodiment, the synergistic weight ratio of the recombinant Bacillus cells producing exospores and at least one specific insecticide disclosed herein is in the range of 1:1000 to 1000:1, preferably in the range of 1:500 to 500:1, more preferably in the range of 1:300 to 500:1. Particularly preferred ratios are 20:1 to 1:20, such as 10:1, 5:1 or 2:1. It should be noted that these ratio ranges refer to the biological control agent based on the recombinant Bacillus cereus family member (to be combined with at least one specific insecticide disclosed herein or a formulation of at least one specific insecticide disclosed herein). For example, a ratio of 100:1 refers to 100 parts by weight of a spore preparation based on a recombinant Bacillus biological control agent producing exospores combined with 1 part by weight of an insecticide (either as a single preparation, a combined preparation, or applied separately to a plant to form a combination on the plant). In one aspect of this embodiment, the spore preparation of the recombinant Bacillus cells producing exospores is a spore preparation containing at least about 1x10 4 cfu / g, at least about 1x 10 5 cfu / g, at least about 1x 10 6 cfu / g, at least about 1x 10 7 cfu / g, at least about 1x10 8 cfu / g, at least about 1x 10 9 cfu / g, at least about 1x 10 10 cfu / g, or at least about 1x 10 11 cfu / g of dried spore preparation.

[0282] In another embodiment, the synergistic weight ratio of the exospore-producing recombinant Bacillus cells and at least one specific pesticide disclosed herein is in the range of 1:100 to 20,000:1, preferably in the range of 1:50 to 10,000:1 or even in the range of 1:50 to 1000:1.

[0283] In one embodiment of the invention, the concentration of the recombinant Bacillus cells producing exospores after dispersion is at least 50 g / ha, such as 50-7500 g / ha, 50-2500 g / ha, 50-1500 g / ha; at least 250 g / ha (hectare), at least 500 g / ha or at least 800 g / ha.

[0284] The application rate of the composition to be used or applied according to the invention may vary. The skilled person will be able to find suitable application rates by routine experiments.

[0285] In another aspect of the present invention, there is provided a seed treated with the composition described above.

[0286] It is known for a long time to prevent and treat insects, mites, nematodes and / or plant pathogens by treating the seeds of plants, and it is a theme of continuous improvement.But seed treatment still relates to a series of problems that can not always be solved in a satisfactory manner.Therefore, it is desirable to develop a method for protecting seeds and germinating plants, which method is exempted from or at least significantly reduces the need for additional delivery of crop protection compositions during storage, after sowing or after plant emergence.In addition, it is desirable to optimize the amount of the active component used in this way, thereby providing the best possible protection for seeds and germinating plants, making them free from the invasion and attack of insects, mites, nematodes and / or plant pathogens, and the active component used can not cause damage to the plant itself.Specifically, the method for treating seeds should also consider the inherent insecticide and / or nematicide characteristics of insect-resistant or insect-resistant transgenic plants, so as to realize the optimal protection of seeds and germinating plants using minimum crop protection compositions.

[0287] Therefore, the present invention also specifically relates to a method for protecting seeds and germinating plants from pests by treating the seeds with a synergistically effective amount of the recombinant Bacillus cells producing exospores as defined above and at least one specific insecticide disclosed herein. The method of the present invention for protecting seeds and germinating plants from pests comprises a method for treating the seeds simultaneously with the recombinant Bacillus cells producing exospores and at least one specific insecticide disclosed herein, and optionally at least one fungicide in one operation. The method of the present invention also comprises a method for treating the seeds with the recombinant Bacillus cells producing exospores and at least one specific insecticide disclosed herein, and optionally at least one fungicide at different times.

[0288] The invention furthermore relates to the use of a composition according to the invention for treating seed in order to protect the seed and the resulting plant from attack by insects, mites, nematodes and / or phytopathogens.

[0289] The present invention also relates to seeds treated with recombinant Bacillus cells producing exospores and at least one specific insecticide disclosed herein, and optionally at least one fungicide simultaneously. The present invention also relates to seeds treated with recombinant Bacillus cells producing exospores and at least one specific insecticide disclosed herein, and optionally at least one fungicide and / or at least one insecticide at different times. In the case of seeds treated with recombinant Bacillus cells producing exospores and the at least one specific insecticide disclosed herein, and optionally at least one fungicide at different times, each active ingredient in the composition of the present invention may be present in different layers on the seeds.

[0290] Furthermore, the present invention relates to seeds which, after being treated with the composition of the present invention, are subjected to a film coating treatment, thereby protecting said seeds from dust abrasion.

[0291] One of the advantages of the present invention is that, due to the special systemic properties of the compositions of the present invention, the treatment of the seed with these compositions provides protection not only for the seed itself but also for the plant growing from the seed after germination against insects, mites, nematodes and / or phytopathogens. In this way, it is not necessary to treat the crop directly at the time of sowing or shortly thereafter.

[0292] Another advantage can be seen in the fact that the treatment of seeds with the composition according to the invention promotes germination and emergence of the treated seeds.

[0293] It is also believed to be advantageous that the compositions according to the invention can also be used, in particular on transgenic seeds.

[0294] It is also stated that the composition of the invention can be used in combination with agents of signaling technology, as a result of which, for example, colonization with symbiotic organisms is improved, such as enhancement of rhizobia, mycorrhizae and / or endophytic bacteria, and / or optimization of nitrogen fixation.

[0295] The composition of the present invention is suitable for protecting the seeds of any plant variety used in agriculture, greenhouses, forestry or gardening. More specifically, the seeds in question are seeds of cereals (e.g., wheat, barley, rye, oats and millet), corn, cotton, soybeans, rice, potatoes, sunflowers, coffee beans, tobacco, canola, rapeseed, beets (e.g., sugar beets and fodder beets), peanuts, vegetables (e.g., tomatoes, cucumbers, beans, brassicas, onions and lettuce), fruit plants, lawns and ornamental plants. Of particular importance is the treatment of seeds of cereals (e.g., wheat, barley, rye and oats), corn, soybeans, cotton, canola, rapeseed and rice.

[0296] As mentioned above, it is particularly important to treat transgenic seeds with the composition of the invention. The seeds in question are seeds of plants that usually contain at least one heterologous gene that controls the expression of a polypeptide, especially a polypeptide with insecticidal and / or nematicidal properties. The heterologous gene in the transgenic seeds may come from microorganisms such as Bacillus, Rhizobium, Pseudomonas, Serratia, Trichoderma, Clavibacter, Glomus or Gliocladium. The present invention is particularly suitable for treating transgenic seeds containing at least one heterologous gene from Bacillus. Particularly preferably, the heterologous gene in question comes from Bacillus thuringiensis.

[0297] For the purposes of the present invention, the composition of the invention is applied to the seed alone or in a suitable formulation. The seed is preferably treated under conditions in which the stability of the seed is not impaired during the treatment. Usually, the seed can be treated at any time between harvesting and sowing. The seeds usually used are those separated from the plant and the spadix, shell, stem, pod, hair or pulp have been removed. Thus, for example, seeds that have been harvested, purified and dried to a water content of less than 15% by weight can be used. Alternatively, for example, seeds that have been treated with water after drying and then dried again can also be used.

