piRNA-400431 and its applications
Through piRNA-400431 as a target, drugs and diagnostic reagents that inhibit their expression were developed, which solved the problem of insufficient early symptoms of liver cancer and low selectivity of traditional chemotherapy, and achieved efficient inhibition and diagnosis of liver cancer cells.
Patent Information
- Application Number
- CN202411370769.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-29
- Publication Date
- 2025-08-19
- Estimated Expiration
- 2044-09-29
AI Technical Summary
In the prior art, the early symptoms of liver cancer are not obvious, the traditional chemotherapy has low selectivity and great side effects, and lacks effective molecular mechanism research and treatment methods.
Using piRNA-400431 as a target, drugs and diagnostic reagents that inhibit their expression were developed. The expression level of liver cancer cells was reduced through piRNA-400431 inhibitors and blocked the growth, metastasis and invasion of liver cancer cells.
piRNA-400431 is highly expressed in liver cancer tissues and cells, has high specificity and sensitivity, and can significantly inhibit the proliferation, cloning, invasion and migration of liver cancer cells, providing a new liver cancer treatment strategy.
Smart Images

Figure CN119162178B_ABST
Abstract
Description
Technical field:
[0001] The present invention specifically relates to piRNA-400431, and its use as a target in the preparation or screening of liver cancer therapeutic drugs, as well as its use in the preparation of liver cancer diagnostic preparations. Background technology:
[0002] Liver cancer has a high incidence and mortality rate. Its incidence ranks fifth among solid tumors worldwide and is the second leading cause of cancer-related deaths. Due to its unclear early symptoms, most cases will have distant metastases by the time they are discovered, and the prognosis remains poor after treatment. Chemotherapy is the preferred treatment for systemic treatment of liver cancer, but traditional chemotherapy has low selectivity for tumor cells and significant side effects. Therefore, exploring the molecular mechanisms of HCC occurrence and development is the key to its research, and finding effective treatments is an urgent problem to be solved.
[0003] piRNAs are a complex class of small noncoding RNAs discovered in Drosophila germ cells in 2006. Most are 24 to 31 nucleotides in length. In-depth research on piRNAs has revealed that they play important roles in germ cell and embryonic development, stem cell function maintenance, germline gene integrity maintenance, transposon transcriptional silencing, translational repression, and cancer development and progression. The mechanisms of action of noncoding RNAs, particularly piRNAs, in liver diseases remain largely unknown. However, piRNAs play a key role in the development and progression of liver cancer and may serve as biomarkers and novel therapeutic targets for the disease. Therefore, research into the functions and mechanisms of piRNAs is of great scientific and clinical significance. Summary of the invention:
[0004] The primary objective of the present invention is to provide a novel piRNA, namely piRNA-400431, and its use in the preparation and / or screening of drugs for the treatment of liver cancer. This invention, for the first time, discovers that piRNA-400431 expression levels in liver cancer may be associated with the development, progression, and prognosis of the disease, with high specificity and sensitivity. Therefore, based on this liver cancer marker, a new liver cancer therapeutic target has been provided. A therapeutic strategy targeting piRNA-400431 has been developed, providing new insights and directions for the treatment of liver cancer.
[0005] The present invention provides piRNA-400431, nucleic acid sequence:
[0006] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAGC AAC.
[0007] The present invention provides the use of the piRNA-400431 in the preparation and / or screening of drugs for treating liver cancer.
[0008] Furthermore,
[0009] The liver cancer treatment drug includes a preparation that inhibits the expression level of piRNA-400431.
[0010] Furthermore,
[0011] The preparation for inhibiting the expression level of piRNA-400431 is a piRNA-400431 inhibitor.
[0012] Preferably, the inhibitor sequence is: AAGCAACATCAGTCTGATAAGCTA.
[0013] The second object of the present invention is to provide a drug for treating liver cancer, including a preparation for inhibiting the expression level of piRNA-400431.
