CRISPR-Cas9 gene editing-based escherichia coli as well as preparation method and application thereof

Abstract

The invention relates to Escherichia coli based on CRISPR-Cas9 gene editing and a preparation method and application thereof.According to the Escherichia coli, an Alr gene and a Dadx gene in the Escherichia coli are partially knocked out through the CRISPR-Cas9 technology, so that D-alanine racemase of the Escherichia coli is inactivated, and the strain is applied to the enzymatic conversion process of D-alanine, so that the conversion efficiency of D-alanine is improved. The generation of a by-product L-alanine is effectively reduced, and the yield of D-alanine is improved.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to an Escherichia coli based on CRISPR-Cas9 gene editing, and a preparation method and application thereof. Background Art

[0002] D-Alanine (D-Ala) is an important chiral amino acid with a wide range of applications in the fields of medicine, food, and chemical industry. In the pharmaceutical field, D-Alanine is an important raw material for synthesizing vitamin B6 and is also one of the ingredients of amino acid infusion. In the food field, D-Alanine can be used as a seasoning and flavor enhancer to improve the taste and flavor of food. In the chemical industry, D-Alanine can be used to synthesize new sweeteners such as alitame. In other fields, D-Alanine can be used as an additive for cosmetics, has excellent defoaming properties, and is a non-ionic surfactant.

[0003] At present, the synthesis method of D-alanine is mainly a combination of chemical method and biological method. (1) Chemical synthesis method. The industrial method of producing DL-alanine is mainly to synthesize 2-aminopropionitrile from acetaldehyde as raw material with sodium cyanide, ammonium chloride and ammonia, and then produce DL-alanine after hydrolysis. Subsequently, chemical splitting method is used to produce D-alanine, including seed crystal splitting method and chromatography splitting method. This method has great environmental pollution and is gradually being eliminated by society. (2) Biological fermentation method. This method uses microbial fermentation to produce D-alanine, which has the advantages of low cost and environmental friendliness. However, the cycle is long and the product concentration is low. At present, there are few studies on the preparation of D-alanine using this method in China. (3) Enzyme conversion method; ① Enzyme splitting method; The enzyme has very strict specificity. When it acts on DL-amino acids and their derivatives, it can only react with one of the configurations to obtain the required optically active amino acids. At present, the L-amino acid acylase splitting method is widely used in industry to produce D-alanine. First, the acylated derivatives of DL-alanine are prepared by chemical methods, and then L-amino acylase acts on the acylated derivatives of L-Ala to generate L-Ala and D-alanine acylated derivatives, and the latter is hydrolyzed to obtain D-alanine. In addition, some D-amino acylases can also directly act on the acylated D-alanine to hydrolyze it to produce D-alanine. ② Transaminase method: D-amino acid transaminase is used to react with D-configuration amino acids to produce D-alanine. Since D-amino acid transaminase belongs to a relatively small part in the transaminase category, there are not many studies on the use of transaminase to prepare D-alanine, and the preparation cost is generally high. In addition, the cost of the enzyme is relatively high, and the purity of the enzyme is high. It is impossible to introduce impurities that react with the substrate or product, resulting in low substrate utilization or by-product generation.

[0004] Therefore, how to produce high-purity D-alanine has become a problem that needs to be solved urgently. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides an Escherichia coli based on CRISPR-Cas9 gene editing and a preparation method and application thereof. The Escherichia coli host bacteria are transformed by CRISPR-Cas9 technology, and the D-alanine racemase expressed by the strain itself is knocked out, so that it is unable to racemize the catalytic product D-alanine to generate the by-product L-alanine, thereby greatly reducing the production of the by-product L-alanine which is extremely difficult to separate.

[0006] To achieve this object, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides an Escherichia coli based on CRISPR-Cas9 gene editing, wherein the Alr gene and the Dadx gene are partially knocked out of the Escherichia coli.

[0008] In the present invention, the Escherichia coli host bacteria are transformed by CRISPR-Cas9 technology, and the D-alanine racemase expressed by the strain itself is knocked out, so that it is unable to racemize the catalytic product D-alanine to generate the by-product L-alanine, thereby greatly reducing the generation of the by-product L-alanine which is extremely difficult to separate.

[0009] Preferably, the nucleic acid sequence of the Alr gene after partial knockout includes the sequence shown in SEQ ID No.1.

[0010] SEQ ID No.1:

[0011] ATGCAAGCGGCAACTGTTGTGATTAACCGCCGCGCTCTGCGACACAACCTGCAACGTCTTCGTGAACTGGCCCCTGCCAGTAAAATGGTTGCGGTGGTGAAAGCGAACGCTTATGGTCACGGTCTTCTTGAGACCGCGCGAACGCTCCCCGATGCTGACGCCTTTGGCGTAGCCCGTCTCGAAGAAGCTAGGCGTTTTATCATCGCCTGACCCAGTGCAAAAACGTTCGTCAGCCGGTGAATATCGTCAGCCATTTTGCGCGCGCGGATGAACCAAAATGTGGCGCAACCGAGAAACAACTCGCTATCTTTAATACCTTTTGCGAAGGCAAACCTGGTCAACGTTCCATTGCCGCGTCGGGTGGCATTCTGCTGTGGCCACAGTCGCATTTTGACTGGGTGCGCCCGGGCATCATTCTTTATGGCGTCTCGCCGCTGGAAGATCGCTCCACCGGTGCCGATTTTGGCTGTCAGCCAGTGATGTCACTAACCTCCAGCCTGATTGCCGTGCGTGAGCATAAAGCCGGAGAGCCTGTTGGTTATGGTGGAACCTGGGTAAGCGAACGTGATACCCGTCTTGGCGTAGTCGCGATGGGCTATGGCGATGGTTATCCGCGCGCCGCGCCGTCCGGTACGCCAGTGCTGGTGAACGGTCGCGAAGTACCGATTGTCGGGCGCGTGGCGATGGATATGATCTGCGTAGACTTAGGTCCACAGGCGCAGGACAAAGCCGGGGATCCGGTCATTTTATGGGGCGAAGGTTTGCCCGTAGAACGTATCGCTGAAATGACGAAAGTAAGCGCTTACGAACTTATTACGCGCCTGACTTCAAGGGTCGCGATGAAATACGTGGATTAA

[0012] Preferably, the nucleic acid sequence of the Dadx gene after partial knockout includes the sequence shown in SEQ ID No.2.

