Strong pathogenicity gosling plague virus and preparation method of egg yolk antibody of strong pathogenicity gosling plague virus

Abstract

The invention relates to the field of microorganisms, and particularly discloses a highly pathogenic gosling plague virus and a preparation method of an egg yolk antibody of the highly pathogenic gosling plague virus. The invention relates to a gosling plague virus, which is preserved in the China General Microbiological Culture Collection Center (CGMCC), is named as the gosling plague virus RD2311B-E21, is preserved on April 22, 2024, and has the preservation number of CGMCC NO.45964. The gosling plague virus is named as the gosling plague virus RD2311B-E21. The preparation method of the egg yolk antibody comprises the following steps: proliferating and inactivating gosling plague virus RD2311B-E21 to prepare an immunogen; respectively injecting the immunogen into the laying hens for four times to obtain four-immunized eggs; the preparation method comprises the following steps: soaking a tetra-immunized egg in a bromogeramine solution, performing spray fumigation with glutaraldehyde, then separating yolk, treating the yolk with disodium hydrogen phosphate to obtain a turbid solution, and performing acidification extraction, degreasing with octanoic acid, degerming filtration, virus removal by ultrafiltration, ultrafiltration concentration and subpackaging to obtain a finished product. The compound has the advantages of high purity, high titer and good treatment, prevention and control effects.

Description

Technical Field

[0001] The present application relates to the field of microorganisms, and more specifically, to a method for preparing a highly pathogenic goose plague virus and its egg yolk antibody. Background Art

[0002] Goose plague, also known as goose parvovirus infection, is a highly contagious disease of goslings and Muscovy ducks caused by goose parvovirus (GPV). The clinical characteristics of sick goslings are mental fatigue, loss of appetite, severe diarrhea, and sometimes neurological symptoms. The mortality rate is high. The earlier the age of infection, the higher the mortality rate. It is one of the most serious infectious diseases that endanger the healthy development of the waterfowl industry and causes huge economic losses to waterfowl farming.

[0003] Goose plague virus belongs to the Parvoviridae family, Parvovirus genus, and has a single serotype. GPV is an autonomous virus that can replicate itself without the help of other viruses. Under natural conditions, it can proliferate on goose embryos, Muscovy duck embryos, or their fibroblasts.

[0004] At present, the specific prevention and treatment of GPV mainly relies on passive immunization with yolk antibody (Immunoglobulin of yolk, IgY), which has a significant preventive and therapeutic effect on GPV virulent infection. Due to its advantages such as low price and good preventive and therapeutic effect, IgY has been accepted and adopted by the majority of goose farmers. However, the IgY currently used is mostly crude antibodies, lacking unified production and inspection standards, and the titer of agar-expanded antibodies varies, which makes it impossible to effectively prevent and control the disease.

[0005] Since the toxicity of the virus directly affects the situation of antibodies, it is necessary to screen out the highly pathogenic goose plague virus. The prepared egg yolk antibody has the advantages of high purity, high titer and good treatment and prevention effects. Summary of the invention

[0006] In order to screen out the highly pathogenic goose plague virus, the prepared egg yolk antibody has the advantages of high purity, high titer and good treatment and prevention effects.

[0007] The present application provides a highly pathogenic goose plague virus and a method for preparing its egg yolk antibody.

[0008] In the first aspect, the present application provides a goose plague virus, using the following technical solution: A goose plague virus, which is deposited in the General Microbiology Center of China Culture Collection Administration Committee, named goose plague virus RD2311B-E21, with a preservation date of April 22, 2024 and a preservation number of CGMCCNO.45964.

[0009] By adopting the above technical scheme, the goose plague virus obtained has strong pathogenicity. By preparing antibodies with this goose plague virus, highly resistant and high-purity antibodies can be obtained, thereby broadening the scope of action of the antibodies.

[0010] Preferably, the virus separation and purification steps are as follows: adding the diseased tissue to a sterile PBS solution at a ratio of 1:1.8-2 (W / V), then grinding to obtain a slurry, subjecting the slurry to freeze-thaw and centrifugation, taking the supernatant to strain separation, filtering, and preserving the slurry, and after blind passage through the allantoic cavity of goose embryos for three generations, separating and purifying the slurry to obtain the goose plague virus RD2311B-E21.

[0011] Preferably, the diseased tissue is one or more of the liver, kidney, and intestine of the diseased goose.

[0012] By adopting the above technical solution, adding sterile PBS to the diseased tissue and then grinding it and blindly passing it for 3 generations, it is possible to obtain highly pathogenic and high-purity viruses. Using this virus to prepare antibodies can make the antibodies have the advantages of high purity, high titer, and good therapeutic and prevention effects.