[0014] Furthermore,
[0015] The preparation for inhibiting the expression level of piRNA-400431 is a piRNA-400431 inhibitor.
[0016] Preferably, the inhibitor sequence is: AAGCAACATCAGTCTGATAAGCTA.
[0017] The third object of the present invention is to provide a reagent for detecting the piRNA-400431 and its use in preparing a liver cancer diagnostic preparation.
[0018] Furthermore,
[0019] The reagent for detecting the piRNA-400431 includes a reagent for detecting the expression level of piRNA-400431.
[0020] Furthermore,
[0021] The reagents for detecting the expression of piRNA-400431 include PCR reagents, and the preferred PCR primer sequences are:
[0022] F:5'-GCTTATCAGACTGATGTTGCTT-3'
[0023] R:5'-GCAGGGTCCGAGGTTATTC-3'.
[0024] The present invention uses piRNA-400431 as a target for RNA interference (RNAi) to develop a tumor therapeutic drug or formulation that targets the piRNA-400431 gene, thereby reducing the expression level of the piRNA-400431 gene in tumor cells. A nucleic acid molecule that reduces the expression level of piRNA-400431 in liver cancer cells is provided. The nucleic acid molecule that reduces the expression level of piRNA-400431 in tumor cells is primarily a piRNA-400431 inhibitor, the sequence of which is: AAGCAACATCAGTCTGATAAGCTA; the control piRNA-NC sequence is: UUCUCCGAACGUGUCACGU.
[0025] Preliminary studies of the present invention revealed that piRNA-400431 was highly expressed in liver cancer tissue samples and liver cancer cell lines. Treatment with a piRNA-400431 inhibitor reduced expression in liver cancer cell lines and reduced the colony formation, invasion, and migration of liver cancer cells. Further pilot animal studies suggested that the piRNA-400431 inhibitor significantly inhibited liver cancer cell growth. This present invention provides a scientific basis for the use of piRNA as a therapeutic strategy for liver cancer and offers new insights into targeting piRNA-400431 to improve the efficacy of liver cancer treatment.
[0026] In summary, this study provides a novel therapeutic target for liver cancer, a therapeutic strategy targeting the piRNA-400431 gene. Interference with piRNA-400431 may help block the growth, metastasis, and invasion of liver cancer cells, thus providing new insights and directions for liver cancer treatment, with far-reaching clinical significance and promising prospects for widespread application.
[0027] The present invention also provides a new liver cancer marker piRNA-400431, which is upregulated in liver cancer tissues and cells with statistical significance. Compared with traditional liver cancer markers, the piRNA-400431 gene may have higher specificity and sensitivity.
[0028] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, without limiting the present invention. Description of the drawings:
[0029] Figure 1 The differential piRNA expression analysis of 5 pairs of HCC tissues and corresponding normal tissues; Figure 1 A is the clustering heat map of differentially expressed piRNAs and Figure 1 B is a volcano analysis diagram.
[0030] Figure 2A is the expression level of piRNA-400431 in cancer tissues and adjacent tissues of HCC patients; Figure 2 B is the expression level of piRNA-400431 in liver cancer cells; Figure 2 C shows the expression level of piRNA-400431 in Hep3B and HepG2 liver cancer cells after transfection with the piRNA-400431 inhibitor. (Statistical analysis between the two groups was performed using an independent sample t-test; ** represents p < 0.01 and *** represents p < 0.001.)
[0031] Figure 3 The receiver operating characteristic (ROC) curve was used to evaluate the sensitivity and specificity of piRNA-400431 for the diagnosis of liver cancer. The AUC value was 0.803, the sensitivity was 0.702, and the specificity was 0.904.
[0032] Figure 4 To inhibit the proliferation and migration of liver cancer cells after using piRNA-400431 inhibitor; Figure 4 A shows the cell proliferation of HepG2 cells after transfection of piRNA-NC and piRNA-inhibitor; Figure 4 B shows the formation of cell clones after piRNA-NC and piRNA-inhibitor transfection into HepG2 cells; Figure 4 C shows the invasion and migration of HepG2 cells after piRNA-NC and piRNA-inhibitor transfection. (Independent sample t-test was used for statistical analysis between the two groups; ** indicates p < 0.01).
