Strain for promoting agilawood formation, culture method and application thereof

Abstract

The invention discloses absidia GXU-F34 for promoting agilawood formation, the absidia GXU-F34 is obtained by intercepting a sample from an ancient tree and purifying and separating, and the absidia GXU-F34 can be used for promoting agilawood formation of aquilaria sinensis. The absidia GXU-F34 is a plant endophyte and can continuously generate some enzymes so as to stimulate a defense system of agilawood plants, a series of enzymes generated by saprophytic fungus microorganisms play an important role in a defense mechanism of the agilawood plants, and finally agilawood is generated.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a strain for promoting agarwood formation, a cultivation method and applications thereof. Background Art

[0002] At present, artificial agarwood formation technology mainly includes physical injury methods such as cutting and nailing, chemical induction methods such as injecting chemical reagents, and artificial inoculation methods using microorganisms as inducers. The physical injury method takes a long time to induce, and the chemical injury method has the disadvantages of chemical reagents polluting the environment and excessively damaging the tree. Many studies have shown that microorganisms play an important role in the formation of agarwood, and fungal agarwood formation technology has become one of the research hotspots.

[0003] In order to alleviate the shortage of agarwood resources, it is of great significance to find strains that can effectively promote the production of high-quality agarwood. Summary of the invention

[0004] The main purpose of the present invention is to provide a strain, a cultivation method and application thereof for promoting the formation of agarwood, so as to provide the market with fungi that promote the formation of agarwood.

[0005] In order to achieve the above object, the present invention adopts the following technical solution:

[0006] A strain that promotes the formation of agarwood. The strain is preserved under the name of Absidia sp. GXU-F34, and was deposited in the China Center for Type Culture Collection on August 3, 2023. The deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: M20231392.

[0007] The present invention also provides a method for culturing the strain, which comprises the following steps:

[0008] S1: Samples were cut from ancient trees, disinfected on the surface, cut into small pieces, placed in sterilized EP tubes and stored at -80°C;

[0009] S2: Rinse the obtained sample under running tap water to remove dust and stains on the surface, and then disinfect the surface with 15% hydrogen peroxide and 75% alcohol respectively. After disinfection, rinse with sterile water 2-3 times, and use sterile filter paper to absorb the surface moisture after rinsing;

[0010] S3: The sample processed in S2 is cultured in a liquid culture medium by using a plug culture method or a liquid culture spreading method to grow bacterial colonies;

[0011] S4: Use a sterile inoculation loop to pick different colonies grown in the culture medium and inoculate them into the corresponding solid culture medium. After culturing in a constant temperature incubator at 28±1℃ for 3-5 days, purify and isolate the strain.

[0012] Furthermore, the samples were taken from roots, leaves, trunk epidermis and xylem tissue 2.0 to 3.0 cm below the epidermis of ancient trees with obvious lesions.

[0013] Furthermore, the strain was stored in a -80°C refrigerator using 20% ​​glycerol.

[0014] The strain provided by the invention is used in promoting the formation of fragrance of white agarwood.

[0015] The advantages of the present invention are that the Absidia spp. GXU-F34 of the present invention is a plant endophyte, which can continuously produce some enzymes to stimulate the defense system of the Aquilaria plant. The series of enzymes produced by saprophytic fungal microorganisms play an important role in the defense mechanism of the Aquilaria plant, and ultimately lead to the production of agarwood. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the colony picture of Absidia sphaerocephala GXU-F34 cultured in Congo red medium and trypan blue medium for 14 days;

[0017] Figure 2 is a microscopic image of Absidia spp. GXU-F34 cultured in PDA medium containing 0.1% benzyl acetone for 10 days;

[0018] Figure 3 is a microscopic image of Absidia spp. GXU-F34 cultured in PDA medium for 10 days;

[0019] Figure 4 This is the phylogenetic tree of ITS genes of Absidia spp. GXU-F34;

[0020] Figure 5 It is the colony morphology of Absidia spp. GXU-F34 cultured on solid medium for 1-7 days;

[0021] Figure 6 It is a structural schematic diagram of an intravenous injection inoculation device;

[0022] Figure 7 This is a picture of the intravenous injection vaccination site;

[0023] Figure 8 This is a picture of the fragrance formation of Aquilaria sinensis four months after inoculation with Absidia spp. GXU-F34. DETAILED DESCRIPTION

[0024] In order to make the objectives, technical solutions and beneficial effects of the present invention more clear, the preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings to facilitate understanding by technicians.