[0013] Since the virus particles and these impurities differ in size and density and are subjected to different centrifugal forces during centrifugation, centrifugation is used to separate and remove impurities; the third generation of blind transmission achieves virus purification.

[0014] In a second aspect, the present application provides a method for preparing goose plague virus yolk antibodies, using the following technical solution: A method for preparing goose plague virus yolk antibodies comprises the following steps: S1. Goose plague virus RD2311B-E21 is proliferated, inactivated, and used to prepare an immunogen; the goose plague virus RD2311B-E21 is selected from the goose plague virus RD2311B-E21 described in any one of claims 1 to 3; S2, the immunogen was injected four times into laying hens to obtain four immune eggs; S3, soaking the four-free eggs in a 0.08-0.12% chlorhexidine solution, draining the water, removing surface dirt, spraying and fumigating the four-free eggs with 0.08-0.12% glutaraldehyde for 28-32 minutes, blowing the eggs dry and then breaking the eggs, and then separating the egg white and yolk to obtain the egg yolk; S4. Evenly mix the egg yolk and the sodium hydrogen phosphate solution with a concentration of 0.02-0.03 mol / L at a volume ratio of 1:0.8-1.2, and filter to remove impurities to obtain the egg yolk liquid; add 2-2.2 times the volume of the sodium hydrogen phosphate solution to the egg yolk liquid, stir and mix to obtain a turbid liquid; S5. Evenly mix the turbid liquid and the sedimentation agent at a volume ratio of 1:0.8-1.2, and then adjust the pH of the sedimentation liquid to 6.0 with a citric acid solution, and carry out sedimentation treatment at 3-5°C for 10-14h, ultrafilter to remove viruses, ultrafilter and concentrate, and package to obtain a finished product.

[0015] By adopting the above technical scheme, the prepared egg yolk antibody has the advantages of high purity, high titer, and good therapeutic and preventive effects. After entering the body of the gosling, it can be quickly absorbed by the body and enter the blood, mark the virus, quickly contact the virus, neutralize the virus, and stop the harm of the virus to the body, thereby alleviating symptoms and restoring health; and highly resistant antibodies can increase the body's antibody reserves, resist the invasion of foreign viruses, and the antibody action time is relatively long; at the same time, egg yolk antibodies can improve the symptoms of listlessness, loss of appetite, difficulty walking, and severe diarrhea in goslings, thereby significantly reducing the mortality rate of sick goslings and improving the cure rate.

[0016] Preferably, the specific steps of proliferation in S1 are as follows: The goose plague virus RD2311B-E21 was inoculated into 12-day-old embryos through the allantoic cavity, and dead fetuses aged 48 hours were discarded. Then, the allantoic fluid and embryos of goose embryos that died and were diseased within 72-120 hours were collected, and the embryos were crushed and ground and mixed with the allantoic fluid at a ratio of 1:0.8-1.2, and then centrifuged and the supernatant was packaged to obtain the antigen.

[0017] By adopting the above technical solution, the goose plague virus can be rapidly multiplied by utilizing the environment of the allantocyst. The allantocyst contains a rich vascular network that can provide a good growth environment for the virus. The virus can be replicated by utilizing the biosynthetic mechanism within the cell to obtain more virus particles, thereby achieving rapid multiplication.

[0018] Preferably, the specific steps of inactivation in S1 are as follows: The antigen is mixed with a formaldehyde solution with a concentration of 8-11%, the final concentration of the formaldehyde solution is 0.08-0.12%, and then stirred and inactivated at 37-38°C for 24-26 hours to obtain an inactivated virus solution.

[0019] By adopting the above technical scheme, using formaldehyde solution and high temperature treatment, the virus can be evenly and relatively completely inactivated, thereby facilitating the preparation of virus antibodies.

[0020] Preferably, the specific steps of preparing the immunogen in S1 are as follows: Take 90-96 parts of white oil, 5-8 parts of Span 80, and 1-3 parts of aluminum stearate by weight, mix and stir, heat to 85-95°C, and kill at high temperature to obtain an oil phase; take 95-97 parts of antigen and 3-5 parts of sterilized Tween 80 by weight and mix well to obtain a water phase; mix the oil phase and the water phase at a volume ratio of 2.8-3.2:1, stir and emulsify, and then package to obtain an immunogen.

[0021] By adopting the above technical solution, white oil and Sban 80 as oil phases have better emulsification effect, can be better compatible with the water phase, obtain emulsion, stabilize the immunogen, and make the antigen evenly dispersed in the emulsion; and white oil can promote the uptake of immunogens by cells and enhance the persistence of immune response.

