Pancreatic stem cell composition for treating diabetes and preparation method thereof

Abstract

The present invention provides a pancreatic stem cell composition for treating diabetes and a preparation method thereof. Specifically, the present invention provides an inhibitory peptide that specifically inhibits CD3, which can significantly reduce the blood sugar level of diabetic mice, increase the amount of liver glycogen, and increase the weight of mice after being used in combination with pancreatic stem cells, and has a good effect in treating diabetes.

Description

Technical Field

[0001] The present application relates to the biological field, and specifically to a pancreatic stem cell composition for treating diabetes and a preparation method thereof. Background Art

[0002] Diabetes is a chronic disease that affects more than 460 million people worldwide. It is estimated that there are more than 113.9 million diabetics and 493.4 million prediabetics among adults over 20 years old in China. In other words, the development trend of diabetes is getting worse and worse, just like the flu, and the diabetic reserve army is also increasing significantly. The global incidence of type 1 diabetes is increasing at a rate of 3-4% per year. The epidemiological survey in China found that the total incidence of type 1 diabetes is 1.01 per 100,000 person-years, with the highest incidence in the 10-14 age group. The natural course of type 1 diabetes mainly includes the following three characteristics: chronic process, hidden progression, and acute onset. Among them, T / B cell-mediated autoimmune damage to pancreatic β cells is the main pathophysiological feature of type 1 diabetes. More and more studies have found that immunotherapy can delay the failure of pancreatic β cells to a certain extent, and is expected to achieve the cure of type 1 diabetes after stem cell therapy.

[0003] According to the characteristics of autoimmunity in type 1 diabetes, the current targets of immunotherapy for type 1 diabetes are mainly concentrated in three areas: T cells, B cells and cytokines. Targeted T cell immunotherapy for type 1 diabetes. Anti-CD3 monoclonal antibodies can inhibit autoimmunity by shielding the CD3 / TCR complex, inducing CD3 / TCR complex internalization and T cell anergy, inducing T cell apoptosis, activating the TGF-β pathway, and thus inducing Treg cells. Studies have found that the anti-CD3 monoclonal antibody teplizumab can effectively inhibit autoimmune destruction of pancreatic β cells, improve metabolism, and reduce insulin doses. Afacept is an anti-CD2 fusion protein that can block T cell activation and induce memory Teff apoptosis. After two courses of afacept treatment, the area under the C-peptide curve in patients with type 1 diabetes was significantly higher than that in the control group, and the insulin dosage and incidence of hypoglycemia were lower than those in the control group. There was no difference in adverse reactions between the two groups. Abatacept is a fusion protein that selectively regulates the costimulatory signal required for T cell activation. It is composed of the extracellular domain of cytotoxic T lymphocyte antigen 4 and the Fc region of IgG1. It binds to CD80 and CD86 on APCs, blocking the interaction between the two and CD28 on T cells, thereby inhibiting T cell activation. It is widely used to treat autoimmune diseases. A study evaluated the role of abatacept in patients with recent type 1 diabetes. The results showed that compared with the placebo group, the rate of decline of C-peptide in the treatment group was delayed, and abatacept slowed the decline of pancreatic β-cell function. However, abatacept did not significantly improve the dosage of insulin, and patients in clinical trials failed to get rid of insulin. ATG is a class of polyclonal antibodies prepared by immunizing animals with human thymocytes or T cells, and is used as an immunosuppressant in organ transplantation. A clinical trial used a higher dose of ATG (6.5 mg / kg) to treat patients with type 1 diabetes. After one year, no significant difference was found between the treatment group and the placebo group. The effectiveness of ATG in treating type 1 has not been verified. However, in the 2-year follow-up, it was found that the C-peptide decline rate of the older subgroup of patients in the ATG group was slower, and ATG retained its C-peptide secretion. Targeted B cell immunotherapy for type 1 diabetes. It is currently believed that targeting B cells can treat type 1 diabetes by activating the ADCC response of complement and NK cells, activating macrophages, interacting with lipid rafts and directly activating apoptosis. Clinical studies have found that rituximab, an anti-CD20 monoclonal antibody targeting B cells, can effectively delay the decline of C-peptide in patients with type 1 diabetes and improve blood sugar levels. Targeting inflammatory factors to treat type 1 diabetes, golimumab is a humanized anti-TNF-α monoclonal antibody that can treat a variety of autoimmune diseases in adults and children. A small sample study of newly diagnosed type 1 diabetes patients showed that golimumab can promote the production of endogenous insulin and reduce the use of exogenous insulin.