[0298] In general, when treating seeds, it must be ensured that the amount of the composition according to the invention and / or other additives applied to the seeds is chosen so that germination of the seeds is not adversely affected and / or the plants emerging from the seeds are not damaged. This is particularly the case for active ingredients that can exhibit phytotoxic effects at certain application rates.

[0299] The composition of the present invention can be applied directly, i.e., without other components and without dilution. Usually, the composition is preferably applied to seeds in a suitable formulation. Suitable formulations and methods for seed treatment are known to those skilled in the art and are described in, for example, the following documents: U.S. Patents 4,272,417A, 4,245,432A, 4,808,430A, 5,876,739A, U.S. Patent Publication No. 2003 / 0176428A1, WO 2002 / 080675 A1, WO 2002 / 028186A2.

[0300] The compositions which can be used according to the invention can be converted into conventional seed dressing formulations, such as solutions, emulsions, suspensions, powders, foams, slurries or other seed coating compositions, and ULV formulations.

[0301] These preparations are prepared in a known manner by mixing the compositions with conventional adjuvants, such as, for example, conventional fillers and solvents or diluents, colorants, wetting agents, dispersants, emulsifiers, defoamers, preservatives, secondary thickeners, adhesives, gibberellins and water.

[0302] Colorants that may be present in the seed dressing formulations that can be used according to the invention include all colorants conventionally used for such purposes. In this context, not only pigments (which have low solubility in water) but also water-soluble dyes can be used. Examples include the dyes known by the names Rhodamine B, CI Pigment Red 112 and CI Solvent Red 1.

[0303] Wetting agents which may be present in the seed dressing formulations which can be used according to the invention include all substances which promote wetting and are conventionally used for the formulation of agrochemical active ingredients. Alkylnaphthalenesulfonates, such as diisopropylnaphthalenesulfonate or diisobutylnaphthalenesulfonate, can preferably be used.

[0304] Dispersants and / or emulsifiers that may be present in the seed dressing formulations that can be used according to the invention include all nonionic, anionic and cationic dispersants conventionally used in the formulation of agrochemical active ingredients. It is preferred to use nonionic or anionic dispersants, or mixtures of nonionic or anionic dispersants. Suitable nonionic dispersants are in particular ethylene oxide-propylene oxide block copolymers, alkylphenol polyglycol ethers and tristyrylphenol polyglycol ethers and their phosphated or sulfated derivatives. Suitable anionic dispersants are in particular lignin sulfonates, polyacrylates, and arylsulfonate-formaldehyde condensates.

[0305] Defoamers that may be present in the seed dressing formulations which can be used according to the invention include all foam inhibitors conventionally used for the formulation of agrochemical active ingredients. Silicone defoamers and magnesium stearate can preferably be used.

[0306] Preservatives that may be present in the seed dressing formulations which can be used according to the invention include all substances which can be used for such purposes in agrochemical compositions. Examples include dichlorobenzene and benzyl alcohol hemiformal.

[0307] Secondary thickeners which may be present in the seed dressing formulations which can be used according to the invention include all substances which can be used for such purposes in agrochemical compositions. Preferred secondary thickeners are expected to include cellulose derivatives, acrylic acid derivatives, xanthan gum, modified clays and highly dispersed silicas.

[0308] Adhesives that may be present in the seed dressing formulations which can be used according to the invention include all customary binders which can be used in seed dressing products. Mention may be made preferably of polyvinyl pyrrolidone, polyvinyl acetate, polyvinyl alcohol and methylcellulose.

[0309] Gibberellins which may be present in the seed dressing formulations which can be used according to the invention preferably include gibberellins A1, A3 (=gibberellic acid), A4 and A7; gibberellic acid is particularly preferably used. Gibberellins are known (cf. R. Wegler, "Chemie der Pflanzenschutz-und ", Volume 2, Springer Verlag, 1970, pp.401-412).

[0310] The seed dressing formulations that can be used according to the invention can be used directly or after dilution with water to treat any of a variety of seeds. Therefore, the concentrate or the preparation obtained therefrom by dilution with water can be used for seed dressing of the seeds of the following plants: cereals such as seeds of wheat, barley, rye, oats and triticale, as well as corn, rice, rape, peas, beans, cotton, sunflower and beet and a variety of different vegetable seeds. The seed dressing formulations that can be used according to the invention or their diluted preparations can also be used for seed dressing of transgenic plants. In this case, additional synergistic effects can occur in the interaction of substances formed by expression.

[0311] For treating the seed with the seed dressing formulations which can be used according to the invention or with formulations derived therefrom by adding water, suitable mixing apparatus include all equipment which can usually be used for seed dressing. More specifically, the seed dressing is carried out by placing the seed in a mixer, adding the specifically required amount of the seed dressing formulation - as such or after prior dilution with water - and mixing until the formulation is evenly distributed on the seed. A drying operation can then be carried out.

[0312] The application rates of the seed dressing formulations that can be used according to the invention can vary within a relatively wide range. The application rate is determined by the specific amounts of the biological control agent based on a member of the family of recombinant Bacillus cereus producing exospores and at least one specific insecticide disclosed herein in the formulation and the seeds. In the case of the composition, the application rate is generally in the range of 0.001-50 g / kg of seed, preferably in the range of 0.01-15 g / kg of seed.

[0313] The compositions of the invention, if they exhibit insecticidal and acaricidal and / or nematicidal activity, have good plant tolerance and favorable toxicity to warm-blooded animals and good environmental compatibility, are suitable for protecting plants and plant organs, increasing harvest yields, improving the quality of harvested materials and controlling animal pests, in particular insects, mites, arachnids, worms, nematodes and molluscs encountered in agriculture, horticulture, animal husbandry, forestry, gardens and leisure facilities, protection of stored products and materials and in sanitary areas. They can preferably be used as plant protection agents. In particular, the present invention relates to the use of the compositions of the invention as insecticides and / or fungicides.

[0314] They are active against normally sensitive and resistant species and against all or some developmental stages.

[0315] These pests include:

[0316] Pests from the phylum Anthropoda, in particular from the class Arachnida, for example Acarus spp., Aceria sheldoni, Aculops spp., Aculus spp., Amblyomma spp., Amphitetranychus viennensis, Argas spp., Boophilus spp., Brevipalpus spp., Bryobia graminum, Bryobia praetiosa, Centruroides spp., Chorioptes spp., Dermanyssus gallinae, Dermatophagoides pteronyssius), Dermatophagoides farinae, Dermacentor spp., Eotetranychus spp., Epitrimerus pyri, Eutetranychus spp., Eriophyes spp., Glycyphagus domesticus, Halotydeus destructor, Hemitarsonemus spp., Hyalomma spp., Ixodes spp., Latrodectus spp., Loxosceles spp., Metatetranychus spp., Neutrombicula autumnalis, Nuphersa spp., Oligonychus spp., Ornithodoros spp., Ornithonyssus spp., Panonychus spp., Phyllocoptruta oleivora, Polyphagotarsonemus latus, Psoroptes spp., Rhipicephalus spp.), Rhizoglyphus spp., Sarcoptes spp., Scorpiomaurus, Steneotarsonemus spp., Steneotarsonemus spinki, Tarsonemus spp., Tetranychus spp., Trombiculaalfreddugesi, Vaejovis spp., Vasates lycopersici;.