[0025] The culture media used in this embodiment include PDA culture medium, SMA culture medium, MEA culture medium, benzyl acetone screening experiment culture medium, liquid enzyme production culture medium, laccase (Lac) enzyme activity test culture medium, lignin peroxidase (Lip) test culture medium, manganese peroxidase (Mnp) test culture medium, Congo red culture medium and trypan blue culture medium, and each culture step and experimental test uses the corresponding culture medium.

[0026] The strain for promoting agarwood formation of the present invention is deposited under the name of Absidia spp. GXU-F34, and was deposited in the China Center for Type Culture Collection on August 3, 2023, with a deposit number of CCTCC NO: M20231392.

[0027] The method for culturing the strain comprises the following steps:

[0028] S1: Samples were cut from ancient trees, disinfected on the surface, cut into small pieces, and placed in sterilized EP tubes and stored at -80°C. The cutting parts of ancient trees were roots, leaves, trunk epidermis, and wood tissue 2.0 to 3.0 cm below the epidermis with obvious lesions. After cutting, they were cut into small pieces of 0.5 cm × 0.2 cm.

[0029] S2: Rinse the obtained sample under running tap water to remove dust and stains on the surface, and then use 15% hydrogen peroxide and 75% alcohol to disinfect the surface respectively. After disinfection, rinse with sterile water 2-3 times, and use sterile filter paper to absorb the surface moisture after rinsing.

[0030] S3: The sample processed in S2 is cultured in a liquid culture medium by using a plug culture method or a liquid culture spreading method to grow bacterial colonies;

[0031] S4: Use a sterile inoculation loop to pick different colonies grown in the culture medium and inoculate them into the corresponding solid culture medium. After culturing in a constant temperature incubator at 28±1℃ for 3-5 days, purify and separate the strains. The obtained strains are stored in a -80℃ refrigerator with 20% glycerol for subsequent use.

[0032] The plug culture method is to cut off the surface of the disinfected sample with a sterile scalpel, cut it into uniform small pieces of about 5 mm, insert them into corresponding culture media respectively, make the cross section fully contact with the culture media, add 50 mg / L ampicillin and 50 mg / L kanamycin to the fungal culture media, and place it in a constant temperature incubator at 25±1°C for 2-10 days.

[0033] The liquid culture coating method is to cut off the surface of the sterilized sample with a sterile scalpel, cut it into uniform small pieces of about 5 mm, grind it slightly with a sterile mortar, expose the inside of the sample, and then inoculate it into the corresponding liquid culture medium, and culture it in a shaking incubator at 30±1℃ for 1-3 days. When the culture medium becomes turbid, dilute the culture medium to 10 -4 Times and 10 -5 times, spread in the corresponding culture medium, and culture in a constant temperature incubator at 30±1℃ for 2-10 days.

[0034] Gene sequencing analysis of Absidia spp. GXU-F34

[0035] After culturing the Absidia GXU-F34 fungus on the culture medium for a period of time, scrape about 1g of mycelium from the plate and place it in a 1.5mL centrifuge tube. Use a DNA extraction kit to extract the DNA of endophytic fungi, and use it as a template to amplify the ITS sequence of the strain using fungal universal primers: ITS-4F (TCCTCCGCTTATTGATATGC) and ITS-5R (GCAAGTAAAAGTCGTAACAAGG). PCR reaction system (50μL system): Taq DNA Polymerase 0.5μL, ITS-4F and ITS-5R 4μL each, template DNA 9μL, double distilled water to 50μL. The amplification program is: 95℃5min; 94℃30s, 50℃1min, 72℃1min, 35 cycles; 72℃10min; the amplified product is detected by 1.5% agarose gel electrophoresis, and the amplified product that meets the requirements is sequenced.