[0013] SEQ ID No.2:

[0014] ATGACCCGTCCGATACAGGCCAGCCTCGATCTGCAGGCATTAAAACAGAATCTGTCCATTGTCCGCCAGGCCGCGACGCACGCGCGTCTGGTCGGTGGTAAAAGCGAACGCTTACGGGCATGGTATTGAGCGTATCTGGAGCGCGATCGGGGCCACCGATGGCTTTGCATTGCTTAACCTGGAAGCGGAA CATCCTGATGGAATTTCCGGCGCGATGGCGCGTATTGAGCAGGCGGCGGAGGGGCTGGAGTGTCGGCGTTCGTTGTCCAATTCGGCGGCGACTCTGTGGCACCCGGAAGCGCATTTTGACTGGGTTCGGCCTGGCATTATTTTGTATGGCGCTTCGCCGTCCGGTCAGTGGCGTGATATCGCCAATACCGGAT TACGTCCGGTGATGACGCTAAGCAGTGAGATTATTGGTGTCCAGACGCTAAAAGCGGGCGAGCGTGTGGGCTACGGCGGTCGCTATACTGCGCGCGATGAACAGCGAATCGGCATTGTCGCCGCAGGGTACGCCGACGGTTATCCGCGCCACGCGCCTACCGGTACCCCTGTTTTAGTGGACGGCGTGCGCAC CATGACGGTGGGGACCGTCTCGATGGATATGCTAGCGGTCGATTTAACGCCTTGCCCGCAGGCGGGTATTGGTACGCCGGTTGAGCTGTGGGGCAAGGAGATCAAAATTGATGATGTCGCCGCCGCTGCCGGAACGGTGGGCTATGAGTTGATGTGCGCGCTGGCGCTACGCGTCCCGGTTGTGACGGTGTAA

[0015] In a second aspect, the present invention provides a method for preparing Escherichia coli based on CRISPR-Cas9 gene editing according to the first aspect, the preparation method comprising the following steps: the preparation method comprises: transferring Alr-pTargetF plasmid, Dadx-pTargetF plasmid, Alr-Donor DNA, Dadx-Donor DNA and pCas9 plasmid into Escherichia coli, and eliminating the plasmid after identification.

[0016] In the present invention, CRISPR-Cas9 technology is used to effectively knock out the Alr gene and the Dadx gene, and further eliminate the residual plasmids, thereby reducing the influence of the plasmids on subsequent experiments.

[0017] Preferably, the preparation method comprises the following steps:

[0018] (1) Designing the N20 sequences corresponding to the Alr and Dadx genes, and connecting the Alr and Dadx genes to the corresponding N20 sequences;

[0019] (2) connecting the sequences obtained in step (1) to the plasmids respectively;

[0020] (3) Construction of Alr-Donor DNA and Dadx-Donor DNA;

[0021] (4) Transforming the plasmid constructed in step (2), the DNA fragment in step (3) and the pCas9 plasmid into Escherichia coli;

[0022] (5) Identification;

[0023] (6) Eliminate plasmid.

[0024] Preferably, the sequence of Alr-N20 in step (1) is as shown in SEQ ID No.3 and SEQ ID No.4.

[0025] SEQ ID No.3-F: CTGTTCTTCGTTATGCACGG;

[0026] SEQ ID No. 4-R: CCGTGCATAACGAAGAACAG.

[0027] Preferably, the Dadx-N20 sequence in step (1) is as shown in SEQ ID No.5 and SEQ ID No.6.

[0028] SEQ ID No.5-F: TCAAAGCACTGCAAAATGCG;

[0029] SEQ ID No. 6-R: CGCATTTGCAGTGCTTTGA.

[0030] Preferably, the plasmid in step (2) comprises a pTargetF plasmid.

[0031] Preferably, the Alr-Donor DNA sequence in step (3) is as shown in SEQ ID No.7.

[0032] SEQ ID No.7:

[0033]

[0034] Preferably, the Dadx-Donor DNA sequence in step (3) is as shown in SEQ ID No.8.

[0035] SEQ ID No.8:

[0036]

[0037] Preferably, the strain of Escherichia coli in step (4) includes any one of DH5α, BL21 (DE3), JM109, TOP10 or HB101.

[0038] Preferably, the identification method in step (5) comprises colony PCR and / or whole genome sequencing.

[0039] Preferably, the method for eliminating the plasmid in step (6) comprises: adding IPTG to the Escherichia coli identified in step (5) for incubation.

[0040] Preferably, the final concentration of IPTG is 0.1-1 mM, for example, 0.1 mM, 0.2 mM, 0.3 mM, 0.4 mM, 0.5 mM, 0.6 mM, 0.7 mM, 0.8 mM, 0.9 mM or 1 mM, etc.

[0041] Preferably, the incubation time is 12-36 hours and the temperature is 35-40° C. The 12-36 hours may be, for example, 12 hours, 15 hours, 20 hours, 25 hours, 30 hours, 35 hours or 36 hours, etc. The 35-40° C. may be, for example, 35° C., 36° C., 37° C., 38° C., 39° C. or 40° C., etc.

[0042] In a third aspect, the present invention provides a dual-enzyme co-expressing Escherichia coli for producing D-alanine, wherein the dual-enzyme co-expressing Escherichia coli is a co-expression of aspartate racemase and D-amino acid transaminase in the CRISPR-Cas9 gene-edited Escherichia coli described in the first aspect.