[0317] In particular, the clover mite, brown mite, hazelnut spider mite, asparagus spider mite, brown wheat mite, legume mite, oxalis mite, boxwood mite, Texas citrus mite, Oriental red mite, citrus red mite, European red mite, yellow spider mite, fig spider mite, Lewis spider mite, six-spotted spider mite, Willamette mite, Yuma spider mite, web-spinning mite, pineapple spider mite, and pineapple mites. mite, citrus green mite, honey-locust spider mite, tea red spider mite, southernred mite, avocado brown mite, spruce spider mite, avocado red mite, Banks grass mite, carmine spider mite, desert spider mite, vegetable spider mite, tumid spider mite, strawberry spider mite, two-spotted spider mite, McDaniel mite, Pacific spider mite, hawthorn spider mite, four-spotted spider mite, Schoenei spider mite, Chilean false spidermite, citrus flat mite, privet mite, flat scarlet mite, white-tailed mite, pineapple tarsonemid mite, West Indian sugar cane mite, bulb scale mite, cyclamenmite, broad mite, winter grain mite, red-leggedearth mite, filbert big-bud mite, grape erineum mite, pear blister leaf mite, apple leaf edgeroller mite, peach mosaic vector mite, alder bead gall mite, Perian walnut leaf gall mite, mite, pecan leaf edgeroll mite, fig bud mite, olive bud mite, citrus bud mite, litchi erineum mite, wheat curl mite, coconutflower and nut mite, sugar cane blister mite, buffalo grass mite, bermuda grass mite, carrot bud mite, sweet potato leaf gall mite, pomegranate leaf curl mite, ash sprangle gall mite, maple bladder gall mite, aldererineum mite, redberry mite, cotton blister mite, mite), blueberry bud miterust mite, pink tea rust mite, ribbed tea mite, grey citrus mite, sweet potato rust mite, horsechestnut rust mite, citrus rust mite, apple rust mite, grape rust mite, pear rust mite, flat needle sheath pine mite, wild rose bud and fruit mite, dryberry mite, mango rust mite, azalea rust mite, plum rust mite, peach silver mite, apple rust mite, tomato russet rust mite, mite), pink citrus rust mite, cereal rust mite, rice rust mite;

[0318] Class Chilopoda, e.g. Geophilus spp., Scutigera spp.;

[0319] The order or class Collembola, for example, Onychiurus armatus;

[0320] Diplopoda, e.g. millipede (Blaniulus guttulatus);

[0321] From the class Insecta, for example, from the order Blattodea, for example Blattella asahinai, Blattella germanica, Blatta orientalis, Leucophaea maderae, Panchlora spp., Parcoblatta spp., Periplaneta spp., Supella longipalpa;

[0322] From the order of the Coleoptera, for example, Acalymma vittatum, Acanthoscelides obtectus, Adoretus spp., Agelasta alni, Agriotes spp., Alphitobius diaperinus, Amphimallon solstitialis, Anobium punctatum, Anoplophora spp., Anthonomus spp., Anthrenus spp., Apions spp., Apogonia spp., Atomaria spp., Attagenus spp., Bruchidius punctatum obtectus), Bruchus spp., Cassida spp., Cerotoma trifurcata, Ceuthorhynchus spp., Chaetocnema spp., Cleonus mendicus, Conoderus spp., Cosmopolites spp., Costelytrazealandica, Ctenicera spp., Curculio spp., Cryptolestes ferrugineus, Cryptorhynchus lapathi, Cylindrocopturus spp., Dermestes spp., Diabrotica spp.), Dichocrocis spp., Dicladispa armigera, Diloboderus spp., Epilachna spp., Epitrix spp., Faustinus spp., Gibbium psylloides, Gnathocerus cornutus, Hellula undalis, Heteronychus arator, Heteronyx spp., Hylamorphaelegans, Hylotrupes bajulus, Hypera postica, Hypomeces squamosus, Hypothenemus spp., Lachnosterna consanguinea, Lasioderma serricorne, Latheticus oryzae, Lathridius spp., Lema spp., Leptinotarsa decemlineata), Leucoptera spp., Lissorhoptrusoryzophilus, Lixus spp., Luperodes spp., Lyctus spp., Megascelis spp., Melanotus spp., Meligethes aeneus, Melolontha spp., Migdolus spp., Monochamus spp., Naupactus xanthographus, Necrobia spp., Niptus hololeucus, Oryctes rhinoceros, Oryzaephilus surinamensis), Oryzaphagus oryzae, Otiorrhynchus spp., Oxycetonia jucunda, Phaedon cochleariae, Phyllophaga spp., Phyllophaga helleri, Phyllotreta spp., Popillia japonica, Premnotrypes spp.), Prostephanus truncatus, Psylliodes spp., Ptinus spp., Rhizobius ventralis, Rhizopertha dominica, Sitophilus spp., Sitophilus oryzae, Sphenophorus spp., Stegobium paniceum, Sternechus spp., Symphyletes spp., Tanymecus spp., Tenebrio molitor, Tenebrioides mauretanicus, Tribolium spp., Trogoderma spp., Tychius spp.), Xylotrechus spp., and Zabrus spp.;

[0323] Preferred are Banded cucumber beetle (Diabrotica balteata), Northern corn rootworm (Diabrotica barberi), Southern corn rootworm (Diabrotica undecimpunctata howardi), Western cucumber beetle (Diabrotica undecimpunctata tenella), Western spotted cucumber beetle, Diabrotica undecimpunctata undecimpunctata, Western corn rootworm (Diabrotica virgifera), Mexican corn rootworm (Diabrotica virgifera zeae).

[0324] From the order of the Diptera, for example, Aedes spp., Agromyza spp., Anastrepha spp., Anopheles spp., Asphondylia spp., Bactrocera spp., Bibio hortulanus, Calliphora erythrocephala, Calliphora vicina, Ceratitis capitata, Chironomus spp., Chrysomyia spp., Chrysops spp., Chrysozona pluvialis, Cochliomyia spp., Contarinia spp.), Cordylobia anthropophaga, Cricotopus sylvestris, Culex spp., Culicoides spp., Culiseta spp., Cuterebra spp., Dacus oleae, Dasyneura spp., Delia spp., Dermatobia hominis, Drosophila spp., Echinocnemus spp., Fannia spp., Gastrophilus spp., Glossina spp., Haematopota spp., Hydrellia spp.), Hydrellia griseola, Hylemya spp., Hippobosca spp., Hypoderma spp., Liriomyza spp., Lucilia spp., Lutzomia spp., Mansonia spp., Musca spp., Oestrus spp., Oscinella frit, Paratanytarsus spp., Paralauterborniella subcincta, Pegomyia spp., Phlebotomus spp., Phorbia spp., Phormia spp., Piophila casei, Prodiplosis spp., Psila rosae, Rhagoletis spp., Sarcophaga spp., Simulium spp., Stomoxys spp., Tabanus spp., Tetanops spp., Tipula spp..