[0036] The sequences were screened according to their peak plots, and the sequences that met the requirements were searched and compared using the BLAST tool at NCBI (https: / / www.ncbi.nlm.nih.gov / ), and sequences with a similarity of more than 98% were selected as reference sequences.

[0037] Analysis on the enzyme production ability and benzyl acetone tolerance of Absidia spp. GXU-F34

[0038] Benzyl acetone is one of the characteristic substances of agarwood. The ability of fungi to promote the formation of agarwood was preliminarily evaluated by combining the tolerance to benzyl acetone with the ability of strains to produce lignin-degrading enzymes.

[0039] The fungi that have been cultured for 3-4 days and whose colonies occupy 1 / 2 to 2 / 3 of the area of ​​a 90 mm culture dish are used as inoculation bacteria. Under a sterile environment, some mycelium is picked out and inoculated into a PDA medium containing 0.1% benzyl acetone. The control group is inoculated into a PDA medium without benzyl acetone. Three parallels are made for each experimental unit and cultured in a constant temperature incubator at 25°C for 10 days. The pictures obtained by taking pictures are processed using imageJ, and the diameters of the colonies are measured respectively. Finally, Congo red medium is used to test whether the strain produces cellulase; trypan blue medium is used to test whether the strain produces amylase.

[0040] According to the experimental results, the colony morphology of Absidia spp. GXU-F34 on Congo red medium and trypan blue medium was inhibited by the colony morphology of Absidia spp. GXU-F34 on PDA, and the growth rate was not significantly inhibited, but no hydrolysis circle was produced, indicating that GXU-F34 did not produce cellulase or amylase. Figure 1 As shown, Figure A is a Congo red culture medium colony map, and Figure B is a trypan blue culture medium colony map.

[0041] The prepared PDA culture medium was sterilized at 121°C under high pressure and then cooled to 50-60°C. In a sterile environment, the purchased benzyl acetone reagent was filtered through a 0.22 μm filter membrane; the filtered benzyl acetone was added to the cooled culture medium, the culture medium was quickly mixed, and poured into a 90 mm culture dish to obtain a PDA culture medium containing 0.1% benzyl acetone.

[0042] Microscopic image of Absidia spp. GXU-F34 under the stress of 0.01% benzyl acetone Figure 2 As shown in the figure (A is a ruptured sporangium, B is a spore and sporangium, C is the root of the mycelium, D is a sporangium, E is a mycelium, and F is a mycelium), compared with the microscopic image of Absidia spp. GXU-F34 in PDA medium, as shown in the figure Figure 3 As shown (in the figure, A, B, G, and H are sporangia and sporangiophores; E and F are ruptured sporangia and spores; C and D are roots of mycelium). The results showed that the growth rate of Absidia pulex GXU-F34 was not significantly restricted under the stress of 0.01% benzyl acetone, and there was no obvious change in the microstructure, and there was no obvious secretion. The spore-forming structure was intact and the spore morphology was not affected, indicating that Absidia pulex GXU-F34 had a high tolerance to benzyl acetone, and it was speculated that it had a significant ability to promote fragrance formation.

[0043] Morphological and molecular identification of GXU-F34

[0044] Microscopic images such as Figure 3As shown, the sporangium is long, smooth, occasionally meridian, 60.24±3.051μm in length and 3.272±0.7947μm in diameter; the funnel-shaped phialid, the sporangium is round, 25.77±0.3864μm in diameter and relatively smooth on the surface, and the spores are oval capsules, 2.469±0.6729μm in diameter and smooth on the surface. There are meridians at the root of the hyphae, with a diameter of 5.250±0.8485μm. The strain was then sequenced by ITS sequence and phylogenetic analysis was performed. Figure 4 Based on the morphological and molecular data, GXU-F34 was considered to be a new species of Absidia spp.