[0022] Preferably, the S2 and immunogen are injected into laying hens at an injection volume of 0.4-0.6 mL to obtain one-immune eggs; after 14-16 days, they are injected into laying hens at an injection volume of 0.9-1.2 mL to obtain two-immune eggs; then after 14-16 days, they are injected into laying hens at an injection volume of 1.3-1.6 mL / hen to obtain three-immune eggs; then after 28-32 days, they are injected into laying hens at an injection volume of 1.8-2.2 mL / hen to obtain four-immune eggs.

[0023] By adopting the above technical solution, the four-immune eggs produce a large amount of antibodies in the body after multiple immunizations, thereby improving the resistance and titer of the antibodies.

[0024] Preferably, the S5 sedimentation agent is prepared by mixing 6.62-6.68 g of PVP, 4.12-4.20 g of trehalose and 1 L of water.

[0025] By adopting the above technical scheme, PVP, trehalose, citric acid and caprylic acid are combined to remove ester substances in the yolk liquid through sedimentation, thereby improving the purity of the supernatant, so that the prepared yolk antibody has the advantages of high purity and high titer.

[0026] Preferably, the citric acid solution is a citric acid aqueous solution with a mass fraction of 28-32%.

[0027] By adopting the above technical solution, the mass fraction of the citric acid solution is limited, the antibody separation is promoted, and the antibody stability is improved, thereby ensuring the resistance and purity.

[0028] In summary, this application has the following beneficial effects: 1. The goose plague virus RD2311B-E21 is highly pathogenic. Using this goose plague virus to prepare antibodies can obtain highly resistant and high-purity antibodies, broadening the scope of action of the antibodies. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1It is the electrophoresis diagram of the PCR test results; Figure 2 Electrophoresis diagram of PCR detection of goose plague virus before and after infection; Figure 3 Results of goose plague challenge and protection experiments. DETAILED DESCRIPTION

[0030] The present application is further described in detail below with reference to the embodiments. Example

[0031] Among the following raw materials, sterile PBS solution was purchased from Wuhan Boster Bioengineering Co., Ltd.; 2×TapPCRStarMix was purchased from Beijing Kangrun Chengye Biotechnology Co., Ltd.; other raw materials were commercially available.

[0032] Example 1: Isolation and purification of goose plague virus: The livers of sick geese in a goose farm infected with gosling plague virus were collected aseptically to obtain diseased tissues; The diseased tissue was added to a sterile PBS solution at a ratio of 1:2 (W / V), and then ground to obtain a slurry. After repeated freezing and thawing for three times, the slurry was centrifuged at 6000 rpm for 15 min. The supernatant was taken for strain separation, filtered through a sterile filter, and then stored at -20°C. After blind passage through goose embryo allantoic sacs for three generations, it was separated and purified to obtain goose plague virus RD2311B-E21.

[0033] Identification of the virus: 1. Extraction of viral DNA fragments of goose plague virus RD2311B-E21: The specific operation process was carried out according to the instructions of the StarSceiptⅢOne-StepRT-RCRKit (Dye) extraction kit, wherein the sample addition amount was 300 μL, and the required viral genomic DNA fragments were obtained and recorded as templates; 2. Identification primers: upstream primer GPV-F: GAGCATCAACTCCCGTATGTCC; downstream primer GPV-R: CTACTTCCTGCTCGTCCGTGA; the fragment length of the above primers is 661 bp; 3. PCR amplification system: 20 μL amplification system was used for amplification. The specific reagents are shown in Table 1. Table 1 PCR amplification system (20 μL) 4. Amplification procedure: After mixing the components in Table 1, pre-denature at 94°C for 3 minutes; then denature at 94°C for 30 seconds, anneal at 56°C for 40 seconds, and finally extend at 72°C for 40 seconds for 30 cycles; after the cycle, extend at 72°C for 10 minutes. Store at 4°C to obtain the PCR amplification product. The product was subjected to 1% agarose gel electrophoresis, and the results were as follows: Figure 1 As shown; Among them, lane 1: marker; lanes 2-3: goose plague virus RD2311B-E21; lane 4: GPV negative control; the results showed that it can be identified as goose plague virus RD2311B-E21.

[0034] Virulence of goose plague virus RD2311B-E21: After diluting the goose plague virus RD2311B-E21 with PBS (0.01mol / L, pH=7.2) at 1:100, inoculate 10 susceptible goose embryos at 12 days old through the allantoic cavity, 0.2ml per embryo, and incubate at 38°C; at least 8 goose embryos should die within 48-168h after inoculation. Dead embryos should have congested skin all over the body, and the spleen and liver should be yellow-brown. Some embryos should be congested and have bleeding edges.

[0035] Table 2 Analysis of goose embryo death Table 2 shows that goose plague virus RD2311B-E21 is a composite standard virus and can be used to prepare goose plague virus RD2311B-E21 yolk antibody.