[0325] From the order of the Heteroptera, for example, Anasa tristis, Antestiopsis spp., Boisea spp., Blissus spp., Calocoris spp., Campylomma livida, Cavelerius spp., Cimex spp., Collaria spp., Creontiades dilutus, Dasynus piperis, Dichelops furcatus, Diconocoris hewetti, Dysdercus spp., Euschistus spp.), Eurygasters spp., Heliopeltis spp., Horcias nobilellus, Leptocorisa spp., Leptocorisa varicornis, Leptoglossus phyllopus, Lygus spp., Macropes excavatus, Miridae, Monalonion atratum, Nezara spp., Oebalus spp., Pentomidae, Piesma quadrata, Piezodorus spp., Psallus spp.), Pseudacysta persea, Rhodnius spp., Sahlbergella singularis, Scaptocoris castanea, Scotinophora spp., Stephanitis nashi, Tibraca spp., Triatoma spp.;

[0326] From the order of the Homoptera, for example, Acizzia acaciaebaileyanae, Acizzia dodonaeae, Acizzia uncatoides, Acrida turrita, Acyrthosipon spp., Acrogonia spp., Aeneolamia spp., Agonascena spp., Aleuyrodes proletella, Aleurolobus barodensis, Aleurothrixus floccosus, Allocaridara malayensis, Amrasca spp., Anuraphis cardui, Aonidiella spp., Aphanostigma piri, Aphis spp., Arboridia apicalis), Arytainilla spp., Aspidiotus spp., Atanus spp., Aulacorthum solani, Bemisia tabaci, Blastopsylla occidentalis, Boreoglycaspis melaleucae, Brachycaudushelichrysi, Brachycolus spp., Brevicoryne brassicae, Cacopsylla spp., Calligypona marginata, Carneocephalafulgida, Ceratovacuna lanigera, Cercopidae, Ceroplastes spp.), Strawberry Aphid (Chaetosiphon fragaefolii), Sugarcane Yellow Snow Shield Scale (Chionaspistegalensis), Tea Green Leafhopper (Chlorita onukii), Cotton Locust (Chondracris rosea), Walnut Black Spot Aphid (Chromaphis juglandicola), Black Brown Round Shield Scale (Chrysomphalus ficus), Corn Leafhopper (Cicadulinambila), Coccomytilus halli, Soft Scale Species (Coccus spp.), Tea Currant Cryptomyopsis aphid (Cryptomyzusribis), Cryptonossa spp., Comb Psyllid Species (Ctenarytaina spp.), Dalbulus spp., Citrus Whitefly (Dialeurodes citri), Citrus Psyllid (Diaphorina citri), White-backed Shield Scale Species (Diaspis spp.), Foot Scale Species (Drosicha spp.), Dysaphis spp., Dysmicoccus spp., Empoasca spp., Eriosoma spp., Erythroneura spp., Eucalyptolyma spp., Euphyllura spp., Euscelis bilobatus, Ferrisia spp., Geococcus coffeae, Glycaspis spp., Heteropsyllacubana, Heteropsylla spinulosa, Homalodisca coagulata, Hyalopterus arundinis, Icerya spp., Idiocerus spp.), Idioscopus spp., Laodelphax striatellus, Lecanium spp., Lepidosaphes spp., Lipaphis erysimi, Macrosiphum spp., Macrosteles facifrons, Mahanarvas spp., Melanaphis sacchari, Metcalfiella spp.、Metopolophiumdirhodum、Monellia costalis、Monelliopsis pecanis、Myzusspp.、Nasonovia ribisnigri、Nephotettix spp.、Nettigoniclla spectra、Nilaparvata lugens、Oncometopia spp.、Ortheziapraelonga、Oxya chinensis、Pachypsylla spp.、Parabemisiamyricae、Paratrioza spp.、Parlatoria spp.、Pemphigus spp.、Peregrinus maidis、Phenacoccus spp.、Phloeomyzus passerinii), Phorodon humuli, Phylloxera spp., Pinnaspis aspidistrae, Planococcus spp., Prosopidopsylla flava, Protopulvinaria pyriformis, Pseudaulacaspis pentagona, Pseudococcus spp., Psyllopsis spp., Psylla spp., Pteromalus spp., Pyrilla spp., Quadraspidiotus spp., Quesada gigas, Rastrococcus spp., Rhopalosiphum spp.), Saissetia spp., Scaphoideustitanus, Schizaphis graminum, Selenaspidusarticulatus, Sogata spp., Sogatella furcifera, Sogatodes spp.、Stictocephala festina、Siphoninus phillyreae、Tenalaphara malayensis、Tetragonocephela spp.、Tinocallis caryaefoliae、Tomaspis spp.、Toxoptera spp.、Trialeurodes vaporariorum、Trioza spp.、Typhlocybas spp.、Unaspis spp.、Viteus vitifolii、Zyginas spp.;.

[0327] From the order of the Hymenoptera, for example, Acromyrmex spp., Athalia spp., Atta spp., Diprion spp., Hoplocampas spp., Lasius spp., Monomorium pharaonis, Sirex spp., Solenopsis invicta, Tapinoma spp., Urocerus spp., Vespa spp., Xeris spp.;

[0328] From the order of the Isopoda, for example, Armadillidium vulgare, Oniscusasellus, Porcellio scaber;

[0329] From the order of the Isoptera, for example, Coptotermes spp., Cornitermes cumulans, Cryptotermes spp., Incisitermes spp., Microtermes obesi, Odontotermes spp., Reticulitermes spp.;

[0330] From the order of the Lepidoptera, for example, Achroia grisella, Acronictamajor, Adoxophyes spp., Aedia leucomelas, Agrotis spp., Alabama spp., Amyelois transitella, Anarsia spp., Anticarsia spp., Argyroploces spp., Barathra brassicae, Borbo cinnara, Bucculatrix thurberiella, Bupalus piniarius, Busseola spp., Cacoecia spp.), Caloptilia theivora, Capua reticulana, Carpocapsa pomonella, Carposina niponensis, Cheimatobia brumata, Chilo spp., Choristoneura spp., Clysia ambiguella, Cnaphalocerus spp., Cnaphalocrocis medinalis, Cnephasia spp., Conopomorpha spp., Conotrachelus spp., Copitarsia spp., Cydia spp., Dalacanoctuides, Diaphania spp.), Diatraea saccharalis, Earias spp., Ecdytolopha aurantium, Elasmopalpus lignosellus, Eldana saccharina, Ephestia spp., Epinotia spp., Epiphyas postvittana, Etiella spp.), Eulia spp., Eupoecilia ambiguella, Euproctis spp., Euxoa spp., Feltia spp., Galleria mellonella, Gracillaria spp., Grapholitha spp., Hedylepta spp., Helicoverpa spp., Heliothis spp., Hofmannophila pseudospretella, Homoeosoma spp., Homona spp., Hyponomeuta padella, Kakivoria flavofasciata), Laphygma spp., Laspeyresia molesta, Leucinodesorbonalis, Leucoptera spp., Lithocolletis spp., Lithophane antennata, Lobesia spp., Loxagrotis albicosta, Lymantria spp., Lyonetia spp., Malacosoma neustria, Maruca testulalis, Mamestrabrassicae, Melanitis leda, Mocis spp., Monopis obviella, Mythimma separata, Nemapogon cloacellus, Nymphula spp., Oiketicus spp., Oria spp., Orthaga spp., Ostrinia spp., Oulema oryzae, Panolis flammea, Parnaras spp., Pectinophora spp., Perileucoptera spp., Phthorimaea spp., Phyllocnistis citrella, Phyllonorycter spp., Pieris spp., Platynota stultana, Plodia interpunctella, Plusia spp., Plutella xylostella, Prays spp., Prodenia spp., Protoparce spp., Pseudaletia spp., Pseudaletia unipuncta, Pseudoplusia includens, Pyrausta nubilalis, Rachiplusia nu, Schoenobius spp.), Scirpophaga spp., Scirpophaga innotata, Scotia segetum, Sesamia spp., Sesamia inferens, Sparganothis spp., Spodoptera spp., Spodoptera praefica, Stathmopoda spp., Stomopteryx subsecivella, Synanthedon spp., Tecia solanivora, Thermesia gemmatalis, Tinea cloacella, Tinea pellionella, Tineola bisselliella, Tortrix spp.), Trichophagatapetzella, Trichoplusia spp., Tryporyza incertulas, Tuta absoluta, Virachola spp.;.

