Strain for promoting agarwood formation, culture method and application thereof

By using the Pterocaryonium GXU-F34 strain, the problems of long induction time and chemical damage in agarwood formation in existing technologies have been solved, achieving efficient and environmentally friendly agarwood formation.

CN119162002BActive Publication Date: 2026-01-13广西壮族自治区国有钦廉林场 +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411447591.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-16
Publication Date
2026-01-13
Estimated Expiration
2044-10-16

AI Technical Summary

Technical Problem

Existing artificial resin formation techniques suffer from problems such as long induction time and environmental pollution from chemical methods, and lack effective strains to promote resin formation in agarwood.

Method used

Using the strain GXU-F34 of *Aquilaria sinensis*, samples were taken from ancient trees, surface-sterilized, purified, isolated, cultured, and applied to *Aquilaria agallocha*. The enzymes produced by this strain stimulate the defense system of *Aquilaria* plants, promoting agarwood formation.

Benefits of technology

It effectively promotes agarwood formation in a short period of time, avoids chemical damage and environmental pollution, and improves the efficiency of agarwood formation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119162002B_ABST
    Figure CN119162002B_ABST
Patent Text Reader

Abstract

The application discloses a plough head mold GXU-F34 for promoting linaloe, and the plough head mold GXU-F34 is obtained by purifying and separating samples cut from old trees and can be used for promoting linaloe. The plough head mold GXU-F34 is a plant endophyte, can continuously produce some enzymes to stimulate the defense system of Aquilaria plants, and a series of enzymes produced by saprophytic fungi microorganisms play an important role in the defense mechanism of Aquilaria plants, and finally lead to the production of linaloe.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, and specifically relates to a strain that promotes agarwood formation, its cultivation method, and its application. Background Technology

[0002] Currently, artificial agarwood formation techniques mainly include physical methods such as cutting and nailing, chemical induction methods such as injecting chemical reagents, and artificial inoculation methods using microorganisms as inducing agents. Physical methods have long induction times, while chemical methods have drawbacks such as environmental pollution from chemical reagents and excessive damage to the tree. Multiple studies have shown that microorganisms play an important role in agarwood formation, making fungal agarwood formation technology a research hotspot.

[0003] To alleviate the shortage of agarwood resources, finding strains that can effectively promote agarwood formation is of great significance. Summary of the Invention

[0004] The main objective of this invention is to provide a strain, cultivation method and application method for promoting agarwood formation, so as to provide the market with fungi that promote agarwood formation.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A strain that promotes agarwood formation, named Absidia sp. GXU-F34, was deposited on August 3, 2023, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M20231392.

[0007] The present invention also provides a method for culturing a bacterial strain, the method comprising the following steps:

[0008] S1: After surface disinfection, samples are taken from ancient trees, cut into small pieces, and placed in sterile EP tubes for storage at -80°C.

[0009] S2: Rinse the obtained sample under running tap water to remove surface dust and dirt, and then disinfect the surface with 15% hydrogen peroxide and 75% alcohol respectively. After disinfection, rinse with sterile water 2-3 times, and then use sterile filter paper to dry the surface moisture.

[0010] S3: The samples treated in S2 are cultured in liquid culture medium using either the block culture method or the liquid culture spread method to grow colonies;

[0011] S4: Use a sterile inoculation loop to pick up different colonies that have grown in the culture medium and inoculate them into the corresponding solid culture medium. After culturing in a constant temperature incubator at 28±1℃ for 3-5 days, purify and isolate the strains.

[0012] Furthermore, the samples were taken from the roots, leaves, trunk bark, and xylem tissue 2.0–3.0 cm below the bark of the ancient tree with obvious lesions.

[0013] Furthermore, the strain was stored in a -80°C freezer using 20% ​​glycerol.

[0014] The strain provided by this invention is used to promote resin formation in Aquilaria sinensis.