[0036] Application Examples Application Example 1: A method for preparing goose plague virus yolk antibody: S1. Proliferation of goose plague virus RD2311B-E21: inoculate 12-day-old susceptible goose embryos with the goose plague virus RD2311B-E21 obtained in Example 1 through the allantoic cavity at a dose of 0.2 ml / piece, discard dead embryos within 48 hours, collect the allantoic fluid and embryos of goose embryos that died 72-120 hours ago and had typical lesions, grind the embryos with a wall-breaking machine, mix them with the allantoic fluid at a ratio of 1:1, centrifuge at 6000 rpm for 15 minutes, quantitatively pack the sterile supernatant, and freeze and store to obtain the antigen; The antigen was mixed with a 10% formaldehyde solution, and the mixture was shaken as it was added to fully mix the mixture, and the final concentration of the formaldehyde solution was 0.1%. The virus solution was then poured steadily into another sterile stainless steel barrel, and inactivated by stirring at 37° C. for 24 hours (the timing was started from when the antigen temperature rose to 37° C., and the mixture was stirred 3 times during the period). After the inactivation was completed, samples were taken for inactivation testing, and the inactivated virus solution was stored at 4° C. for standby use to obtain an inactivated virus solution; Weigh 94kg white oil and 6kg Span 80, mix them evenly, add 2kg aluminum stearate, heat to 90℃ while stirring, and then sterilize under high pressure at 121℃ for 30min to obtain oil phase; weigh 96kg antigen and 4kg sterilized Tween 80, mix them and shake them well to completely dissolve Tween 80 to obtain water phase; take 3kg oil phase and place it in a high-speed shear instrument, stir at a speed of 15000r / min, add 1kg water phase, and continue stirring for 6 minutes to fully emulsify the mixture; after emulsification, aseptically dispense into 250ml sterile bottles, indicate the name, preparation time, filling amount, etc. on the outer wall of the bottle, and store at 4℃ to obtain the immunogen; immunogen test: Property test: The immunogen is a milky white uniform emulsion, showing an oil-in-water type. Take a sterile pipette, draw 5 drops of the immunogen into cold water, except for the first drop, the others do not spread; Stability test: draw 10ml of the immunogen into a centrifuge tube, centrifuge at 3000r / min for 15min, the water phase precipitated at the bottom of the tube is 0.1ml, not more than 0.5ml, which is stable; Sterility test: according to the current "Chinese Veterinary Pharmacopoeia" Appendix test, after the test, it is sterile; Safety test: use 10 14-day-old SPF chickens, inject 2.0ml of the immunogen into the leg muscle, observe for 14 days, no local and systemic adverse reactions caused by the injection of the immunogen occur, so it is safe; S2. Inject the immunogen into 140-day-old laying hens by intramuscular injection at a volume of 0.5 mL to obtain one-immune eggs; then after 15 days, inject it into laying hens at a volume of 1 mL to obtain two-immune eggs; then after 15 days, inject it into laying hens at a volume of 1.5 mL / hen to obtain three-immune eggs; then after 30 days, inject it into laying hens at a volume of 2 mL / hen for four-immune, and start collecting eggs for testing 14 days after the four-immune. When the titer of the egg agar diffusion test is not less than 1:64, collect the eggs and store them at 4°C for use, to obtain four-immune eggs; S3, soaking the four-free eggs in a 0.1% chlorhexidine solution, then draining the water to remove surface dirt, spraying and fumigating the four-free eggs with 0.1% glutaraldehyde for 30 minutes, blowing the eggs dry and breaking them, and then separating the egg white from the light yellow to obtain the egg yolk; S4, mixing egg yolk and disodium hydrogen phosphate solution with a concentration of 0.02 mol / L in a volume ratio of 1:1, filtering with a 60-mesh sieve to remove impurities to obtain egg yolk liquid; adding 2 times the volume of disodium hydrogen phosphate solution to the egg yolk liquid, the concentration of the disodium hydrogen phosphate solution is 0.03 mol / L, the solvent is water, stirring at 1000 rpm for 60 min to obtain a mixed solution, the mixed solution has a pH value of about 7.2, a milky yellow color, turbidity, uniformity, and a turbid liquid; S5. Mix the turbid liquid and the sedimentation agent in a volume ratio of 1:1 to obtain a composite liquid; the sedimentation agent is prepared by mixing 6.66g of PVP, 4.16g of trehalose and 1L of water until they are completely dissolved; the sedimentation liquid is milky yellow, uniform and turbid; then adjust the pH of the sedimentation liquid to 6.0 with a 30% mass fraction citric acid solution, sedimentation treatment at 4°C for 12h, and transfer the supernatant; add octanoic acid at a final concentration of 0.1% to the supernatant, stir evenly, and let it stand for 4h; finally, sterilize and filter through a 0.22μm microporous filter element, filter with an ultrafiltration membrane with a molecular weight cutoff of 1000kDa to remove viruses, use an ultrafiltration membrane with a molecular weight cutoff of 100kDa to 2-fold concentrate the yolk antibody, package, seal with a cover, and store at 4°C to obtain the finished product.