[0331] From the order of the Orthoptera (Saltatoria), for example, Acheta domesticus, Dichroplus spp., Gryllotalpa spp., Hieroglyphus spp., Locusta spp., Melanoplus spp., Schistocerca gregaria;

[0332] From the order of the Phthiraptera, for example, Damalinia spp., Haematopinus spp., Linognathus spp., Pediculus spp., Ptirus pubis, Trichodectes spp.;

[0333] From the order of the Psocoptera, for example, Lepinatus spp., Liposcelis spp.;

[0334] From the order of the Siphonaptera, for example, Ceratophyllus spp., Ctenocephalides spp., Pulex irritans, Tunga penetrans, Xenopsylla cheopis;

[0335] From the order of the Thysanoptera, for example, Anaphothrips obscurus, Baliothrips biformis, Drepanothrips reuteri, Enneothrips flavens, Frankliniella spp., Heliothrips spp., Hercinothrips femoralis, Rhipiphorothrips cruentatus, Scirtothrips spp., Taeniothrips cardamoni, Thrips spp.;

[0336] From the order of the Zygentoma (= Thysanura), for example, Ctenolepisma spp., Lepisma saccharina, Lepismodes inquilinus, Thermobia domestica;

[0337] Symphyla, e.g. Scutigerella spp.;

[0338] Pests from the phylum Mollusca, in particular from the class Bivalvia, for example Dreissena spp., and from the class Gastropoda, for example Arions spp., Biomphalaria spp., Bulinus spp., Deroceras spp., Galba spp., Lymnaea spp., Oncomelania spp., Pomacea spp., Succinea spp.;

[0339] Animal pests from the phyla Plathelinthes and Nematoda, for example, Ancylostoma duodenale, Ancylostomaceylanicum, Acylostoma braziliensis, Ancylostomas spp., Ascaris spp., Brugia malayi, Brugiatimori, Bunostomum spp., Chabertia spp., Clonorchis spp., Cooperia spp., Dicrocoelium spp., Dictyocaulus filaria), Diphyllobothrium latum, Dracunculus medinensis, Echinococcus granulosus, Echinococcus multilocularis, Enterobius vermicularis, Faciola spp., Haemonchus spp., Heterakis spp., Hymenolepis nana, Hyostrongulus spp., Loa Loa, Nematodirus spp., Oesophagostomum spp., Opisthorchis spp.), Onchocercavolvulus, Ostertagia spp., Paragonimus spp., Schistosomen spp., Strongyloides fuelleborni, Strongyloides stercoralis, Stronyloides spp.), Taenia saginata, Taenia solium, Trichinella spiralis, Trichinella nativa, Trichinella britovi, Trichinella nelsoni, Trichinella pseudopsiralis, Trichostrongulus spp., Trichuris trichuria, Wuchereria bancrofti;.

[0340] Plant parasitic pests from the phylum Nematoda, for example Aphelenchoides spp., Bursaphelenchus spp., Ditylenchus spp., Globodera spp., Heterodera spp., Longidorus spp., Meloidogyne spp., Pratylenchus spp., Radopholus similis, Trichodorus spp., Tylenchulus spp., Xiphinema spp., Helicotylenchus spp. spp.), Tylenchorhynchus spp., Scutellonema spp., Paratrichodorus spp., Meloinema spp., Paraphelenchus spp., Aglenchus spp., Belonolaimus spp., Nacobbus spp., Rotylenchulus spp., Rotylenchus spp., Neotylenchus spp., Paraphelenchus spp., Dolichodorus spp., Hoplolaimus spp.), Punctodera spp., Criconemella spp., Quinisulcius spp., Hemicycliophora spp., Anguina spp., Subanguinas spp., Hemicriconemoides spp., Psilenchus spp., Pseudohalenchus spp., Criconemoides spp., Cacopaurus spp., Hirschmaniella spp., Tetylenchus spp.

[0341] The fact that the compositions are well tolerated by plants at the concentrations required for controlling plant diseases and pests allows the use of the compositions to treat above-ground parts of plants, propagation material and seeds, and the soil.

[0342] According to the present invention, all plants and plant parts can be treated. Here, plants refer to all plants and plant populations, such as desired and undesired wild plants, cultivars and plant varieties (whether or not protected by plant variety rights or plant breeders' rights). Cultivar and plant variety can be plants obtained by conventional propagation and breeding methods assisted or supplemented by one or more biotechnology methods, such as by using double haploids, protoplast fusion, random mutagenesis and directed mutagenesis, molecular markers or genetic markers, or by bioengineering and genetic engineering methods. Plant parts refer to all above-ground and underground parts and organs of plants, such as buds, leaves, flowers and roots, whereby, for example, leaves, needles, stems, stems, flowers, fruiting bodies, fruits and seeds, as well as roots, bulbs and rhizomes are listed. Crops and asexual and sexual propagation materials, such as cuttings, bulbs, rhizomes, barberries and seeds also belong to plant parts.

[0343] The composition of the invention, when well tolerated by plants and combined with favorable toxicity to warm-blooded animals and well tolerated by the environment, is suitable for protecting plants and plant organs, for increasing harvest yield, improving the quality of harvested material. It can preferably be used as a crop protection composition. It is active against normally sensitive and resistant varieties and against all or some developmental stages.