[0004] At present, immunotherapy for type 1 diabetes has developed a variety of drugs mainly around the above targets, and more and more clinical studies have found that targeted immunotherapy can protect the function of pancreatic beta cells in patients with type 1 diabetes to a certain extent and slow down the damage caused by the disease. However, immunotherapy for type 1 diabetes also faces the effects of single-treatment medication and high long-term treatment costs. Therefore, developing immunotherapy for type 1 diabetes combined with other treatment methods is an important research direction. Summary of the invention

[0005] The present invention provides an immunotherapy method for type 1 diabetes, and specifically provides a new inhibitory polypeptide specifically targeting CD3 for the treatment of type 1 diabetes.

[0006] Furthermore, the amino acid sequence of the CD3 inhibitory peptide is shown in SEQ ID NO:1.

[0007] It is well known in the art that inhibiting CD3 activity can promote the proliferation of mature thymocytes, especially T cells. Conversely, inhibiting CD3 activity can inhibit the proliferation of immature thymocytes and promote apoptosis. The CD3 inhibitory peptide of the present invention can promote apoptosis of immature thymocytes.

[0008] Furthermore, the CD3 inhibitory peptide of the present invention may also be modified or altered.

[0009] Furthermore, a peptide consisting of an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 by deleting, substituting, inserting or adding one or more amino acids.

[0010] In the present invention, "a plurality of amino acids" may be, for example, 2 or 3 amino acids, more preferably, 2 amino acids. In embodiments where amino acids are substituted, preferred substitutions are substitutions of one amino acid with another amino acid having the same properties as the one amino acid, for example, substitution of one amino acid with another amino acid having the same side chain functional group as the one amino acid (e.g., Arg is substituted with Lys, Asp is substituted with Glu); and substitution of one hydrophobic amino acid with another hydrophobic amino acid (e.g., Val is substituted with Ile).

[0011] In another aspect, the present invention also provides use of a CD3 inhibitory peptide in preparing a reagent for inhibiting apoptosis of immature thymocytes.

[0012] In another aspect, the present invention also provides use of a CD3 inhibitory peptide in the preparation of a drug for treating type 1 diabetes.

[0013] In addition, in another aspect, the present invention also provides the use of CD3 inhibitory peptide and pancreatic stem cells in the preparation of a pharmaceutical composition for treating type 1 diabetes.

[0014] The pancreatic islet stem cells are Nestin-positive pancreatic islet stem cells separated from pancreatic islets.

[0015] The Nestin-positive pancreatic stem cells can be cultured in a cell culture medium.