[0033] Figure 5 The figure shows the tumor growth after nude mice were subcutaneously inoculated with piRNA-NC and piRNA-inhibitor transfected HepG2 cell lines. Specific implementation method:
[0034] The following examples are intended to further illustrate the present invention, but are not intended to limit the present invention.
[0035] 1.1 Sample Collection
[0036] A total of 60 cancerous tissues and 60 adjacent tissues from liver cancer patients were collected. The clinical samples had complete clinical data, including the patient's name, gender, age, hospitalization number, pathological type, pathological stage, treatment status, etc. The consent of the subjects was obtained for all clinical samples.
[0037] 1.2 RNA-Seq sequencing to screen differentially expressed piRNAs
[0038] RNA-Seq sequencing was performed on liver cancer tissues to screen for differentially expressed piRNAs. This part of the experiment was completed by Guangzhou Ruibo Biotechnology Co., Ltd. The specific steps are as follows: First, the total RNA sample was pre-treated and then cDNA was synthesized. Green qPCR Master Mix and cDNA template were loaded into a well plate and amplified using an ABI7900 real-time fluorescence quantitative PCR instrument. PiRNAs with significantly abnormal expression were screened based on a fold change ≥ 2 and a p-value < 0.05.
[0039] RNA-seq results analysis
[0040] RNA sequencing was performed on total RNA obtained from five pairs of HCC and normal tissues. Based on the differential expression levels of dysregulated piRNAs (|fold change| ≥ 2 and p value < 0.05), heat maps and volcano plots of piRNA differential expression were plotted ( Figure 1 We selected piRNA-400431, which was significantly upregulated in HCC tissues, for qPCR validation.
[0041] 1.3 Extraction and reverse transcription of total RNA from tissue samples and cell lines
[0042] RNA was extracted from tissues or cells using an RNA extraction kit, the RNA concentration was measured using NanoDrop, and then reverse-transcribed into cDNA using a reverse transcription kit.
[0043] Reverse transcription was performed using a reverse transcription kit, and the system was as follows:
[0044]
[0045]
[0046] Reaction conditions:
[0047] 42°C, 90 minutes; 95°C, 5 minutes; and cooling on ice to obtain a cDNA solution.
[0048] Fluorescence quantitative PCR: First, PCR detection was performed for piRNA-400431 primers (synthesized by Sangon Biotechnology Co., Ltd.) as follows:
[0049] F:5'-GCTTATCAGACTGATGTTGCTT-3'
[0050] R:5'-GCAGGGTCCGAGGTTATTC-3'
[0051] The PCR product was sequenced to confirm the correct sequence of piRNA-400431. The relative expression of piRNA-400431 was detected using SYBR Green Mixture with -actin as an internal reference.
[0052] Fluorescence quantitative PCR system
[0053]
[0054] PCR conditions
[0055]
[0056] After the PCR process is completed, the Ct value of each PCR reaction is obtained and the Ct value is expressed as 2 -ΔΔCt The relative expression levels of circular RNAs were calculated.
[0057] Based on the sequence of piRNA-400431, an inhibitor that specifically knocks down piRNA-400431 was designed.
[0058] Its sequence: AAGCAACATCAGTCTGATAAGCTA
[0059] Control NC sequence: UUCUCCGAACGUGUCACGU.
[0060] 1.3 Inhibitor transfection cells
[0061] Cells were transfected with piRNA-NC and piRNA-inhibitor, respectively: liver cancer cells (Hep3B and HepG2) were plated in 24-well plates and transfected with 1ipo3000 transfection reagent (purchased from Thermo Fisher). 25 pmol inhibitor was added to each well. Cell RNA was extracted after 72 hours, and the expression of piRNA-400431 was detected by real-time fluorescence quantitative PCR.