[0043] In the present invention, a multi-enzyme catalytic system is constructed on the basis of the Escherichia coli described in the first aspect, and aspartate racemase is introduced to achieve direct whole-cell catalytic production of D-alanine using L-aspartate as a substrate without enzyme purification. Compared with a single enzyme catalytic system, the cost of the substrate L-aspartate used in the multi-enzyme catalytic system is much lower than that of D-aspartate.

[0044] Preferably, the nucleic acid sequence of the aspartate racemase is shown as SEQ ID No.9.

[0045] SEQ ID No.9:

[0046] ATGGAGAATTTTTTCAGTATTTTAGGCGGAATGGGCACGATGGCGACAGAAAGTTTTGTTCGCTTGATCAACCACCGAACGAAAGCTACAAAAGATCAAGAATATTTGAATTATGTCTTATTCAATCATGCAACAGTTCCTGATCGTACAGCTTATATTTTAGATCGATCAGAAGAAAATCCAATGCCGTTTCTGCTGGATGATATTGAGAAACAAAATTTATTGCGACCAAACTTCATTGTGTTGACTTGTAACACAGCACATTACTTTTTTGAAGAATTACAAGCGGCAACGGATATTCCTATCCTGCATATGCCAAGAGAAGCAGCAAATGAACTTGTCCGTCAGCATACGACAGGGAGAGTAGCGATTCTAGGAACAGAAGGAAGTATGAAAGCTGGAATCTATGAACGCGAAGTCAAAAATCTTGGATTCGAAACAGTGATTCCTGATACTGCGCTTCAAGAAAAAATCAATTATTTGATCTATCATGAAATCAAAGAGTCAGATCACTTGAATCAAGAACTCTACTATGAGATTTTGGAAGAAGCGGTAGAGCGATTAAACTGTGAAAAAGTTATCCTAGGTTGCACGGAATTATCTTTGATGAATGAATTTGCTGAAGATAATCATTACCCAGTGATCGATGCTCAATCTATTTTAGCGGATCGGACGATCGAACGAGCATTAGCTGAAAGAAACGAAGCATTAGATACAGTATCTGAAAAGTAG

[0047] Preferably, the nucleic acid sequence of the D - amino acid transaminase is as shown in SEQ ID No.10.

[0048] SEQ ID No.10:

[0049] ATGGGCTACACCCTGTGGAACGATCAGATTGTGAAAGATGAAGAAGTTAAAATCGACAAAGAAGATCGTGGCTACCAATTCGGTGACGGTGTGTACGAAGTAGTTAAAGTTTATAACGGTGAAATGTTCACAGTTAATGAACACATCGACCGCCTGTACGCGTCCGCTGAAAAAATCCGCATCACCATCCCGTACACCAAAGATAAATTCCAC CAGCTGCTGCACGAACTGGTTGAGAAAAACGAACTGAACACCGGCCACATCTATTTCCAGGTTACCCGTGGCACCTCTCCGGTGCGCACCAGTTCCCGGAAAACACCGTTAAACCGGTTATCATCGGTTACACCAAAGAAAACCCGCGTCCGTTAGAAAACCTGGAAAAAGGTGTTAAAGCGACCTTTGTTGAAGATATCCGTTGGCTGCGT TGTGATATCAAATCTCTGAATCTGCTGGGTGCTGTTCTGGCTAAACAGGAAGCGCACGAAAAAGGCTGCTACGAAGCGATCCTGCACCGTAACAACACCGTTACCGAGGGCTCTAGCAGCAACGTTTTTCGGCATCAAAGATGGTATCCTGTACACCCACCCGGCGAACAACATGATCCTGAAAGGCATCACCCGTGATGTTGTTATTGCGTGC GCGAACGAAATCAACATGCCGGTAAAAGAAATCCCGTTCACCACCCACGAAGCGCTGAAAATGGATGAACTGTTCGTGACCAGCACCACCAGCGAAATCACCCCGGTGATCGAAATCGATGGCAAACTGATCCGTGATGGTAAAGTTGGTGAATGGACCCGTAAACTGCAGAAACAGTTCGAAACTAAAATCCCGAAACCGCTGCACATCTAA

[0050] In a fourth aspect, the present invention provides a method for preparing the dual-enzyme co-expressing Escherichia coli for D-alanine production described in the third aspect, the preparation method comprising connecting the nucleic acid sequences of aspartate racemase and D-amino acid transaminase to a plasmid and then transferring them into the CRISPR-Cas9 gene-edited Escherichia coli described in the first aspect.

[0051] Preferably, the steps of the preparation method include:

[0052] (A) using a restriction endonuclease to cut the plasmid and then connect it to the nucleic acid sequence of aspartate racemase to obtain a connection product;

[0053] (B) using a restriction endonuclease to digest the ligation product obtained in step (A) and the resulting product with the nucleic acid sequence of the D-amino acid transaminase to obtain a co-expression vector;

[0054] (C) The co-expression vector obtained in step (B) is transferred into the CRISPR-Cas9 gene editing-based Escherichia coli described in the first aspect.

[0055] Preferably, the plasmid described in step (A) comprises any one of pETDuet-1, pRSFDuet-1, pCOLADuet-1, pCDFDuet-1, pACYCDuet-1, pGEX or pMA.

[0056] Preferably, the restriction endonuclease in step (A) comprises BamHI and / or EcoRI.

[0057] Preferably, the restriction endonuclease in step (B) comprises AatⅠⅠ and / or XhoⅠ.

[0058] Preferably, the method of transferring in step (C) comprises electroporation.

[0059] In a fifth aspect, the present invention provides a use of the dual-enzyme co-expressing Escherichia coli for D-alanine production according to the third aspect in D-alanine production.