[0016] The term "cell culture medium" (also referred to herein as "culture fluid" or "culture medium") is a culture medium for culturing cells, which contains nutrients to maintain cell viability and support proliferation. The cell culture medium may contain any of the following in appropriate combinations: salts, buffers, amino acids, glucose or other sugars, antibiotics, serum or serum replacements, and other components, such as peptide growth factors, etc. The cell culture medium commonly used for a particular cell type is known to those skilled in the art. Exemplary basal culture media used herein include DMEM / F-12 (Dulbecco's Modified Eagle Medium / Nutrient Mixture F-12; available from Thermo Fisher Scientific). The basal culture medium may be supplemented with one or more of the following: a suitable buffer (e.g., HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)), chemically defined supplements such as N2 (0.1-10%, e.g., 1%) and B27 (0.1-10%, e.g., 1%) serum-free supplements (available from Thermo Fisher Scientific), antibiotics such as penicillin / streptomycin (0.1-10%, e.g., 1%), MEM non-essential amino acids (Eagle's Minimum Essential Medium (MEM), which consists of a balanced salt solution, amino acids, and vitamins that are essential for the growth of cultured cells and And when supplemented with non-essential amino acids, MEM non-essential amino acid solution is produced), glucose (0.1-10%, such as 0.30%), L-glutamine (e.g., GlutaMAXTM), ascorbic acid and / or DAPT (N-[N-(3,5-difluorophenylacetyl)-l-alanyl]-S-phenylglycine tert-butyl ester). Differentiation-inducing factors such as Wnt agonists disclosed herein, such as CHIR99021, or Wnt substitutes, such as NGS, TGF-β pathway inhibitors, such as SB431542 or A83-01, Rho-ROCK pathway inhibitors, such as Y27632, Bmp inhibitors, such as Noggin, EGF (epidermal growth factor), insulin transferrin selenium mixture (ITS, available from Sigma), FGF2 (fibroblast growth factor 2), heparin, Y27632 and B27 can also be added to the culture medium.

[0017] Pharmaceutical Compositions and Pharmaceutical Kits "Pharmaceutical composition" refers to a pharmaceutical preparation for use in humans or animals. The pharmaceutical composition comprises a polypeptide of the invention and a suitable formulation of a carrier, stabilizer and / or excipient. The invention provides pharmaceutical preparations comprising a polypeptide of the invention. To prepare a pharmaceutical composition or sterile composition, the polypeptide is mixed with a pharmaceutically acceptable carrier or excipient. Formulations of therapeutic and diagnostic drugs in the form of, for example, lyophilized powders, slurries, aqueous solutions or suspensions can be prepared by mixing with physiologically acceptable carriers, excipients or stabilizers.

[0018] The composition contains a pharmaceutically effective amount of the polypeptide of the present invention and a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" as used herein means that when the molecular entity and the composition are properly administered to an animal or a human, they will not produce adverse, allergic or other adverse reactions. The "pharmaceutically acceptable carrier" used herein should be compatible with the mutant protein of the present invention, that is, it can be mixed with it without significantly reducing the effect of the pharmaceutical composition under normal circumstances. Specific examples of some substances that can serve as pharmaceutically acceptable carriers or their components are sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose and methylcellulose; tragacanth powder; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyols, such as propylene glycol, glycerol, sorbitol, mannitol and polyethylene glycol; alginic acid; emulsifiers, such as Tween; wetting agents, such as sodium lauryl sulfate; colorants; flavorings; tableting agents, stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic saline solution; and phosphate buffer, etc.

[0019] Beneficial Effects

[0020] The present invention provides a pancreatic stem cell composition for treating diabetes and a preparation method thereof. Specifically, the present invention provides an inhibitory peptide that specifically inhibits CD3, which can significantly reduce the blood sugar level of diabetic mice, increase the amount of liver glycogen, and increase the weight of mice after being used in combination with pancreatic stem cells, and has a good effect in treating diabetes. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Effect of CD3 inhibitory peptide on thymocyte apoptosis rate

[0022] Figure 2 Effects of each treatment group on the liver glycogen content of mice DETAILED DESCRIPTION

[0023] The specific embodiments of the present invention will be described in more detail below with reference to the accompanying drawings. Although the specific embodiments of the present invention are shown in the accompanying drawings, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided in order to enable a more thorough understanding of the present invention and to enable the scope of the present invention to be fully communicated to those skilled in the art.

[0024] Example 1 Screening of inhibitory peptides that specifically inhibit CD3

[0025] According to the conventional peptide screening method, CD3 recombinant protein (ab220543) was coated on a 96-well plate, and T7 phage (KMD Bioscience, catalog number PLG102) was added the next day and incubated at room temperature for 30 minutes. After rinsing with TBST, the phage bound to the CD3 recombinant protein was incubated at room temperature for 10-20 minutes with T7 phage elution solution to elute the phage, which was added to 8 ml of shaken BLT5403 host bacteria (Novagen) and shaken at 37°C until lysis. The phage screening process was repeated five times. After the above five rounds of phage screening, 50 plaques were randomly selected for amplification, and primers (upstream primer GGAGCTGTCGTATTCCAGTC, downstream primer TAAACGGGTCTTGAGGGGTT) were used for PCR amplification and sequencing analysis. After identification, a repeated DNA sequence was obtained, which was translated into an amino acid sequence as shown in SEQ ID NO: 1. The molecular formula of the polypeptide (named CD3 inhibitory peptide) is: C 518 H 771 N 149 O 130 S5, molecular weight: 11325.909.