[0037] Application Example 2: The difference between this application example and application example 1 is: S1. Proliferation of goose plague virus RD2311B-E21: inoculate 12-day-old susceptible goose embryos with the goose plague virus RD2311B-E21 obtained in Example 1 through the allantoic cavity at a dose of 0.2 ml / piece, discard dead embryos within 48 hours, collect the allantoic fluid and embryos of goose embryos that died 72-120 hours ago and had typical lesions, grind the embryos with a wall-breaking machine, mix them with the allantoic fluid at a ratio of 1:0.8, centrifuge at 6000 rpm for 15 minutes, quantitatively pack the sterile supernatant, and freeze and store to obtain the antigen; The antigen was mixed with a formaldehyde solution of 8%, and the mixture was shaken as it was added to fully mix the mixture. The final concentration of the formaldehyde solution was 0.08%. The virus solution was then poured steadily into another sterile stainless steel barrel, and inactivated by stirring at 37° C. for 26 hours (the timing was started from when the antigen temperature rose to 37° C., and the mixture was stirred 3 times during the period). After the inactivation was completed, samples were taken for inactivation testing. The inactivated virus solution was stored at 4° C. for standby use to obtain an inactivated virus solution. Weigh 90kg of white oil and 5kg of Span 80, mix them evenly, add 1kg of aluminum stearate, heat to 85°C while stirring, and then sterilize at 121°C for 30 minutes to obtain an oil phase; weigh 95kg of antigen and 3kg of sterilized Tween 80, mix them and shake them thoroughly to completely dissolve Tween 80 to obtain an aqueous phase; take 2.8kg of the oil phase and place it in a high-speed shear instrument, stir at a speed of 15000r / min, add 1kg of the aqueous phase, and continue stirring for 6 minutes to fully emulsify the mixture; after emulsification, aseptically dispense into 250ml sterile bottles, and indicate the name, preparation time, and packaging volume on the outer wall of the bottle. The amount was equal, and it was stored at 4°C to obtain the immunogen; S2, the immunogen was injected into 140-day-old laying hens by intramuscular injection at a volume of 0.4mL to obtain a one-immune egg; then 14 days later, it was injected into laying hens at a volume of 0.9mL to obtain a two-immune egg; then 14 days later, it was injected into laying hens at a volume of 1.3mL / hen to obtain a three-immune egg; then 28 days later, it was injected into laying hens at a volume of 1.8mL / hen for four-immune, and 14 days after the four-immune, laying hens were collected for testing, and when the titer of the laying hen agar diffusion test was not less than 1:64, the eggs were collected and stored at 4°C for standby use to obtain four-immune eggs; S3, soaking the four-free eggs in a 0.08% chlorhexidine solution, then draining the water to remove surface dirt, spraying and fumigating the four-free eggs with 0.08% glutaraldehyde for 32 minutes, blowing the eggs dry and then breaking the eggs, and then separating the egg white from the light yellow to obtain the egg yolk; S4, mixing egg yolk and disodium hydrogen phosphate solution with a concentration of 0.02 mol / L in a volume ratio of 1:0.8, filtering with a 60-mesh sieve to remove impurities to obtain egg yolk liquid; adding 2 volumes of disodium hydrogen phosphate solution to the egg yolk liquid, the concentration of the disodium hydrogen phosphate solution is 0.03 mol / L, the solvent is water, stirring at 1000 rpm for 60 min to obtain a mixed solution, the mixed solution has a pH value of about 7.2, a milky yellow color, turbidity, uniformity, and a turbid liquid; S5. Mix the turbid liquid and the sedimentation agent at a volume ratio of 1:0.8 to obtain a composite liquid; the sedimentation agent is prepared by mixing 6.62g of PVP, 4.12g of trehalose and 1L of water until they are completely dissolved; the sedimentation liquid is milky yellow, uniform and turbid; then adjust the pH of the sedimentation liquid to 6.0 with a 30% mass fraction citric acid solution, sedimentate at 3°C ​​for 14h, and transfer the supernatant; add caprylic acid to a final concentration of 0.08% to the supernatant, stir evenly, and let it stand for 2h; finally, sterilize and filter through a 0.22μm microporous filter element, filter with an ultrafiltration membrane with a molecular weight cutoff of 1000kDa to remove viruses, use an ultrafiltration membrane with a molecular weight cutoff of 100kDa to 2-fold concentrate the yolk antibody, package, seal with a cover, and store at 4°C to obtain a finished product.