[0015] The advantages of this invention are as follows: GXU-F34 of this invention is a plant endophytic fungus that can continuously produce some enzymes to stimulate the defense system of Aquilaria plants. A series of enzymes produced by saprophytic fungi play an important role in the defense mechanism of Aquilaria plants, ultimately leading to the production of aquilaria. Attached Figure Description

[0016] Figure 1 This is a colony diagram of *Pterocaryonium spp.* GXU-F34 cultured on Congo Red and Tylenol Blue agar plates for 14 days.

[0017] Figure 2 These are microscopic images of *Pterocaryonium* GXU-F34 cultured in PDA medium containing 0.1% benzylacetone for 10 days.

[0018] Figure 3 These are microscopic images of *Pterocaryonium* GXU-F34 cultured in PDA medium for 10 days.

[0019] Figure 4 It is a phylogenetic tree of ITS genes in 34 species of Pterocaryonium GXU-F34;

[0020] Figure 5 The colony morphology of *Pterocaryonium* GXU-F34 cultured on solid medium for 1-7 days;

[0021] Figure 6 This is a schematic diagram of the intravenous drip inoculation device;

[0022] Figure 7 These are photos of an intravenous drip injection procedure.

[0023] Figure 8 Image showing the resin formation of Aquilaria sinensis four months after inoculation with Pterocarya stenoptera GXU-F34. Detailed Implementation

[0024] To make the objectives, technical solutions, and beneficial effects of the present invention clearer, the preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings, so as to facilitate understanding by those skilled in the art.

[0025] The culture media used in this embodiment include PDA medium, SMA medium, MEA medium, benzylacetone screening experimental medium, liquid enzyme production medium, laccase (Lac) enzyme activity testing medium, lignin peroxidase (Lip) testing medium, manganese peroxidase (Mnp) testing medium, Congo red medium, and tyrosine blue medium. Each culture step and experimental test uses the corresponding culture medium.

[0026] The strain that promotes agarwood formation in this invention is known as *Pterocarya spp.* GXU-F34 and was deposited at the China Center for Type Culture Collection on August 3, 2023, with accession number CCTCC NO: M20231392.

[0027] The method for culturing the strain includes the following steps:

[0028] S1: Samples were taken from ancient trees, disinfected, cut into small pieces, and placed in sterile EP tubes for storage at -80℃. The parts of the ancient trees to be taken were the roots, leaves, bark of the trunk, and xylem tissue 2.0-3.0cm below the bark with obvious lesions. After taking the samples, they were cut into small pieces of 0.5cm×0.2cm.

[0029] S2: Rinse the obtained sample under running tap water to remove surface dust and dirt, then disinfect the surface with 15% hydrogen peroxide and 75% alcohol respectively. After disinfection, rinse with sterile water 2-3 times, and then use sterile filter paper to absorb the surface moisture.

[0030] S3: The samples treated in S2 are cultured in liquid culture medium using either the block culture method or the liquid culture spread method to grow colonies;

[0031] S4: Using a sterile inoculation loop, different colonies grown in the culture medium are picked up and inoculated into their respective solid culture media. After incubation at 28±1℃ for 3-5 days, the colonies are purified and isolated to obtain the bacterial strains. The obtained strains are stored in a -80℃ freezer using 20% ​​glycerol for subsequent use.

[0032] The insert culture method involves cutting off the surface of the sterilized sample with a sterile scalpel, cutting it into uniform small pieces of about 5 mm, and inserting them into the corresponding culture medium to ensure full contact between the cut surface and the culture medium. The fungal culture medium is supplemented with 50 mg / L ampicillin and 50 mg / L kanamycin, respectively, and then placed in a constant temperature incubator at 25±1℃ for 2-10 days.

[0033] The liquid culture plating method involves cutting off the surface of the sterilized sample with a sterile scalpel, cutting it into uniform small pieces of approximately 5 mm, lightly grinding them in a sterile mortar, exposing the interior of the sample, and then inoculating them into the corresponding liquid culture medium. The samples are then incubated on a shaker at 30±1℃ for 1-3 days. Once the culture medium becomes turbid, it is diluted to 10⁻⁶. -4 Double 10 -5 The sample was coated onto the corresponding culture medium and then incubated in a constant temperature incubator at 30±1℃ for 2-10 days.