[0026] The CD3 inhibitory peptide obtained by artificial synthesis screening of the above polypeptide was synthesized by solid phase synthesis (commissioned to Nanjing Taopu Biotechnology Co., Ltd. for synthesis), with a synthesis purity of >96%, and was subjected to high performance liquid chromatography (HPLC) and mass spectrometry (MS) analysis. The purified liquid was then placed in a freeze dryer for concentration and freeze-dried into powder for subsequent experiments.

[0027] According to the conventional experimental method, CD3 recombinant protein was prepared to a concentration of 10 μg / ml, pre-enriched on the CM5 chip, set the flow rate to 10 μl / min, the injection time to 120 s, and used 50 mM NaOH as the cleaning solution, regenerated for 30 s. According to the molecular weight of CD3 recombinant protein, CD3 inhibitory peptide and rat anti-mouse CD3 monoclonal antibody (BioLab, catalog number GH0619-YXO), the target response value of coupling protein (ligand protein) to the chip was calculated according to the formula RU = 150 * ligand protein response value / analyte protein response value. The coupling reagent EDC (concentration 0.4M) and NHS (concentration 0.1M) were mixed in a volume ratio of 1:1 to activate the surface of the CM5 chip. CD3 recombinant protein was centrifuged at 10000 rpm for 8 minutes to remove bubbles, injected for coupling, and then ethanolamine was used to block excess activation sites. CD3 antibody was dissolved in HEPES buffer and diluted to gradient concentrations. After centrifugation, bubbles were removed and injected for detection. BiacoreEvaluation Software was used to analyze the data, fit the curve, and calculate the affinity KD value of the protein interaction. Similarly, Limphotin peptide was dissolved in HBS buffer containing 1% DMSO, coupled to a CM5 chip, and injected with CD3 recombinant protein for detection. The results are shown in Table 1.

[0028] Table 1 Affinity test results of CD3 inhibitory peptides

[0029] name Affinity results (KD) CD3 inhibitory peptide 1.84nM

[0030] As can be seen from Table 1, SPR detection shows that the CD3 inhibitory peptide has a strong affinity with the CD3 molecule.

[0031] Example 2 Functional Identification of CD3 Inhibitory Peptides

[0032] C57BL / 6 mice (Changzhou Cavens Laboratory Animal Co., Ltd.) were routinely cultured until 10 days after birth. The mice were killed by cervical dislocation, and the thymus was removed aseptically. The cell suspension was quickly prepared with DMEM high-glucose complete medium (containing 20% ​​FBS) and the cell concentration was adjusted to 1×10 8 / ml. The cells were placed in DMEM high-glucose complete medium containing different final concentrations of peptides, and cultured at 37°C, 5% CO2 for 12 hours before apoptosis analysis. The experimental groups were added with different dilutions of CD3 inhibitory peptides (final concentrations were 50μg / mL, 100μg / mL, 200μg / mL, and 500μg / mL), the control group was not added with peptides, and the positive control group was rat anti-mouse CD3 monoclonal antibody (the concentration used was 50μg / mL, Biolabs, catalog number GH0619-YXO). 1×10 samples were collected from each group. 6Cells were washed twice with ice-cold PBS, fixed with 70% cold ethanol, and stored at 4°C. Before staining, cells were suspended in PBS, RNase was added to a final concentration of 50μg / ml at room temperature for 30 minutes, and then Propidium iodide was added to a final concentration of 50μg / ml. At room temperature and away from light for 30 minutes, the cells were measured on the computer. Observe whether the AP peak, which is unique to apoptosis, appears before the G peak, and calculate the percentage of the cells in the total cells, i.e. the percentage of apoptosis. The results are shown in Figure 1 shown.