[0038] Application Example 3: The difference between this application example and application example 1 is: S1. Proliferation of goose plague virus RD2311B-E21: inoculate 12-day-old susceptible goose embryos with the goose plague virus RD2311B-E21 obtained in Example 1 through the allantoic cavity at a dose of 0.2 ml / piece, discard dead embryos within 48 hours, collect allantoic fluid and embryos of goose embryos that died 72-120 hours ago and have typical lesions, grind the embryos with a wall-breaking machine and then mix them with the allantoic fluid at a ratio of 1:1.2, centrifuge at 6000 rpm for 15 minutes, quantitatively pack the sterile supernatant, freeze and store, and obtain the antigen; The antigen was mixed with a 1.2% formaldehyde solution, and the mixture was shaken as it was added to fully mix the mixture. The final concentration of the formaldehyde solution was 0.12%. The virus solution was then poured steadily into another sterile stainless steel barrel, and inactivated by stirring at 38° C. for 24 hours (the timing was started from when the antigen temperature rose to 37° C., and the mixture was stirred 3 times during the period). After the inactivation was completed, samples were taken for inactivation testing. The inactivated virus solution was stored at 4° C. for standby use to obtain an inactivated virus solution. Weigh 96kg white oil and 8kg Span 80, mix them evenly, add 3kg aluminum stearate, heat to 95°C while stirring, and then sterilize at 121°C for 30min to obtain an oil phase; weigh 97kg antigen and 5kg sterilized Tween 80, mix them and shake them well to completely dissolve Tween 80 to obtain an aqueous phase; take 3.2kg of the oil phase and place it in a high-speed shear instrument, stir at a speed of 15000r / min, add 1kg of the aqueous phase, and continue stirring for 6 minutes to fully emulsify the mixture; after emulsification, aseptically dispense into 250ml sterile bottles, and indicate the name, preparation time, and packaging volume on the outer wall of the bottle. The amount was equal, and it was stored at 4°C to obtain the immunogen; S2, the immunogen was injected into 140-day-old laying hens by intramuscular injection at a volume of 0.6mL to obtain a one-immune egg; then after 16 days, it was injected into laying hens at a volume of 1.2mL to obtain a two-immune egg; then after 16 days, it was injected into laying hens at a volume of 1.6mL / hen to obtain a three-immune egg; then after 32 days, it was injected into laying hens at a volume of 2.2mL / hen for four-immune, and eggs were collected for testing 14 days after the four-immune, and when the titer of the egg agar diffusion test was not less than 1:64, the eggs were collected and stored at 4°C for standby use to obtain four-immune eggs; S3, soaking the four-free eggs in a 0.12% chlorhexidine solution, then draining the water to remove surface dirt, spraying and fumigating the four-free eggs with 0.12% glutaraldehyde for 28 minutes, blowing the eggs dry and breaking them, and then separating the egg white from the light yellow to obtain the egg yolk; S4, mixing egg yolk and disodium hydrogen phosphate solution with a concentration of 0.03 mol / L in a volume ratio of 1:1.2, filtering with a 60-mesh sieve to remove impurities to obtain egg yolk liquid; adding 2.2 times the volume of disodium hydrogen phosphate solution to the egg yolk liquid, the concentration of the disodium hydrogen phosphate solution is 0.03 mol / L, the solvent is water, stirring at 1000 rpm for 60 min to obtain a mixed solution, the mixed solution has a pH value of about 7.2, a milky yellow color, turbidity, uniformity, and a turbid liquid; S5. Mix the turbid liquid and the sedimentation agent in a volume ratio of 1:1.2 to obtain a composite liquid; the sedimentation agent is prepared by mixing 6.68g of PVP, 4.20g of trehalose and 1L of water until they are completely dissolved; the sedimentation liquid is milky yellow, uniform and turbid; then adjust the pH of the sedimentation liquid to 6.0 with a 30% mass fraction citric acid solution, sedimentation treatment at 5°C for 10h, and transfer the supernatant; add octanoic acid at a final concentration of 0.12% to the supernatant, stir evenly, and let it stand for 6h; finally, sterilize and filter through a 0.22μm microporous filter element, filter with an ultrafiltration membrane with a molecular weight cutoff of 1000kDa to remove viruses, use an ultrafiltration membrane with a molecular weight cutoff of 100kDa to 2-fold concentrate the yolk antibody, package, seal with a cover, and store at 4°C to obtain the finished product.

[0039] Performance testing 1. Potency test The egg yolk antibodies were prepared in the manners of Application Examples 1-3 respectively, the titers of the egg yolk antibodies were tested, and the data were recorded.

[0040] 2. Purity testing The egg yolk antibodies were prepared in the manners of Application Examples 1-3 respectively, the purity of the egg yolk antibodies was tested, and the data were recorded.