[0034] Gene sequencing analysis of Pterocaryon GXU-F34

[0035] After culturing *Pterocarya spp.* GXU-F34 on the culture medium for a period of time, approximately 1g of mycelium was scraped from the plate and placed in a 1.5mL centrifuge tube. Endophytic fungal DNA was extracted using a DNA extraction kit. Using this DNA as a template, the ITS sequence of the strain was amplified using universal fungal primers: ITS-4F (TCCTCCGCTTATTGATATGC) and ITS-5R (GCAAGTAAAAGTCGTAACAAGG). The PCR reaction system (50μL system) consisted of: 0.5μL Taq DNA Polymerase, 4μL each of ITS-4F and ITS-5R, 9μL template DNA, and double-distilled water to a final volume of 50μL. The amplification program was: 95℃ for 5 min; 94℃ for 30 s, 50℃ for 1 min, 72℃ for 1 min, 35 cycles; 72℃ for 10 min. The amplified products were detected by 1.5% agarose gel electrophoresis, and the amplified products meeting the requirements were sequenced.

[0036] The sequences were screened based on the peak plots of the measured sequences. Sequences that met the requirements were searched and compared using the BLAST tool on NCBI (https: / / www.ncbi.nlm.nih.gov / ). Sequences with a similarity greater than 98% were selected as reference sequences.

[0037] Analysis of enzyme production capacity and benzylacetone tolerance of *Pterocaryonus vulgaris* GXU-F34

[0038] Benzylacetone is one of the characteristic substances of agarwood. The ability of fungi to promote agarwood formation was preliminarily assessed by combining benzylacetone tolerance with the ability of strains to produce lignin-degrading enzymes.

[0039] Fungi cultured for 3-4 days, with colonies occupying 1 / 2 to 2 / 3 of the area of ​​a 90mm culture dish, were used as inoculum. Under aseptic conditions, a portion of the hyphae were inoculated into PDA medium containing 0.1% benzylacetone. The control group was inoculated into PDA medium without benzylacetone. Three replicates were performed for each experimental unit. The cultures were incubated at 25℃ for 10 days. Images were taken and processed using ImageJ. The diameter of the colonies was measured. Finally, Congo red agar was used to test whether the strain produced cellulase, and phenolic blue agar was used to test whether the strain produced amylase.

[0040] The experimental results showed that the colony morphology of *Pterocarya spp.* GXU-F34 on Congo red and phenolic blue media was inhibited compared to that on PDA, but the growth rate was not significantly inhibited. However, no hydrolysis zone was produced, indicating that GXU-F34 does not produce cellulase or amylase. The colony morphology of *Pterocarya spp.* GXU-F34 on Congo red and phenolic blue media is shown in the figure below. Figure 1 As shown in the figure, A is a colony diagram of Congo red agar medium, and B is a colony diagram of phenolic blue agar medium.

[0041] After autoclaving the prepared PDA medium at 121°C, cool it to 50-60°C. Under aseptic conditions, filter the purchased benzylacetone reagent through a 0.22μm filter membrane. Add the filtered benzylacetone to the cooled medium, mix the medium quickly, and pour it into a 90mm petri dish to obtain PDA medium containing 0.1% benzylacetone.

[0042] Microscopic images of *Pterocaryonium globulus* GXU-F34 under stress with 0.01% benzylacetone are shown below. Figure 2 As shown in the image (A is a ruptured sporangium, B is spores and sporophytes, C is the mycelial root, D is a sporophyte, E is mycelium, F is mycelium), compare the microscopic images of *Pterocarya spp.* GXU-F34 on PDA medium, as shown. Figure 3 As shown in the figure (A, B, G, H are sporangia and sporophytes; E, F are ruptured sporangia and spores; C, D are mycelial roots). The results indicate that the growth rate of *Pterocarya spp.* GXU-F34 was not significantly limited under stress with 0.01% benzylacetone, the microstructure showed no significant changes, and there were no obvious secretions. The sporulation structure remained intact, and the spore morphology was unaffected, indicating that *Pterocarya spp.* GXU-F34 has a high tolerance to benzylacetone and is presumably capable of significantly promoting resin formation.