[0033] from Figure 1 It can be seen that with the increase of polypeptide concentration, the apoptosis rate of thymocytes is gradually improved, reaching a maximum of 33.5% apoptosis rate. Compared with the positive control group, the inhibitory effect is more obvious. This also fully illustrates that the CD3 inhibitory peptide can inhibit the proliferation of immature thymocytes (10d mice, thymocytes are immature, so they are immature thymocytes) by inhibiting the CD3 activity in thymocytes, and promote apoptosis, which shows that the CD3 inhibitory peptide of the present invention has good biological activity.

[0034] Example 3 Preparation of pancreatic stem cells

[0035] Three C57BL / 6 mice aged 6 to 8 weeks were selected as donors to isolate pancreatic stem cells. After intraperitoneal injection of 1% sodium pentobarbital, a midline incision was made, the pancreatic duct was ligated and injected into the end of the duodenum, and the mice were killed. 10 ml of Hank's solution containing 0.5 mg / ml collagenase P was slowly injected into the common bile duct to slowly expand the pancreas in situ. Subsequently, the pancreas was quickly separated along the intestinal wall, and the pancreas was placed in a 37°C water bath for static digestion for 18 minutes; the pancreas was taken out and vigorously shaken for 1 minute to disperse it into a fine sand state, and 10 times the volume of 4°C pre-cooled Hank's solution (containing 10% fetal bovine serum) was immediately added to terminate the digestion. Filter, centrifuge at 4°C 700×g for 3 minutes, remove the supernatant, and then wash twice with 4°C Hank's solution. Add 4 ml of 1.1 g / ml purification solution to all the isolated islet sediments, mix thoroughly, then slowly add 1.096 g / ml (2 ml) and 1.066 g / ml (2 ml) purification solutions in turn, centrifuge horizontally at 700×g for 18 minutes, absorb the cells on the interface of 1.066-1.096 g / ml and 1.096-1.100 g / ml, wash 3 times with Hank's solution, collect the cells, use immunomagnetic beads to sort Nestin+ cells in islet cells, and use Hank's solution suspension cell culture to proliferate Nestin+ cells. After proliferation, use RT-PCR to detect the expression of Nestin gene. Compared with the unsorted ones, the expression of Nestin gene increased from 5.8% to 96.8%, indicating that Nestin+ islet stem cells were isolated and prepared. DTZ staining was used to identify them as islet-like cells.

[0036] Example 4 Experiment on the treatment of type 1 diabetes in mice using CD3 inhibitory peptide and pancreatic stem cells

[0037] Establishment of type 1 diabetes mouse model: After 7 days of adaptive feeding, 10 mice were randomly selected as the blank group (NC); the remaining mice were fasted for 12 hours, but not water-deprived, and STZ150 mg / kg body weight was injected intraperitoneally to induce type 1 diabetes mouse model. During the modeling period, the mice were free to eat and drink water. On the third day after modeling, the mice were fasted for 10 hours and the tails were cut to collect blood for determination of fasting blood glucose (FBG). When the FBG value was >11.1mmol / L (200mg / 100mL), the modeling was considered successful.

[0038] The mice with successful modeling were randomly divided into model group (MC), positive group (PC), inhibitory peptide group (TS), stem cell group (CS), inhibitory peptide and stem cell combined treatment group (TCS). The model group and blank group were gavaged with 0.1 mL / 10 g body weight sodium citrate buffer; the positive group was gavaged with 0.1 mL / 10 g body weight dimethyl biguanide hydrochloride solution (1% dimethyl biguanide hydrochloride); the inhibitory peptide group was gavaged with 0.1 mL / 10 g body weight CD3 inhibitory peptide (1% polypeptide solution). The stem cell group was injected with 0.1 mL (1×10 4 The inhibitory peptide and stem cell combined treatment group was gavaged with 0.1 mL / 10 g body weight of CD3 inhibitory peptide (1% peptide solution), while the stem cell group was injected with 0.1 mL (1×10 4 Each group was administered once on the 1st day, the 7th day, the 14th day, the 21st day, and the 28th day. Before administration on the 1st day, blood glucose and body weight were measured, and after administration on the 28th day, fasting blood glucose and body weight were measured 1 week later. The results of blood glucose changes are shown in Table 2.