[0060] Preferably, the production method for application comprises: adding L-aspartic acid, coenzyme and pyruvate to the dual-enzyme co-expressing Escherichia coli for D-alanine production described in the third aspect, adjusting the pH, and performing an oscillating reaction.

[0061] Preferably, the final concentration of the Escherichia coli is 3-10 g / L, for example, it can be 3 g / L, 4 g / L, 5 g / L, 6 g / L, 7 g / L, 8 g / L, 9 g / L or 10 g / L.

[0062] Preferably, the final concentration of L-aspartic acid is 40-60 g / L, for example, it can be 40 g / L, 42 g / L, 44 g / L, 46 g / L, 48 g / L, 50 g / L, 52 g / L, 54 g / L, 56 g / L, 58 g / L or 60 g / L.

[0063] Preferably, the coenzyme comprises pyridoxal phosphate.

[0064] Preferably, the concentration of the coenzyme is 1-4 mM, for example, 1 mM, 2 mM, 3 mM or 4 mM.

[0065] Preferably, the concentration of pyruvic acid is 6-10 g / L, for example, 6 g / L, 7 g / L, 8 g / L, 9 g / L or 10 g / L.

[0066] Preferably, the molar ratio of pyruvic acid to L-aspartic acid is 1:(2-8), wherein (2-8) may be, for example, 2, 3, 4, 5, 6, 7 or 8.

[0067] Preferably, the speed of the oscillating reaction is 100-500 rpm, for example, it can be 100 rpm, 200 rpm, 300 rpm, 400 rpm or 500 rpm.

[0068] Preferably, the temperature of the oscillation reaction is 35-45°C, and the time is 12-36h. The 35-45°C may be, for example, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C or 45°C, etc. The 12-36h may be, for example, 12h, 14h, 16h, 18h, 20h, 22h, 24h, 26h, 28h, 30h, 32h, 34h or 36h, etc.

[0069] Compared with the prior art, the present invention has at least the following beneficial effects:

[0070] 1. In the present invention, the Escherichia coli host bacteria are transformed by CRISPR-Cas9 technology, and the D-alanine racemase expressed by the strain itself is knocked out, so that it is unable to racemize the catalytic product D-alanine to generate the by-product L-alanine, thereby greatly reducing the production of the by-product L-alanine which is extremely difficult to separate.

[0071] 2. In the present invention, a co-expression strategy is adopted to introduce aspartate racemase and D-amino acid transaminase, and the fermentation culture of "one bacteria and two enzymes" is successfully realized, which not only realizes the efficient expression of aspartate racemase and D-amino acid transaminase, but also effectively reduces the production cost of the enzyme.

[0072] 3. In the present invention, an enzymatic conversion method of D-alanine was established based on the dual-enzyme co-expression modified strain, which achieved the "one bacteria, two enzymes" whole-cell catalytic production of D-alanine using L-aspartic acid as the substrate, further reducing the industrial production cost of D-alanine. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] Figure 1 The electrophoresis detection diagram of knockout gene in E. coli is shown in Figure A, which is the electrophoresis diagram of knockout Alr gene, and Figure B is the electrophoresis diagram of knockout Dadx gene.

[0074] Figure 2 AspR+DaaT(YM-1) co-expression plasmid construction diagram

[0075] Figure 3 This is the SDS-PAGE result of pEAD1 strain and pEAD2 strain.

[0076] Figure 4 It is a bar graph of transformation rate and yield when different amounts of recombinant bacteria are added.

[0077] Figure 5 It is a bar graph showing the conversion rate and yield when different amounts of pyridoxal phosphate are added.

[0078] Figure 6 It is a bar graph of conversion rate and yield when different amounts of pyruvate are added. DETAILED DESCRIPTION

[0079] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and through specific implementation methods. However, the following examples are only simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0080] Example 1

[0081] In this example, CRISPR-Cas9 technology was used to partially knock out the Alr gene and Dadx gene in Escherichia coli.

[0082] (1) Construction of Alr / Dadx-pTargetF plasmid

[0083] Upstream targeting primers corresponding to Alr and Dadx genes and downstream targeting primers N20 were designed through http: / / chopchop.cbu.uib.no / , as shown in Table 1. Then primers that can amplify pTargetF-sgRNA-Alr and pTargetF-sgRNA-Dadx were designed, and pTargetF targeting plasmid was used as a template for PCR amplification reaction, and transferred into DH5α for circularization to construct Alr-pTargetF plasmid and Dadx-pTargetF plasmid. The amplified gene sequence carries 20 bases of the targeting site, namely N20. Alr-pTargetF plasmid and Dadx-pTargetF plasmid can guide Cas9 protein to accurately locate the target gene.

[0084] Table 1

[0085]

[0086]

[0087] (2) Construction of Donor DNA (homologous repair donor DNA) of Alr and Dadx genes

[0088] Using the genomic DNA of E. coli BL21 (DE3) as a template, Alr-upper arm-F and Alr-overlap-R as primers, PCR amplification was performed to obtain fragment 1, and Alr-overla-F and Alr-lower arm-R as primers, PCR amplification was performed to obtain fragment 2. Using Alr-upper arm-F and Alr-lower arm-R as primers, fragment 1 and fragment 2 were used as templates to obtain Alr-Donor DNA by overlapping extension PCR method, and Dadx-Donor DNA was obtained by the same method. The constructed sequences are shown in SEQ ID No. 7 and SEQ ID No. 8. The sequences of all the above primers are shown in Table 2.

[0089] Table 2

[0090]

[0091] (3) Preparation of electrotransfected cells

[0092] The overnight culture of E. coli BL21 (DE3) was inoculated into 40 mL of LB medium at a ratio of 1:100 and cultured at 37°C with a shaker at 220 rpm until the bacterial concentration (OD 600 When the concentration is 0.4, ice bath for 30 minutes. Then centrifuge the ice-bathed bacterial solution at 4°C, 4800g for 5 minutes, and discard the supernatant; resuspend the cells with pre-cooled 10% glycerol, centrifuge the bacterial solution again at 4°C, 4800g for 5 minutes; carefully discard the supernatant, resuspend the cells with pre-cooled 10% glycerol, centrifuge and discard the supernatant three times; finally, take about 500μL of pre-cooled 10% glycerol to resuspend the cells. The resuspended cells are the electrotransfected cells, which are divided into 1.5mL centrifuge tubes (100μL per tube) and stored at -80°C for use.