[0043] Morphological and molecular identification of GXU-F34

[0044] Microscopic images such as Figure 3As shown, the conidiophores are relatively long, smooth, and occasionally conidiophores, measuring 60.24±3.051 μm in length and 3.272±0.7947 μm in diameter. The funnel-shaped phialides contain round sporangia with a diameter of 25.77±0.3864 μm and a relatively smooth surface. The spores are elliptical capsules with a diameter of 2.469±0.6729 μm and a smooth surface. The hyphae are conidiophores at the base, with a diameter of 5.250±0.8485 μm. The strain was subsequently subjected to ITS sequencing and phylogenetic analysis. Figure 4 Based on morphological and molecular data, GXU-F34 is considered a new species of *Pterocarya*.

[0045] The application of the strain in promoting resin formation in Aquilaria sinensis.

[0046] GXU-F34 colony morphology on PDA medium for activation, observed on days 1-7. Figure 5 (A: Day 1, B: Day 2, C: Day 3, D: Day 4, E: Day 5, F: Day 6, G: Day 7, H: Four days of culture on PDA medium). After culturing for 7 days on solid medium, pick mycelia and inoculate them into a 250ml Erlenmeyer flask containing 100ml of PDB medium. Culture for 2-3 days to obtain seed culture, then transfer to a 250ml Erlenmeyer flask containing 100ml of PDB for expansion culture. The inoculation amount is 5%, and culture for 3 days for later use. After the culture is completed, centrifuge the bacterial culture at low speed, decan a portion of the medium, and collect the bacterial cells for later use.

[0047] The inoculation subjects were Aquilaria sinensis trees, located in the Qinlian State-owned Forest Farm in Qinzhou City, Guangxi Zhuang Autonomous Region. All the Aquilaria sinensis trees on site were 7-10 years old. Ten trees with no obvious surface damage were randomly selected as experimental trees. The bacterial solution was added as follows... Figure 6 The intravenous drip inoculation device shown was used to dilute bacteria to a final concentration of OD600 = 0.3 and fungi to 3% of the bacterial dry weight. Holes were drilled in the tree trunk with a diameter of φ = 3 mm. The inoculation bottle was pressurized to 1.5 MPa and suspended at a high position. Inoculation was performed using the intravenous drip inoculation device, and the inoculation process was as follows. Figure 6 As shown.

[0048] Four months after inoculation, the bark of the inoculated Aquilaria sinensis tree was cut open until the discolored wood was visible. The tree was photographed and analyzed after the bark was removed. The discolored portion was excavated until the tree itself contained little or no discolored tissue. The obtained tissue was photographed, and the area of ​​resin formation was measured and analyzed using ImageJ software. Figure 7 As shown in the figure. The results indicate that *Aquilaria sinensis* GXU-F34 has a high ability to promote the production of fragrance in *Aquilaria* plants.

[0049] Although the specific embodiments of the present invention have been described and illustrated in detail above, it should be noted that various changes and modifications can be made to the above embodiments without departing from the spirit of the present invention and the scope set forth in the appended claims.

Claims

1. A strain that promotes agarwood formation, characterized in that, The strain, known as *Pterocaryonium* GXU-F34, was deposited at the China Center for Type Culture Collection (CCTCC) on August 3, 2023, with accession number CCTCC NO: M20231392.

2. The application of the strain according to claim 1 in promoting resin formation in Aquilaria sinensis.

Citation Information

Patent Citations

  • Efficient phosphate-solubilizing absidia and application thereof

    CN114540208A

  • Strain of microorganism having antimicrobial activity

    US5344647A