[0039] Table 2 Changes of blood sugar in each group before treatment

[0040]

[0041]

[0042] As can be seen from Table 2, compared with the blank group, the FBG value of the model group was significantly increased, and the difference was extremely significant (P < 0.01), indicating that the pancreatic islet cells of diabetic mice induced by STZ were severely damaged, resulting in increased blood sugar. After 4 weeks of continuous treatment, the FBG values ​​of the positive group and the three treatment groups continued to decrease, especially after the 4th week, compared with the model group, the difference was extremely significant (P < 0.01). It can also be seen from Table 2 that the inhibitory peptide has a good effect of lowering blood sugar whether used alone or in combination with stem cells, and has broad prospects for therapeutic application.

[0043] In addition, the changes in the weight of mice in each group were also detected. After 4 weeks of treatment, the body weight of mice in the blank group showed an obvious upward trend, and the body weight of the model group decreased by 12.01% compared with the blank group, showing a very significant decrease (P < 0.01); compared with the model group, the body weight of mice in the positive group and the three treatment groups (corresponding to the inhibitory peptide group, stem cell group and TCS group, respectively) showed a slow upward trend, with significant differences (P < 0.05), and the growth rates were 3.05% (PC), 6.89% (TC), 5.56% (CS), and 9.17% (TCS), respectively. This shows that the treatment group can promote the absorption and utilization of glucose, reduce energy loss, and thus restore the weight of mice.

[0044] Since glycogen content is closely related to the development of diabetes, the liver glycogen content of each group of mice was also tested. Specifically, the mice in each group were killed by dislocation of the neck, and their livers were dissected and removed. The livers were rinsed with saline and the surface moisture of the livers was dried with absorbent paper. The mouse liver glycogen (Glycogen) ELISA kit (Shanghai Fantai Biotechnology Co., Ltd.) was used according to the instructions. The specific results are as follows Figure 2 shown.

[0045] Depend on Figure 2 It can be seen that compared with the blank group, the model group had a very significant decrease in liver glycogen content (P < 0.01), which was 51.08% of the blank group, indicating that the liver of the model group mice was damaged and the ability to synthesize glycogen was weakened. The liver glycogen content of the positive group and the three treatment groups was significantly higher than that of the model group (P < 0.01), especially the liver glycogen content of the TCS group was (19.2 ± 1.0) mg / g, and the treatment effect was significant. Each treatment group and the positive group can increase the liver glycogen synthesis ability of diabetic mice, reduce the decomposition of liver glycogen, and inhibit the increase of blood sugar levels. From the above results, it can be seen that the inhibitory peptides and stem cells of the present invention have a good effect in treating type 1 diabetes.

[0046] Although the embodiments of the present invention are described above in conjunction with the accompanying drawings, the present invention is not limited to the above specific embodiments and application fields, and the above specific embodiments are only illustrative and instructive, rather than restrictive. A person of ordinary skill in the art can also make many forms under the guidance of this specification and without departing from the scope of protection of the claims of the present invention, all of which belong to the protection of the present invention.

Claims

1. A CD3 inhibitory peptide, characterized in that The amino acid sequence of the inhibitory peptide is shown in SEQ ID NO:

1.

2. Use of the CD3 inhibitory peptide according to claim 1 in the preparation of a drug for treating type 1 diabetes.

3. Use of the CD3 inhibitory peptide and Nestin-positive pancreatic stem cells as claimed in claim 1 in the preparation of a pharmaceutical composition for treating type 1 diabetes.

4. The use according to claim 3, wherein the Nestin-positive pancreatic stem cells are Nestin-positive pancreatic stem cells separated from pancreatic islets.

Images