[0062] The experimental results showed that piRNA-400431 was highly expressed in liver cancer tissues and cells, and the use of inhibitors in liver cancer cells (Hep3B and HepG2) could reduce the expression of piRNA-400431 ( Figure 2 ).
[0063] 1.4 CCK-8 assay for cell proliferation
[0064] The hepatoma cells (Hep3B and HepG2) transfected with piRNA-NC and piRNA-inhibitor were counted and the number of cells was 1×10 3The number of liver cancer cells per well was seeded into 96-well plates in 100 μL of complete culture medium and cultured in a 37°C incubator. At a 10% CCK-8 concentration (10 μL of CCK-8 solution was added to 100 μL of complete culture medium), 100 μL was aspirated and added to the 96-well plate. After incubation at 37°C for 2 hours, the absorbance (OD) of each well was measured at a wavelength of 450 nm using a microplate reader.
[0065] The experimental results showed that piRNA-400431 inhibitors can significantly inhibit the proliferation of liver cancer cells HepG2 ( Figure 4 A).
[0066] 1.5 Clone formation assay
[0067] Add 3 × 10 2 Cells were cultured for approximately 14 days, with the culture medium replaced every 3 days. The culture medium was then discarded from the wells, and the cells were washed 2-3 times with PBS. The cells were fixed with 4% paraformaldehyde for 10-15 minutes, then stained with 0.1% crystal violet for 10 minutes. Excess crystal violet was removed by aspiration, and the cells were rinsed with running water. Clusters of 50 or more cells were counted as one clone. The number of cell clones in the different treatment groups was calculated and statistically analyzed.
[0068] The experimental results showed that piRNA-400431 inhibitors can significantly inhibit the cloning ability of liver cancer cells HepG2 ( Figure 4 B).
[0069] 1.6 Transwell assay
[0070] Take 250 μL of 2×10 5 A resuspended liver cancer cell suspension (in FBS-free medium) was added to the upper chamber of a Transwell chamber, and medium containing 10% FBS was added to the lower chamber. After incubation at 37°C for 1-2 days, the medium in the upper chamber was aspirated and the cells were washed twice with PBS. The cells were fixed with 4% paraformaldehyde for 10-15 minutes, then stained with 0.1% crystal violet for 10 minutes. Excess violet was aspirated and the cells were rinsed with running water. The number of cells that passed through the membrane below the upper chamber was counted under a light microscope for statistical analysis.
[0071] The experimental results showed that piRNA-400431 inhibitors can significantly inhibit the invasion and migration ability of liver cancer cells HepG2 ( Figure 4 C).
[0072] 1.7 Nude mouse tumor formation assay
[0073] HepG2 cells transfected with piRNA-NC and piRNA-inhibitor were plated on a 10 cm dish. When the number of cells reached the injection standard, they were digested and counted. 2×10 6 The cells were injected subcutaneously into BALB / c nude mice, and the tumors were removed on day 25 and their weights were calculated.
[0074] Figure 5 The experimental results suggest that piRNA-400431 inhibitors have an inhibitory effect on the growth of liver cancer cells HepG2.
Claims
1. Use of a preparation for inhibiting the expression level of piRNA-400431 in the preparation of a drug for treating liver cancer; the sequence of the preparation for inhibiting the expression level of piRNA-400431 is AAGCAACATCAGTCTGATAAGCTA.
2. Application of reagents for detecting piRNA-400431 in the preparation of liver cancer diagnostic preparations.
3. The use according to claim 2, characterized in that The reagent for detecting piRNA-400431 includes a reagent for detecting the expression amount of piRNA-400431.
4. The use according to claim 3, characterized in that Reagents for detecting the expression of piRNA-400431 include PCR reagents.
5. The use according to claim 4, characterized in that The PCR primer sequences are: F:5'-GCTTATCAGACTGATGTTGCTT-3 R:5'-GCAGGGTCCGAGGTTATTC-3'.