[0041] Table 3 Performance test table project Potency purity / % Application Example 1 1:20 99.5 Application Example 2 1:17 99.0 Application Example 3 1:21 99.6 Combined with the data in Table 3, it can be seen that the prepared egg yolk antibody has the advantages of high titer and high purity.

[0042] 3. Treatment and prevention effect detection The goose plague virus RD2311B-E21 obtained after separation and purification in Example 1 was diluted 10 times with PBS (0.01mol / L, pH=7.2), with a total of 8 dilutions. For each dilution, 10 susceptible goose embryos (200μL / embryo) at 12 days of age were inoculated through the allantoic cavity, and a blank control group was set up and incubated at 38°C. After infection, the goose embryos were observed every day, and the goose embryos that died within 48 hours were discarded. Thereafter, they were observed every 24 hours for 168 hours. The cumulative number of goose embryos with lesions and those without lesions at each dilution was counted. The EID of the virus in each 0.2mL suspension was calculated according to the Reed-Muench method. 50 .

[0043] Table 4 Mortality of inoculated goose embryos and ELD of GPV isolates 50 4. Goose plague virus RD2311B-E21 challenge and protection test 950 4-day-old specific pathogen-free geese were randomly divided into 4 groups and weighed. Group 1 with 50 geese was used as negative control group, and Group 2 with 300 geese was used as non-treatment control group. 4-day-old geese were subcutaneously inoculated with gosling plague virus in the neck, with 0.5 mL (containing 200 ELD 50 ), the third group of 300 geese were challenged and treated with gosling plague virus, and 0.5 mL (containing 200 ELD 50 ), 1 ml of egg yolk antibody was injected 24 hours later, and 300 gooses in the fourth group were used as the anti-virus group. 1 ml of egg yolk antibody was injected intramuscularly in 4-day-old goslings, and goose plague virus was inoculated subcutaneously in the neck 24 hours later, with 0.5 ml (containing 200 ELD 50 ), and were isolated and raised separately. The specific operation is shown in Table 1. Clinical observation was carried out every day after the challenge, and the incidence and mortality were counted. On the 10th day after the challenge, all goslings were euthanized and autopsied (the method for judging the lesions: the autopsy showed that the liver was enlarged with necrotic spots on the surface; the duodenum was enlarged and the intestinal mucosa was shed).

[0044] Table 5 Goose plague challenge and protection test plan Results of PCR test for goose plague virus before and after infection Figure 2 As shown: Lane 1: maker; Lanes 2 and 3 are band diagrams before challenge; Lanes 4-5, 6-7, 8-9 are electrophoresis diagrams of the heart, liver, and spleen dissected after challenge, respectively; Lane 10: GPV blank control.

[0045] Combined with Table 4, Table 5, Figure 2 , 3 It can be seen that in Group 1, there was 0 gosling death 10 days after infection; in Group 2, the non-treatment group infected with poison had 280 / 300 gosling deaths 10 days after infection, and the protection rate was 6%; in Group 3, the treatment group infected with poison had 3 / 300 gosling deaths 10 days after infection, and the protection rate was 99%; in Group 4, the prevention group infected with poison had 4 / 300 gosling deaths 10 days after infection, and the protection rate was 99%; this indicates that in the face of the attack of the gosling plague strain, the protection rate is 99%-100%, and the yolk antibody can effectively prevent and treat the incidence of gosling plague.

[0046] 4. Large-scale experiment on goose plague A large goose test area in Suzhou was selected, and one of the diseased goose houses was selected as the test object. The goose house was divided into two isolation areas, 1 and 2, and 1,500 3-week-old geese were raised in each area. The diseased geese in areas 1 and 2 were treated separately. The geese in area 1 were injected with 1 mL / goose of goose plague yolk antibody purchased from the market; the goose house in area 2 was injected with 1 mL / goose of yolk antibody prepared in application example 1. The gooses were observed for 10 consecutive days and the disease status of the goslings was recorded (the method for judging the onset of goose plague: depression, slow walking, loss of appetite or loss of appetite, loose feathers, retracted head and neck, closed eyes and standing still, some discharged gray-white watery feces, and the dead geese had serous nasal discharge from the nostrils).

[0047] The results showed that after 7 days of treatment with goose plague yolk antibodies, the protection rate of geese in zone 1 was 83.5%, and the protection rate of geese in zone 2 was 97%. Facing the attack of goose plague virus, the yolk antibody prepared in this application has a better protective effect than the commercially available yolk antibody and has a better prevention and control effect.

[0048] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed. However, as long as it is within the scope of the claims of the present application, it shall be protected by the patent law.