[0093] (4) Electroporation of pCas9, Alr-pTargetF and Dadx-pTargetF plasmids and Donor DNA to knock out Alr and Dadx genes

[0094] Add 50μL of E.coli BL21 (DE3) electroporation competent cells and 5μL of pCas9 plasmid at a concentration of 50ng / μL to a 1mm electroporation cup, and gently hit the electroporation cup to mix evenly. Set the voltage to 1600kV and the electroporation time to 2.6ms. After electroporation, quickly add 500μL of LB liquid culture medium, and repeatedly pipette and transfer all the bacteria to a 1.5mL centrifuge tube. Cultivate in a shaker at 30℃ and 220rpm for 2h. After the cultivation is completed, take 100μL of bacterial solution and spread it on an LB culture medium plate containing 50μg / mL kanamycin, and place the plate in a 30℃ incubator for 36h. Take a single colony and inoculate it in 20mL of LB culture medium containing 50μg / mL kanamycin for overnight culture. The cultured bacterial suspension was inoculated into 40 mL of LB liquid medium containing 50 μg / mL kanamycin at a ratio of 1:100, induced with L-arabinose at a final concentration of 60 mM, and cultured at 30°C, 220 rpm in a shaking incubator until the bacterial suspension concentration (OD) reached 0. 600 When the induced bacterial solution is about 0.4, the induced bacterial solution is prepared into electrotransformed cells, and the preparation method is the same as above. Subsequently, Alr-pTargetF, Dadx-pTargetF, Alr-Donor DNA, and Dadx-Donor DNA are electrotransformed into the induced electrotransformed competent cells, and the electrotransformation method is the same as above. Finally, it is coated on a double-resistant LB plate containing 50μg / mL spectinomycin and 50μg / mL kanamycin, and cultured at 30°C for 12-16h.

[0095] (5) E. coli BL21(DE3) with stable knockout of Alr and Dadx genes Alr-Dadx- Screening of strains

[0096] The strains containing Alr-pTargetF, Dadx-pTargetF plasmids and pCas9 plasmids were screened using plates with 0.02 g / L D-alanine, spectinomycin and kanamycin resistance, respectively, and the bacterial solution PCR detection was performed using the specific primers Alr-F / Alr-R and Dadx-F / Dadx-R of the Alr and Dadx genes shown in Table 2. The specific results are shown in Table 2. Figure 1 As shown in A, M is Maker, lanes 1-3 are Alr genes after partial knockout, and lanes 4-6 are Alr original genes. Figure 1 As shown in B, M is Maker, 1-3 are the original Dadx genes, and 4-6 are the Dadx genes after partial knockout. Alr and Dadx genes 223bp and 300bp were partially knocked out. The gene-edited strain is called E. coli BL21 (DE3) Alr-Dadx- Transformed strains.

[0097] (6) Elimination of pTargetF plasmid and pCas9 plasmid

[0098] E. coli BL21(DE3) Alr-Dadx- 10 μL of the bacterial solution of the transformed bacteria was inoculated into 20 mL of LB medium containing 50 μg / mL kanamycin and 0.5 mM IPTG, and cultured at 30°C overnight with shaking. The induced bacterial solution was streaked on LB medium containing 50 μg / mL kanamycin, cultured at 30°C, and single colonies were obtained. Several single colonies were picked and placed in LB liquid medium containing 50 μg / mL kanamycin, labeled, and cultured at 30°C overnight with shaking. After that, this bacterial solution was placed in LB liquid medium containing 50 μg / mL spectinomycin, and cultured at 30°C with shaking for 36 hours. If there was no bacterial growth, it proved that the plasmid pTargetF had been eliminated. An appropriate amount of bacterial solution that had eliminated the plasmid pTargetF was taken and cultured at 37°C overnight with shaking in LB liquid medium for 24 hours. After that, the bacterial solution was streaked on LB medium to obtain a single colony, and this single colony was picked and cultured at 37°C overnight with shaking. The bacterial solution was pipetted into LB liquid culture medium containing 50 μg / mL kanamycin, and cultured at 30°C with shaking for 30 h. If no bacterial cells grew, it proved that the plasmid pCas9 had been eliminated.

[0099] Example 2

[0100] In this example, pET Duet-1 -AspR-DaaT (YM-1) co-expression recombinant plasmid construction

[0101] (1) pET Duet-1 Construction of -AspR plasmid

[0102] AspR from Streptococcus thermophilus. The plasmid used is pET Duet-1 The restriction site is BamHⅠ-EcoRⅠ and it was fully synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0103] (2) Acquisition of DaaT (YM-1) gene

[0104] The gene of Bacillus sphaericus YM-1 was used as the template for PCR reaction, and the forward primer and reverse primer were designed. The restriction sites were Aat II and xho I, as shown in Table 3. The PCR reaction was carried out in a total volume of 50 μL. The reaction conditions were 95°C pre-denaturation for 3 min before starting the cycle, followed by 95°C denaturation for 15 s, 60°C annealing for 15 s, and 72°C extension for 1 min 30 s. After a total of 30 cycles, the target fragment was extended at 72°C. The PCR amplification product was recovered according to the steps of the gel recovery kit.