[0045] The strain is used in promoting the formation of Aquilaria sinensis.

[0046] The colony morphology of GXU-F34 on days 1-7 after activation using PDA medium. Figure 5 (A: Day 1, B: Day 2, C: Day 3, D: Day 4, E: Day 5, F: Day 6, G: Day 7, H: 4 days of culture on PDA medium). After 7 days of culture on solid medium, pick the mycelium and inoculate it into a 250ml conical flask containing 100ml PDB medium, culture for 2-3 days, obtain the seed liquid, transfer it to a 250ml conical flask containing 100ml PDB for expansion culture, the inoculation amount is 5%, and culture for 3 days for use. After the culture is completed, centrifuge the bacterial liquid at low speed, pour out part of the culture medium, and collect the bacterial bodies for use.

[0047] The inoculated trees were Aquilaria sinensis, located in the state-owned Qinlian Forest Farm in Qinzhou City, Guangxi Zhuang Autonomous Region. The Aquilaria sinensis trees on site were all 7-10 years old. Ten plants with no obvious surface damage were randomly selected as the test trees. Figure 6 The intravenous drip inoculation device shown in the figure is used to dilute bacteria to a final concentration of OD600 = 0.3, and fungi to a dry weight of 3% of the bacterial solution. The tree is drilled with an electric drill, and the hole diameter is φ = 3mm; the inoculation bottle is pressurized to 1.5Mpa, and the inoculation bottle is suspended at a high place, and inoculated using the intravenous drip inoculation device. The inoculation situation is shown in the figure. Figure 6 shown.

[0048] Four months after inoculation, the bark of the inoculated Aquilaria sinensis tree was scratched until discolored wood was seen. The tree body after the bark was scratched was photographed and analyzed, and the discolored part was dug out until the tree body itself contained no or a small amount of discolored tissue. The obtained tissue was photographed and the range of the agarwood was measured and analyzed using the software ImageJ. Figure 7 The results showed that Absidia spp. GXU-F34 had a higher ability to promote the fragrance production of Aquilaria plants.

[0049] Although the specific embodiments of the present invention have been described and illustrated in detail above, it should be noted that various changes and modifications may be made to the above embodiments without departing from the spirit of the present invention and the scope of the appended claims.

Claims

1. A strain that promotes the formation of agarwood, characterized in that: The strain is preserved under the name of Absidia spp. GXU-F34 and was deposited in the China Center for Type Culture Collection on August 3, 2023, with the deposit number of CCTCC NO: M20231392.

2. The method for culturing the strain according to claim 1, characterized in that: The culture method comprises the following steps: S1: Samples were cut from ancient trees, disinfected on the surface, cut into small pieces, placed in sterilized EP tubes and stored at -80°C; S2: Rinse the obtained sample under running tap water to remove dust and stains on the surface, and then disinfect the surface with 15% hydrogen peroxide and 75% alcohol respectively. After disinfection, rinse with sterile water 2-3 times, and use sterile filter paper to absorb the surface moisture after rinsing; S3: The sample processed in S2 is cultured in a liquid culture medium by using a plug culture method or a liquid culture spreading method to grow bacterial colonies; S4: Use a sterile inoculation loop to pick different colonies grown in the culture medium and inoculate them into the corresponding solid culture medium. After culturing in a constant temperature incubator at 28±1℃ for 3-5 days, purify and isolate the strain.

3. The method for culturing the strain according to claim 2, characterized in that: The samples are taken from roots, leaves, trunk epidermis and xylem tissue 2.0 to 3.0 cm below the epidermis of ancient trees with obvious lesions.

4. The method for culturing the strain according to claim 2, characterized in that: The strain was stored in a -80°C freezer using 20% ​​glycerol.

5. Application of the strain according to claim 1 in promoting the formation of fragrance of Aquilaria sinensis.

Images