[0344] Plants that can be treated according to the invention include the following major crop plants: corn, soybean, alfalfa, cotton, sunflower, Brassica oil seeds, such as rapeseed (e.g. canola, rapeseed), Brassica rapa, B. juncea (e.g. (field) mustard) and Brassica carinata, palm species (e.g. oil palm, coconut), rice, wheat, sugar beet, sugar cane, oats, rye, barley, millet and sorghum, triticale, flax, nuts, grapes and vines and various fruits and vegetables from various plant taxa, such as Rosaceae sp. (e.g. pome fruits, such as apples and pears; and stone fruits, such as apricots, cherries, almonds, plums and peaches; berries, such as strawberries, raspberries, red currants and black currants; currant and gooseberry), Ribesioidae sp., Juglandaceae sp., Betulaceae sp., Anacardiaceae sp., Fagaceae sp., Moraceae sp., Oleaceae sp. (e.g., olive trees), Actinidaceae sp., Lauraceae sp. (e.g., avocado, cinnamon, camphor), Musaceae sp. (e.g., banana trees and plantations), Rubiaceae sp. (e.g., coffee), Theaceae sp. (e.g., tea trees), Sterculiceae sp., Rutaceae sp. sp.) (e.g., lemon, orange, tangerine, and grapefruit), Solanaceae sp. (e.g., tomato, potato, pepper, chili, eggplant, tobacco), Liliaceae sp.), Compositiae sp. (e.g., lettuce, artichoke, and chicory, including root chicory, endive, or common chicory), Umbelliferae sp. (e.g., carrot, parsley, celery, and celeriac), Cucurbitaceae sp. (e.g., cucumber, including gherkin, pumpkin, watermelon, gourds, and melons), Alliaceae sp. (e.g., leek and onion), Cruciferae sp.) (e.g. white cabbage, red cabbage, broccoli, cauliflower, Brussels sprouts, pakchoi, kohlrabi, radish, horseradish, watercress and Chinese cabbage), Leguminosae sp. (e.g. peanuts, peas, lentils and beans - for example common beans and beans sensu lato), Chenopodiaceae sp. (e.g. leaf beets, fodder beets, spinach, beetroot), Linaceae sp. (e.g. hemp), Cannabeaceae sp. (e.g. cannabis), Malvaceae sp. (e.g. okra, cocoa), Papaveraceae sp. (e.g. poppy), Asparagaceae sp. (e.g. asparagus); useful and ornamental plants for horticulture and forestry, including turf, lawns, grasses and Stevia rebaudiana); and in each case, genetically modified varieties of these plants.

[0345] Depending on the plant species or plant cultivars, their location and growth conditions (soils, climate, vegetation period, nutrition), the treatment according to the invention may also result in superadditive ("synergistic") effects by using or applying the compositions according to the invention. Thus, for example, by using or applying the compositions according to the invention in the treatment according to the invention, the following effects beyond what was actually expected may occur: reduction of the application rate and / or broadening of its spectrum of activity and / or increase of its activity, improvement of plant growth, increased tolerance to high or low temperatures, increased tolerance to drought or to water or soil salinity, improved flowering quality, easier harvesting, accelerated ripening, increased harvesting yield, larger fruits, taller plants, greener leaves, earlier flowering, improved quality of the harvested product and / or increased nutritional value, higher sugar concentration in the fruit, better storage stability and / or better processability of the harvested product.

[0346] In the treatment of the present invention, the composition of the present invention may also have a strengthening effect on plants at certain application rates. The defense system of the plant against unwanted phytopathogenic fungi and / or microorganisms and / or viruses is mobilized. Plant strengthening (resistance inducing) substances are understood herein to mean those substances or combinations of substances that can stimulate the plant defense system in such a way that when subsequently inoculated with unwanted phytopathogenic fungi and / or microorganisms and / or viruses, the treated plants show a great degree of resistance to these phytopathogenic fungi and / or microorganisms and / or viruses. Therefore, by using or applying the composition of the present invention in the treatment of the present invention, plants can be protected from the above-mentioned pathogens for a period of time after the treatment. After the plants are treated with the active compound, the time for achieving the protective effect generally lasts for 1-10 days, preferably 1-7 days.

[0347] Likewise preferably, the plants and plant cultivars to be treated according to the invention are resistant to one or more biotic stress factors, ie the plants exhibit an improved defence against animal and microbial pests, for example against nematodes, insects, mites, phytopathogenic fungi, bacteria, viruses and / or viroids.

[0348] Plants and plant cultivars that may also be treated according to the invention are plants that are resistant to one or more abiotic stresses, i.e. plants that have shown increased plant health in terms of stress tolerance. Abiotic stress conditions may include, for example, drought, low temperature exposure, heat exposure, osmotic stress, waterlogging, increased soil salinity, enhanced mineral exposure, ozone exposure, high light exposure, limited nitrogen nutrient availability, limited phosphorus nutrient availability or shade avoidance. Preferably, treatment of these plants and cultivars with the compositions of the invention additionally increases overall plant health (see above).

[0349] Plants and plant cultivars which may also be treated according to the invention are plants characterized by enhanced yield properties, i.e. plants which exhibit increased plant health with respect to this property. Increased yield in such plants may be the result of factors such as improved plant physiology, growth and development, such as water use efficiency, water retention efficiency, improved nitrogen utilization, enhanced carbon assimilation, improved photosynthesis, increased germination rate and accelerated maturity.

[0350] Yield can also be affected by improved plant architecture (under stress and non-stress conditions), including but not limited to: early flowering, flowering control for hybrid seed production, seedling vigor, plant size, number of internodes and internode distance, root growth, seed size, fruit size, pod size, number of pods or ears, number of seeds per pod or ear, seed quality, improved seed fullness, reduced seed dispersal, reduced pod dehiscence, and lodging resistance. Other yield characteristics include seed composition, such as carbohydrate content, protein content, oil content and composition, nutritional value, reduction in anti-nutritional compounds, improved processability, and better storage stability. Preferably, treatment of these plants and cultivars with the compositions of the present invention additionally increases overall plant health (see above).

[0351] Plants that can be processed according to the present invention are hybrid plants that have expressed hybrid characteristics or hybrid vigor, which usually bring higher yields, higher vigor, healthier plants and better resistance to biological and abiotic stress factors. Such plants are usually produced by hybridizing a selfing male sterile parent line (female parent) with another selfing male fertile parent line (male parent). Hybrid seeds are usually harvested from male sterile plants and sold to growers. Male sterile plants can sometimes (for example in corn) be produced by emasculation (i.e. mechanically removing male reproductive organs (or male flowers)), but, more generally, male sterility is produced by genetic determinants in plant genomes. In this case, particularly when seed is a desired product to be harvested from hybrid plants, it is usually useful to ensure that the male fertility of hybrid plants is fully restored. This can be accomplished by ensuring that the male parent has a suitable fertility recovery gene that can restore the male fertility of hybrid plants containing the genetic determinants responsible for male sterility. The genetic determinants responsible for male sterility can be located in the cytoplasm. For example, examples of cytoplasmic male sterility (CMS) have been described in Brassica species. However, the genetic determinants responsible for male sterility may also be located in the nuclear genome. Male sterile plants may also be obtained by plant biotechnology methods such as genetic engineering. A particularly useful method for obtaining male sterile plants is described in WO 89 / 10396, in which, for example, a ribonuclease such as barnase is selectively expressed in the tapetum cells in the stamens. Fertility may subsequently be restored by expressing a ribonuclease inhibitor such as barnase inhibitor in the tapetum cells.

[0352] Plants or plant cultivars (obtained by plant biotechnology methods such as genetic engineering) which may be treated according to the invention are herbicide-tolerant plants, i.e. plants made tolerant to one or more given herbicides. Such plants can be obtained by genetic transformation or by selection of plants containing mutations imparting such herbicide tolerance.