[0105] Table 3

[0106]

[0107] (3) pET Duet-1 - Construction of AspR-DaaT (YM-1)

[0108] The DaaT (YM-1) amplified product in (2) was mixed with the pET Duet-1 -AspR was double digested with restriction endonucleases AatⅠⅠ and xhoⅠ, and then ligated. Figure 2 The constructed vector is called pET Duet-1 -AspR-DaaT(YM-1), and then the ligation product pET Duet-1 -AspR-DaaT(YM-1) was transformed into E. coli BL21(DE3), and the engineered bacterium was called pEAD1. Alr-Dadx- In the modified strain, the engineered bacterium becomes pEAD2.

[0109] Example 3

[0110] In this example, the enzyme activities of aspartate racemase and D-amino acid transaminase were determined.

[0111] The single expression plasmids pETDuet-1-AspR and pET-21a(+)-DaaT(YM-1) were fully synthesized by Sangon Biotech (Shanghai) Co., Ltd. and transformed into Escherichia coli BL21(DE3) Alr-Dadx- The pETD-A and pET-D engineering bacteria were obtained.

[0112] (1) HPLC detection method

[0113] The operating steps of the following HPLC detection method are as follows: HPLC detection sample pre-column pretreatment, accurately aspirate 1.0 mL of the dilution after the catalytic reaction, place it in a 10 mL brown volumetric flask, add 1.0 mL of 0.5 mol / L sodium bicarbonate solution with a pH value of 9.0, then add 1.0 mL of 1% DNFB acetonitrile solution, mix well, seal with a sealing film, put into a constant temperature water bath, react at 60°C in a dark place away from light for 60 minutes, then take out, cool to room temperature, make up to volume with pH 7.0 phosphate buffer solution, leave for 15 minutes, and filter with a 0.22 μm filter membrane to obtain.

[0114] The HPLC parameters were as follows: a C18 column, mobile phase A of 50 mM acetic acid solution and mobile phase B of 50% acetonitrile aqueous solution, an injection volume of 10 μL, an ultraviolet detection wavelength of 360 nm, a column temperature of 30° C., and a flow rate of 1.0 mL / min.

[0115] (2) Bacterial induction expression

[0116] Single colonies of pETD-A, pET-D, pEAD1 and pEAD2 were selected and inoculated into 50 mL LB medium containing Amp resistance, and cultured at 37°C and 220 rpm until OD 600 The final concentration of IPTG was 0.5 mM and the cells were induced to culture for 6 h. The expression of the target protein was analyzed by SDS-PAGE electrophoresis. Figure 3 As shown, lane 1 is pETD-A bacteria expressing AspR enzyme alone, with a molecular weight of 26kDa, lane 2 is pET-D bacteria expressing DaaT (YM-1) enzyme alone, with a molecular weight of 32kDa, and lanes 3-4 are pEAD1 and pEAD2 bacteria co-expressing AspR and DaaT (YM-1) respectively. Comparing lanes 1-2 with lanes 3-4, it was found that the expression of single plasmid double enzyme co-expression was almost the same as that of single plasmid single enzyme, and there was no significant difference. Comparing lanes 3 and 4, it was found that the expression of pEAD1 and pEAD2 bacteria was almost the same, indicating that the modified strain did not have a huge impact on protein expression.

[0117] (3) Detection of aspartate racemase activity

[0118] Take 0.5g bacterial cells, add 50mL PBS buffer with a concentration of 0.1mol / L at pH 8.0, resuspend and ultrasonically disrupt, centrifuge and take 2mL of crude enzyme solution with a concentration of 10g cell / L, add 18mL of L-aspartic acid solution with a concentration of 80g / L, form a 20mL reaction system, place in a 40℃ water bath, react for 30min, then boil in a boiling water bath for 5min to terminate the reaction, centrifuge and take 9mL of supernatant, add 1mL DaaT (YM-1) crude enzyme solution, react for 24h, boil at 100℃ for 5min, centrifuge and take the supernatant and dilute it, and use HPLC detection method to determine the L-aspartic acid consumption. The specific calculation formula is:

[0119]

[0120] (4) Enzyme activity detection of D-amino acid transaminase

[0121] Take 0.5g of bacterial cells, add 50mL of pH 8.0 0.1mol / L PBS buffer to resuspend and ultrasonically disrupt, centrifuge and take 1mL of 10g cell / L crude enzyme solution, add 9mL of 80g / L D-aspartic acid, 3mM pyridoxal phosphate and 0.107g pyruvic acid solution to form a 10mL reaction system, place in a 60℃ water bath, react for 30min, then boil in water bath for 5min to terminate the reaction, centrifuge and dilute the supernatant, and use HPLC to determine the amount of D-alanine produced. The specific calculation formula is:

[0122]

[0123] (5) Results

[0124] After the above detection, the enzyme activity of aspartate racemase expressed by pETD-A bacteria was 2170 μmol / (min·g), and the enzyme activity of D-amino acid transaminase expressed by pET-D bacteria was 3921 μmol / (min·g). The enzyme activity of aspartate racemase is lower than that of D-amino acid transaminase. It can be seen that in the dual-enzyme cascade reaction, aspartate racemase is the rate-limiting enzyme of the entire catalytic reaction, and the catalytic conditions should give priority to the optimal conditions of aspartate racemase to maximize the D-alanine production.

[0125] Example 4

[0126] This example detects the activity of pEAD1 and pEAD2 bacteria

[0127] (1) Take 0.5 g of bacterial cells containing recombinant pEAD1 and recombinant pEAD2, add 50 mL of PBS buffer with a pH of 8.0 and a concentration of 0.1 mol / L to resuspend, and take 1 mL of 10 g cell / L bacterial liquid, add 9mL of solution containing 80g / L D-aspartic acid, 3mM coenzyme and 0.107g pyruvic acid to form a 10mL reaction system, place in a 50℃ water bath, react for 30min, then boil in a boiling water bath for 5min to terminate the reaction, centrifuge and dilute the supernatant, and use HPLC to determine the amount of D-alanine produced. The specific calculation formula is:

[0128]

[0129] (2) Test results

[0130] The bacterial activities of pEAD1 and pEAD2 were tested to be 615 μmol / (min·g) and 684 μmol / (min·g), respectively, which were lower than the enzyme activities of AspR and DaaT(YM-1). This is because the substrate must cross the cell membrane before contacting the enzyme, so the bacterial activity is lower than the enzyme activity. In addition, the reaction between pEAD1 and pEAD2 and the substrate is a cascade reaction, which is slower than a single enzyme reaction. Therefore, the significant reduction in bacterial activity relative to the enzyme activity is consistent with the theoretical basis.