Claims

1. A goose plague virus, It is characterized in that The goose plague virus is deposited in the General Microbiology Center of the China Culture Collection Administration, named goose plague virus RD2311B-E21, the preservation date is April 22, 2024, and the preservation number is CGMCCNO.45964.

2. A goose plague virus according to claim 1, It is characterized in that The virus separation and purification steps are as follows: adding the diseased tissue to a sterile PBS solution at a ratio of 1:1.8-2 (W / V), then grinding to obtain a slurry, freezing and thawing, centrifuging, taking the supernatant to separate the strains, filtering, and preserving, and after blind passage in the allantoic cavity of goose embryos for three generations, separating and purifying to obtain the goose plague virus RD2311B-E21.

3. The method for preparing goose plague virus yolk antibody according to claim 2, It is characterized in that The diseased tissue is one or more of the liver, kidney and intestine of the diseased goose.

4. A method for preparing goose plague virus yolk antibody, Features: The steps include: S1. Goose plague virus RD2311B-E21 is proliferated, inactivated, and used to prepare an immunogen; the goose plague virus RD2311B-E21 is selected from the goose plague virus RD2311B-E21 described in any one of claims 1 to 3; S2, the immunogen was injected four times into laying hens to obtain four immune eggs; S3, soaking the four-free eggs in a 0.08-0.12% chlorhexidine solution, then draining the water to remove surface dirt, spraying and fumigating the four-free eggs with 0.08-0.12% glutaraldehyde for 28-32 minutes, blowing the eggs dry and then breaking the eggs, and then separating the egg white and yolk to obtain the egg yolk; S4, mixing the egg yolk and the sodium hydrogen phosphate solution with a concentration of 0.02-0.03 mol / L in a volume ratio of 1:0.8-1.2, filtering to remove impurities to obtain an egg yolk liquid; adding 2-2.2 times the volume of the sodium hydrogen phosphate solution to the egg yolk liquid, stirring and mixing, and obtaining a turbid liquid; S5. Evenly mix the turbid liquid and the sedimentation agent at a volume ratio of 1:0.8-1.2, and then adjust the pH of the sedimentation liquid to 6.0 with a citric acid solution, and carry out sedimentation treatment at 3-5°C for 10-14h, ultrafilter to remove viruses, ultrafilter and concentrate, and package to obtain a finished product.

5. The method for preparing goose plague virus yolk antibody according to claim 4, It is characterized in that The specific steps of proliferation in S1 are as follows: The goose plague virus RD2311B-E21 was inoculated into 12-day-old embryos through the allantoic cavity, and dead fetuses aged 48 hours were discarded. Then, the allantoic fluid and embryos of goose embryos that died and were diseased within 72-120 hours were collected, and the embryos were crushed and ground and mixed with the allantoic fluid at a ratio of 1:0.8-1.2, and then centrifuged and the supernatant was packaged to obtain the antigen.

6. The method for preparing goose plague virus yolk antibody according to claim 4, It is characterized in that The specific steps of inactivation in S1 are as follows: The antigen was mixed with a formaldehyde solution of 8-11% concentration, the final concentration of the formaldehyde solution was 0.08-0.12%, and then stirred and inactivated at 37-38°C for 24-26 hours to obtain an inactivated virus solution.

7. The method for preparing goose plague virus yolk antibody according to claim 4, It is characterized in that The specific steps of preparing the immunogen in S1 are as follows: Take 90-96 parts of white oil, 5-8 parts of Span 80, and 1-3 parts of aluminum stearate by weight, mix and stir, heat to 85-95°C, and kill at high temperature to obtain an oil phase; take 95-97 parts of antigen and 3-5 parts of sterilized Tween 80 by weight and mix well to obtain a water phase; mix the oil phase and the water phase at a volume ratio of 2.8-3.2:1, stir and emulsify, and then package to obtain an immunogen.

8. The method for preparing goose plague virus yolk antibody according to claim 4, It is characterized in that The S2 immunogen is injected into laying hens at an injection volume of 0.4-0.6 mL to obtain one-immune eggs; after 14-16 days, it is injected into laying hens at an injection volume of 0.9-1.2 mL to obtain two-immune eggs; then after 14-16 days, it is injected into laying hens at an injection volume of 1.3-1.6 mL / hen to obtain three-immune eggs; then after 28-32 days, it is injected into laying hens at an injection volume of 1.8-2.2 mL / hen to obtain four-immune eggs.

9. The method for preparing goose plague virus yolk antibody according to claim 4, It is characterized in that The S5 sedimentation agent is prepared by mixing 6.62-6.68 g of PVP, 4.12-4.20 g of trehalose and 1 L of water.

10. The method for preparing goose plague virus yolk antibody according to claim 4, It is characterized in that The citric acid solution is a citric acid aqueous solution with a mass fraction of 28-32%.

Images