[0353] Example

[0354] Example 1: Efficacy formula of a combination of multiple active ingredients

[0355] A synergistic effect of the active ingredients exists when the activity of the active ingredient combination exceeds the total activity of the active ingredients when applied alone. The expected activity of a given combination of two active ingredients can be calculated as follows (see Colby, SR, "Calculating Synergistic and Antagonistic Responses of Herbicide Combinations," Weeds, 1967, 15, 20-22):

[0356] if

[0357] X is the efficacy of active ingredient A at an application rate of m ppm (or g / ha),

[0358] Y is the efficacy of active ingredient B at an application rate of n ppm (or g / ha),

[0359] E is the efficacy of active ingredients A and B at application rates of m ppm and n ppm (or g / ha), respectively,

[0360] but

[0361]

[0362] If the actual activity exceeds the calculated value, the activity of the combination is superadditive, i.e., there is a synergistic effect. In this case, the actual observed efficacy must be greater than the expected efficacy (E) calculated by the above formula.

[0363] For example, described formula and analysis can be used for assessing plant growth promotion.This test is assessed after being applied to plant for a few days.100% expression corresponds to the plant weight of untreated control plants.In this case effect refers to extra plant weight % compared with untreated control.For example, the effect of processing that realizes plant weight is 120% is 20% compared with untreated control plants.If the plant growth promoting effect of conjugate (i.e. the effect of the plant weight % of the plant treated with conjugate observed) exceeds calculated value, then the activity of conjugate is superadditive, i.e. there is synergistic effect.

[0364] The formula and analysis can also be used to assess synergy in disease control trials. The degree of efficacy expressed in % is recorded. 0% means an efficacy corresponding to the control, while an efficacy of 100% means that no disease is observed.

[0365] If the actual insecticidal or fungicidal activity exceeds the calculated value, the activity of the combination is superadditive, i.e., there is a synergistic effect. In this case, the actual observed efficacy must be greater than the expected efficacy (E) calculated by the above formula.

[0366] Another method for demonstrating synergistic effect is the Tammes method (see “Isoboles, A Graphic Representation of Synergismin Pesticides” in Neth. J. Plant Path., 1964, 70, 73-80).

[0367] Example 2: Plant Growth Promotion Using Flupyrone and Recombinant Bacillus thuringiensis Cells An experiment was conducted to analyze the efficacy of a combination of flupyrone and a fermentation product of recombinant Bacillus thuringiensis cells expressing phospholipase C ("BEPC"). Corn seeds were planted in a sterile mixture of synthetic substrate and sand in small three-inch square pots on a light rack in a plant growth room at 25-28°C and 50% humidity for approximately 14 days. Two seeds were planted in each pot. At planting, the growth substrate in each pot was impregnated with the following treatments. After 14 days, the whole plant biomass of the plants was measured. In the following table, UTC refers to the untreated control. "Calculated" refers to the expected effect calculated using the above Colby equation, and "Efficacy" refers to the actual effect observed.

[0368] The product, containing flupyrazone as its active ingredient (17.09% flupyrazone), was diluted in 50 mL of water and the diluted solution was used to impregnate the growth substrate. The application rates shown below refer to the amount of active ingredient (ie, flupyrazone) applied to the growth substrate.

[0369] A recombinant Bacillus cereus family member (Bacillus thuringiensis BT013A) expressing a phospholipase on its exospores (BEPC) was produced as follows. To produce a plasmid expressing a fusion protein in a Bacillus cereus family member, a PCR fragment encoding the BclA promoter (SEQ ID NO:85), a methionine start codon, and amino acids 20-35 (SEQ ID NO:1) of BclA was produced, followed by six alanine linker sequences fused in frame to the Bacillus thuringiensis BT013A phospholipase (SEQ ID NO:108). These PCR fragments were digested with XhoI and ligated to the SalI site of the pSUPER plasmid to produce the plasmid pSUPER-BclA 20-35-phospholipase. The pSUPER plasmid was produced by fusion of the pUC57 plasmid (containing an ampicillin resistance cassette) and the pBC16-1 plasmid (containing tetracycline resistance) of Bacillus. The 5.5 kbp plasmid can replicate in E. coli and Bacillus species. The pSUPER-BclA 20-35-phospholipase plasmid was transformed and propagated in a dam methylase negative E. coli strain and finally transformed into Bacillus thuringiensis BT013A.

[0370] To obtain a complete fermentation broth culture of BEPC, 15 mL of a conical flask containing brain heart infusion medium (BHI) was inoculated with BEPC and grown for 7-8 hours at about 30°C under a 300 rpm shaker. The next day, 250 μL of aliquots from each flask were inoculated into a 250 mL flask containing 50 mL of yeast extract-based medium and grown at about 30°C. About 2 days after inoculation, when at least 95% of spore formation was complete, the culture broth was collected and colony forming units were calculated. The fermentation broth was diluted to 5% in 50 mL of water and the following colony forming units were applied to each pot.

[0371] Table 3

[0372]

[0373] The results demonstrate a super-additive plant yield effect when flupyralidone and BEPC are combined. Example 3: Plant growth promotion using clothianidin and recombinant Bacillus thuringiensis cells

[0374] Corn seeds were planted in loamy sand in a greenhouse at 20° C. and 70% humidity for about 11 days. Approximately 11 days from the time of treatment, the seedlings above the soil were cut and the fresh weight was determined.

[0375] Recombinant Bacillus thuringiensis cells expressing endoglucanase encoded by SEQ ID NO: 107 or phospholipase C encoded by SEQ ID NO: 108 prepared as above were applied at about 50 μg / grain. Clothianidin was also applied at about 250 μg / grain.

[0376] It is expected that corn plants treated with the recombinant Bacillus thuringiensis in combination with clothianidin will have a % shoot weight that exceeds the calculated value based on the % shoot weight of corn plants treated with the two active ingredients alone, i.e. a synergistic effect will be observed.

Claims

1. A composition comprising a synergistically effective amount of: a) a recombinant exospore-producing Bacillus cell expressing a fusion protein comprising (i) at least one protein or peptide selected from the group consisting of plant growth stimulating proteins or peptides and proteins or peptides having insecticidal activity, and (ii) a targeting sequence, an exospore protein, or an exospore protein fragment; and b) at least one insecticide selected from the group consisting of acetamiprid, aldicarb, amitraz, beta-cyfluthrin, carbaryl, clothianidin, cyfluthrin, cypermethrin, deltamethrin, endosulfan, ethion, ethiprole, fenamiphos, fenbutyl, fenthion, fipronil, flubendiamide, fluopyram, flupyrazone, flupyralid, flufenamic acid, heptathion, imidacloprid, methamidophos, methiocarb, methomyl, niclosamide, sulfone, phosalone, cypermethrin, spirodiclofen, spiromesifen, spirotetramat, thiacloprid, Thiodicarb, tralomethrin, triazophos, thiocarb, aphidron, 1-{2-fluoro-4-methyl-5-[(R)-(2,2,2-trifluoroethyl)sulfinyl]phenyl}-3-(trifluoromethyl)-1H-1,2,4-triazol-5-amine, and 1-(3-chloropyridin-2-yl)-N-[4-cyano-2-methyl-6-(methylcarbamoyl)phenyl]-3-{[5-(trifluoromethyl)-2H-tetrazol-2-yl]methyl}-1H-pyrazole-5-carboxamide.

2. The composition of claim 1, wherein at least one protein or peptide is a plant growth stimulating protein or peptide selected from enzymes involved in the production or activation of plant growth stimulating compounds and enzymes that degrade or modify bacterial, fungal or plant nutrient sources.