[0131] The activity of pEAD2 is slightly higher than that of pEAD1. In addition to the error causing the result, it may be related to the protein expression level. During the bacterial culture process, it was found that the growth rate of pEAD2 was faster than that of pEAD1. This may be because pEAD2 does not need to synthesize D-Ala for its own cell wall synthesis, but can directly use exogenously added D-Ala to synthesize bacterial cell walls. This allows more energy to synthesize enzymes in the pEAD2 metabolic network, making pEAD2 more active than pEAD1 at the same bacterial addition amount.

[0132] Example 5

[0133] This test example compares the whole-cell catalysis results of pEAD1 and pEAD2 bacteria.

[0134] 8g L-aspartic acid was dissolved in 50mL pure water, and then 0.067g PLP of coenzyme, 3.77g pyruvic acid, 3.77g, and ammonia water were adjusted to 8 and then the volume was fixed to 100mL to prepare a reaction solution. After the reaction solution was evenly divided into two parts, 0.67g pEAD1 and pEAD2 were added respectively and placed at 47°C for 15h to compare the content of L-alanine in the product D-alanine. After testing, the content of L-alanine in the reaction solution catalyzed by pEAD1 bacteria was 16.56% at 15h, while the content of L-alanine in the reaction solution catalyzed by pEAD2 bacteria was 0.54%. The conversion rates of pEAD1 and pEAD2 were both above 89.70%.

[0135] Example 6

[0136] This test example optimizes the pEAD2 engineered bacteria whole-cell catalytic system for D-alanine

[0137] (1) Effect of pEAD2 addition on D-alanine synthesis

[0138] Add 2.5g L-aspartic acid, 0.0494g pyridoxal phosphate (PLP) and 0.165g pyruvic acid to 50mL water to prepare a reaction solution with an aspartic acid concentration of 50g / L and a final coenzyme (PLP) concentration of 4mM. Adjust the amount of pEAD2 bacteria to add according to the mass ratio (g:g) of pyruvic acid and pEAD2 bacteria of 5:1, 10:1, 15:1, 18:1, 20:1, 25:1, 30:1 and 35:1. Adjust the pH of the solution to 8 with ammonia water. Place the solution in a shaker at 40°C and 200rpm for reaction for 24h. Take 2.5mL of the sample and boil it in a water bath for 5min to terminate the reaction. Centrifuge and dilute the supernatant. Detect the L-aspartic acid conversion rate and D-alanine yield by HPLC. Figure 4 As shown, when the mass ratio of pyruvic acid to bacterial mass was 10:1, the 24h conversion rate and product saturation were 85.12% and 73.95%, respectively.

[0139] (2) Effect of pyridoxal phosphate addition on the synthesis of D-alanine

[0140] Add 2.5g L-aspartic acid and 0.165g pyruvic acid to 50mL water to make an aspartic acid concentration of 50g / L reaction solution, add 0.25g bacteria, add PLP to the final concentration of 1mM, 1.5mM, 2mM, 2.5mM, 3mM, 3.5mM and 4mM, adjust the pH of the solution to 8 with ammonia water, place it in a shaker at 40℃ and 200rpm for 24h, take 2.5mL of the reaction solution and boil it in a water bath for 5min to terminate the reaction, centrifuge and take the supernatant for dilution, detect the L-aspartic acid conversion rate and D-alanine yield by HPLC, and select the optimal amount of PLP. Figure 5 As shown, when the final concentration of PLP was 3 mM, the 24 h conversion rate and yield were 82.28% and 78.68%, respectively.

[0141] (3) Effect of pyruvate addition on D-alanine synthesis

[0142] Add 2.5g L-aspartic acid and 0.0371g PLP to 50mL water to prepare a reaction solution with an L-aspartic acid concentration of 50g / L and a final PLP concentration of 3mM. Add 0.25g of bacteria, and add pyruvic acid according to the molar ratio of pyruvic acid to aspartic acid of 2:1, 5:1, 10:1, 15:1 and 20:1. Ammonia water is used to adjust the solution pH to 8. Place the solution in a shaker at 40°C and 200rpm for 24h to determine the conversion rate of L-aspartic acid and the yield of D-alanine. Take a 2.5mL sample of the reaction solution and boil it in a water bath for 5min to terminate the reaction. Centrifuge and take the supernatant for dilution. Detect the conversion rate of L-aspartic acid and the yield of D-alanine by HPLC to select the optimal amount of pyruvic acid. Figure 6As shown, when the molar ratio of pyruvic acid to aspartic acid is 2:1, the 24h conversion rate and yield are 89.70% and 86.75% respectively. When the molar ratio of pyruvic acid to aspartic acid is 5:1, the 24h conversion rate and yield are 88.01% and 80.12% respectively. Considering the economic benefit and catalytic effect, the molar ratio of pyruvic acid to aspartic acid should be 5:1.

[0143] In summary, the present invention uses CRISPR-Cas9 technology to knock out the genes of E. coli BL21 (DE3) to inactivate the two alanine racemases carried by it, and construct a modified bacterium E. coli BL21 (DE3) Alr-Dadx- . Duet-1 Construct pET for the expression vector by tandemly connecting aspartate racemase and D-amino acid transaminase Duet-1 -AspR-DaaT (YM-1) co-expression plasmid, and pET Duet-1 -AspR-DaaT (YM-1) recombinant plasmid was electroporated into the transformed strain E. coli BL21 (DE3) Alr-Dadx- The pEAD2 engineering bacteria were constructed and the pEAD2 engineering bacteria catalyzed the synthesis of D-alanine from L-aspartic acid. Finally, in the pEAD2 bacteria whole cell catalytic system, the L-alanine content was only 0.54%, the conversion rate was 89.70%, and the D-alanine yield was 86.75%.