3. The composition of claim 1, wherein the exospore-producing Bacillus cell is a cell of a member of the Bacillus cereus family.

4. The composition of claim 3, wherein the Bacillus cereus family member is selected from the group consisting of Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillusgaemokensis, Bacillus weihenstephensis, Bacillus toyoiensis, and combinations thereof.

5. The composition of any one of claims 1 to 4, wherein the targeting sequence or exospore protein comprises: an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 1; a targeting sequence comprising amino acids 20-35 of SEQ ID NO: 1; a targeting sequence comprising amino acids 22-31 of SEQ ID NO: 1; a targeting sequence comprising amino acids 22-33 of SEQ ID NO: 1; a targeting sequence comprising amino acids 20-31 of SEQ ID NO: 1; A targeting sequence comprising SEQ ID NO: 1; or An exospore protein comprising an amino acid sequence that is at least 85% identical to SEQ ID NO:

2.

6. The composition of any one of claims 2 to 5, wherein the enzyme involved in the production or activation of the plant growth stimulating compound is selected from the group consisting of acetoin reductase, indole-3-acetamide hydrolase, tryptophan monooxygenase, acetolactate synthase, α-acetolactate decarboxylase, pyruvate decarboxylase, diacetyl reductase, butanediol dehydrogenase, aminotransferase, tryptophan decarboxylase, amine oxidase, indole-3-pyruvate decarboxylase, indole-3-acetaldehyde dehydrogenase, tryptophan side chain oxidase, nitrilase, nitrilase, peptidase, protease, adenosine phosphate isopentenyltransferase, phosphatase, adenosine kinase, adenine phosphoribosyltransferase, CYP735A, 5' ribonucleotide phosphohydrolase, adenosine nucleosidase, zeatin cis-trans isomerase, zeatin O-glucosyltransferase, β-glucosidase, cis-hydroxylase, CK cis-hydroxylase, CK N-glucosyltransferase, 2,5-ribonucleotide phosphohydrolase, adenosine nucleosidase, purine nucleoside phosphorylase, zeatin reductase, hydroxylamine reductase, 2-oxoglutarate dioxygenase, gibberellin 2B / 3B hydrolase, gibberellin 3-oxidase, gibberellin 20-oxidase, deacetylated chitosanase, chitinase, β-1,3-glucanase, β-1,4-glucanase, β-1,6-glucanase, aminocyclopropane-1-carboxylate deaminase, and enzymes involved in the production of nodulation factors.

7. The composition of claim 6, wherein the enzyme involved in the production or activation of the plant growth stimulating compound is chitosanase.

8. The composition of claim 7, wherein the fusion protein comprises SEQ ID NO:

109.

9. The composition of any one of claims 2 to 5, wherein the enzyme that degrades or modifies the bacterial, fungal or plant nutrient source is selected from the group consisting of cellulases, lipases, lignin oxidases, proteases, glycoside hydrolases, phosphatases, nitrogenases, nucleases, amidases, nitrate reductases, nitrite reductases, amylases, ammonia oxidases, ligninases, glucosidases, phospholipases, phytases, pectinases, glucanases, sulfatases, ureases, xylanases and siderophores.

10. The composition of claim 9, wherein the enzyme is a cellulase selected from the group consisting of endoglucanase, exoglucanase and beta-glucosidase.

11. The composition of claim 10, wherein the fusion protein comprises a Bacillus subtilis endoglucanase.

12. The composition of claim 11, wherein the fusion protein comprises SEQ ID NO:

107.

13. The composition of claim 12, wherein the recombinant Bacillus cell is from Bacillus thuringiensis BT013A.

14. The composition of claim 9, wherein the enzyme is a phospholipase.

15. The composition of claim 14, wherein the fusion protein comprises SEQ ID NO:

108.

16. The composition of any one of claims 1 to 15, wherein the fusion protein is expressed under the control of a sporulation promoter native to the targeting sequence of the fusion protein, the exosporium protein or the exosporium protein fragment.

17. The composition of any one of claims 1 to 16, wherein the fusion protein is expressed under the control of a high expressing sporulation promoter.

18. The composition of claim 17, wherein the high expression sporulation promoter comprises a sigma-K sporulation-specific polymerase promoter sequence.

19. The composition of any one of claims 16 to 18, wherein the sporulation promoter comprises a nucleic acid sequence that is at least 80% identical to the nucleic acid sequence of any one of SEQ ID NOs: 85-103.

20. The composition of any one of claims 1 to 19, wherein the at least one insecticide is selected from clothianidin, cypermethrin, ethiprole, fipronil, flupyralidone and methiocarb.

21. The composition of claim 20, wherein the insecticide is flupyralidone.

22. The composition of any one of claims 1 to 19, wherein the insecticide is clothianidin.

23. Seed treated with a composition according to any one of claims 1 to 22.

24. Use of a composition according to any one of claims 1 to 23 for enhancing plant growth and / or promoting plant health.

25. The use according to claim 24 for treating conventional plants or transgenic plants or their seeds.

26. A method of treating a plant, plant part or the area surrounding a plant to enhance plant growth and / or promote plant health comprising the steps of: Simultaneously or sequentially administer synergistically effective amounts of: a) a recombinant exospore-producing Bacillus cell expressing a fusion protein comprising (i) at least one plant growth stimulating protein or peptide, and (ii) a targeting sequence, an exospore protein or an exospore protein fragment; and b) at least one insecticide selected from the group consisting of acetamiprid, aldicarb, amitraz, beta-cyfluthrin, carbaryl, clothianidin, cyfluthrin, cypermethrin, deltamethrin, endosulfan, ethion, ethiprole, ethoprophos, fenamiphos, fenbutyl, fenthion, fipronil, flubendiamide, fluopyram, flupyrazone, flupyralid, flufenamic acid, heptathion, imidacloprid, methamidophos, methiocarb, methomyl, niclosamide, sulfone, phosalone, cypermethrin, spirodiclofen, spiromesifen, spirotetramat, thiacloprid , thiodicarb, tralomethrin, triazophos, chlorpyrifos, aphidron, 1-{2-fluoro-4-methyl-5-[(R)-(2,2,2-trifluoroethyl)sulfinyl]phenyl}-3-(trifluoromethyl)-1H-1,2,4-triazol-5-amine and 1-(3-chloropyridin-2-yl)-N-[4-cyano-2-methyl-6-(methylcarbamoyl)phenyl]-3-{[5-(trifluoromethyl)-2H-tetrazol-2-yl]methyl}-1H-pyrazole-5-carboxamide.

27. The method of claim 26, wherein the targeting sequence or exospore protein comprises: an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 is at least about 54%; a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 1; a targeting sequence comprising amino acids 20-35 of SEQ ID NO: 1; a targeting sequence comprising amino acids 22-31 of SEQ ID NO: 1; a targeting sequence comprising amino acids 22-33 of SEQ ID NO: 1; a targeting sequence comprising amino acids 20-31 of SEQ ID NO: 1; A targeting sequence comprising SEQ ID NO: 1; or An exospore protein comprising an amino acid sequence that is at least 85% identical to SEQ ID NO:2.

Images