[0144] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. A CRISPR-Cas9-based gene editing of Escherichia coli, It is characterized in that The Alr gene and the Dadx gene are partially knocked out in the Escherichia coli.

2. The Escherichia coli strain according to claim 1, It is characterized in that The nucleic acid sequence of the Alr gene after partial knockout includes the sequence shown in SEQ ID No.1; Preferably, the nucleic acid sequence of the Dadx gene after partial knockout includes the sequence shown in SEQ ID No.

2.

3. A method for preparing Escherichia coli based on CRISPR-Cas9 gene editing according to claim 1 or 2, It is characterized in that The preparation method comprises the steps of: transferring Alr-pTargetF plasmid, Dadx-pTargetF plasmid, Alr-Donor DNA, Dadx-Donor DNA and pCas9 plasmid into Escherichia coli, and eliminating the plasmid after identification to obtain the product.

4. The preparation method according to claim 3, It is characterized in that The preparation method comprises the following steps: (1) Designing the N20 sequences corresponding to the Alr and Dadx genes, and connecting the Alr and Dadx genes to the corresponding N20 sequences; (2) connecting the sequences obtained in step (1) to the plasmids respectively; (3) Construction of Alr-Donor DNA and Dadx-Donor DNA; (4) Transforming the plasmid constructed in step (2), the DNA fragment in step (3) and the pCas9 plasmid into Escherichia coli; (5) Identification; (6) Elimination of plasmids; Preferably, the sequence of Alr-N20 in step (1) is as shown in SEQ ID No.3 and SEQ ID No.4; Preferably, the Dadx-N20 sequence in step (1) is as shown in SEQ ID No.5 and SEQ ID No.6; Preferably, the plasmid in step (2) comprises a pTargetF plasmid; Preferably, the Alr-Donor DNA sequence in step (3) is as shown in SEQ ID No.7; Preferably, the Dadx-Donor DNA sequence in step (3) is as shown in SEQ ID No. 8; Preferably, the transfer method in step (4) includes any one of electroporation, heat shock or particle bombardment; Preferably, the strain of Escherichia coli in step (4) includes any one of DH5α, BL21 (DE3), JM109, TOP10 or HB101; Preferably, the identification method in step (5) comprises colony PCR and / or whole genome sequencing; Preferably, the steps of the method for eliminating the plasmid in step (6) include: adding IPTG to the Escherichia coli identified in step (5) for incubation; Preferably, the final concentration of IPTG is 0.1-1 mM; Preferably, the incubation time is 12-36 hours and the temperature is 35-40°C.

5. A dual enzyme co-expression Escherichia coli for D-alanine production, It is characterized in that The dual-enzyme co-expressing Escherichia coli is the co-expression of aspartate racemase and D-amino acid transaminase in the CRISPR-Cas9 gene-edited Escherichia coli according to claim 1 or 2.

6. The dual enzyme co-expression Escherichia coli according to claim 5, It is characterized in that The nucleic acid sequence of the aspartate racemase is as shown in SEQ ID No.9; Preferably, the nucleic acid sequence of the D-amino acid transaminase is as shown in SEQ ID No.

10.

7. A method for preparing a dual-enzyme co-expressing Escherichia coli for D-alanine production according to claim 5 or 6, It is characterized in that The preparation method comprises the steps of connecting the nucleic acid sequences of aspartate racemase and D-amino acid transaminase to a plasmid and then transferring the resulting sequences into the CRISPR-Cas9 gene-edited Escherichia coli according to claim 1 or 2.

8. The preparation method according to claim 7, It is characterized in that The preparation method comprises the following steps: (A) using a restriction endonuclease to digest the plasmid and then connecting it to the nucleic acid sequence of aspartate racemase to obtain a connection product; (B) using a restriction endonuclease to digest the ligation product obtained in step (A) and obtain a co-expression vector with the nucleic acid sequence of D-amino acid transaminase; (C) transferring the co-expression vector obtained in step (B) into the CRISPR-Cas9 gene editing-based Escherichia coli according to claim 1 or 2; Preferably, the plasmid described in step (A) comprises any one of pETDuet-1, pRSFDuet-1, pCOLADuet-1, pCDFDuet-1, pACYCDuet-1, pGEX or pMA; Preferably, the restriction endonuclease in step (A) comprises BamHI and / or EcoRI; Preferably, the restriction endonuclease in step (B) comprises AatⅠⅠ and / or xhoⅠ; Preferably, the method of transferring in step (C) comprises electroporation.

9. Use of the dual enzyme co-expressing Escherichia coli for D-alanine production according to claim 5 or 6 in D-alanine production.

10. The use according to claim 9, It is characterized in that The production method of the application comprises: adding L-aspartic acid, coenzyme and pyruvic acid to the dual enzyme co-expressing Escherichia coli for D-alanine production according to claim 5 or 6, adjusting the pH, and performing an oscillating reaction; Preferably, the final concentration of Escherichia coli is 3-10 g / L; Preferably, the final concentration of L-aspartic acid is 40-60 g / L; Preferably, the coenzyme comprises pyridoxal phosphate; Preferably, the concentration of the coenzyme is 1-4 mM; Preferably, the concentration of pyruvic acid is 6-10 g / L; Preferably, the molar ratio of pyruvic acid to L-aspartic acid is 1:(2-8); Preferably, the shaking culture speed is 100-500 rpm; Preferably, the oscillation reaction is carried out at a temperature of 35-45°C and for a time of 12-36 hours.

Images