Application of StPYL16 gene in enhancing plant drought stress resistance

Abstract

The invention discloses an application of StPYL16 gene in enhancing drought stress resistance of plants, and relates to the field of biotechnology. The nucleotide sequence of the StPYL16 gene is shown in SEQ ID NO.1. The transient and stable expression of the StPYL16 gene in tobacco can enhance the drought resistance of transgenic plants, leading to improvements in plant height, stem thickness and root development. In addition, compared with wild-type plants, StPYL16 transgenic tobacco exhibits lower malondialdehyde content, higher proline accumulation and stronger SOD, POD and CAT activities. At the same time, the StPYL16 gene also up-regulates the expression level of stress-related genes in transgenic plants under drought treatment. These findings indicate that the StPYL16 gene plays an active regulatory role in the response of potato to drought stress, and the drought stress resistance of plants can be improved by overexpressing the StPYL16 gene.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of StPYL16 gene in enhancing plant drought stress resistance. Background Art

[0002] Plant growth and development are often affected by various abiotic stresses, including cold, drought, and salinity. Abiotic stress is a major hidden danger in agricultural production and often leads to crop yield reduction. After exposure to abiotic stress, plants need to coordinate physiological and biochemical responses and gene regulation to adapt to adverse environmental conditions. Gene regulation is closely related to stress-triggered hormone signaling pathways. Studies have revealed that the plant hormone abscisic acid (ABA) plays a vital role in the plant response to abiotic stress.

[0003] ABA signaling is initially recognized and triggered by the presence of ABA, and ABA perception is achieved through the binding of ABA receptors to the hormone. The main types of ABA receptors are PYR (pyrabactin resistance) / PYL (PYR-like) / RCAR (regulatory component of ABA receptor), which are localized in the nucleus and cytoplasm. PYR / PYL / RCAR (hereafter referred to as PYL) ABA receptors together with protein phosphatase 2C (PP2C) and SNF1-related protein kinase 2 (SnRK2) form a core ABA signaling network characterized by a dual negative regulatory mechanism. In the absence of ABA, PP2Cs bind to SnRK2s, thereby inhibiting the activity of SnRK2 proteins. When ABA levels increase, ABA is recognized and bound by its receptors, triggering an interaction between the ABA receptor complex and PP2Cs. As a result, SnRK2s are released from inhibition, leading to the activation of downstream target gene expression. In plants, many ABA receptors, protein phosphatases, and kinases have been recognized as key elements in the ABA signaling pathway. For example, Arabidopsis thaliana has 14 PYR / PYL receptors, 76 PP2C phosphatases, and 10 SnRK2 kinases. Following the study of Arabidopsis thaliana, members of the PYL, PP2C, and SnRK2 families have also been discovered in other plants, such as rice, corn, and tomato.

[0004] As a stress hormone, ABA content in plants increases rapidly under abiotic stress conditions, especially drought and salt stress. In recent years, the role of ABA receptors in plant responses to abiotic stress has been gradually elucidated, but research on the biological functions and regulatory effects of ABA-related genes in potato stress responses is limited.

[0005] Potato (Solanum tuberosum L.), as the world's fourth largest crop, plays a vital role in global food security. However, in areas such as Gansu, China, which are famous for their low rainfall, potatoes often encounter various stresses during their growth, especially drought. The inventor team focuses on developing drought-resistant potato varieties, identifying drought-resistant genes, and analyzing regulatory mechanisms. Progress has been made in studying hormonal regulation of potato growth and stress response. However, the characteristics of potato PYL genes and their functions in drought stress response remain largely unexplored. On this basis, the present invention screens and identifies new PYL genes that respond to drought stress based on transcriptome data of potatoes under drought stress, thereby providing strong technical support for breeding potato drought-resistant varieties. Summary of the invention

[0006] The purpose of the present invention is to provide an application of the StPYL16 gene in enhancing plant drought stress resistance, so as to solve the problems existing in the above-mentioned prior art. The drought stress resistance of the plant can be improved by overexpressing the StPYL16 gene.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a StPYL16 gene with drought resistance, and the nucleotide sequence of the StPYL16 gene is shown as SEQ ID NO.1.

[0009] The present invention also provides a recombinant expression vector, comprising the StPYL16 gene.

[0010] The present invention also provides a host cell, comprising the above-mentioned recombinant expression vector.

[0011] Furthermore, the host cell is a recombinant Agrobacterium.

[0012] The present invention also provides the use of the StPYL16 gene, recombinant expression vector or host cell in enhancing plant drought stress resistance.

[0013] Furthermore, the plant is potato or tobacco.

[0014] The present invention also provides a method for enhancing plant drought stress resistance, comprising the steps of genetically transforming the StPYL16 gene into a plant body, overexpressing the gene in the plant body, and cultivating a transgenic plant with drought resistance.

[0015] Furthermore, the genetic transformation adopts Agrobacterium transformation method.

[0016] Furthermore, the Agrobacterium transformation method adopts Agrobacterium-mediated leaf disc transformation method.

[0017] The present invention discloses the following technical effects:

[0018] The present invention identifies a potato PYL gene named StPYL16 based on transcriptome data under drought stress. Molecular characterization analysis shows that the StPYL16 protein has an extremely conserved PYL family domain. Tissue expression results show that the StPYL16 gene is mainly expressed at a high level in underground parts, especially in tubers. Abiotic stress responses show that StPYL16 has a significant response to ABA and drought conditions. Further studies on the promoter show that ABA and drought stress can enhance the promoter activity of the StPYL16 promoter on the reporter gene. Then, transient and stable expression of StPYL16 in tobacco enhances the drought resistance of transgenic plants, resulting in improved plant height, stem thickness and root development. In addition, compared with wild-type plants, StPYL16 transgenic tobacco exhibits lower malondialdehyde (MDA) content, higher proline (Pro) accumulation, and stronger SOD, POD and CAT activities. At the same time, StPYL16 also upregulated the expression levels of stress-related genes (NtSOD, NtCAT, NtPOD, NtRD29A, NtLEA5 and NtP5CS) in transgenic plants under drought treatment. These findings indicate that the StPYL16 gene plays an active regulatory role in the potato response to drought stress, and overexpression of the StPYL16 gene can improve the drought stress resistance of plants.

[0019] The present invention identifies a new PYL gene that responds to drought stress, providing strong technical support for breeding drought-resistant potato varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 This is the result of transcriptome analysis of StPYL family gene expression under drought stress;

[0022] Figure 2 This is the result of tissue expression analysis of StPYL16 gene;

[0023] Figure 3The results of qPRC analysis of StPYL16 gene expression level under ABA and drought treatments; A is the qPRC analysis result of StPYL16 gene expression level under ABA treatment; B is the qPCR analysis result of StPYL16 gene expression level under drought treatment;

[0024] Figure 4 The results of the study on drought and ABA enhancing the promoter activity of StPYL16; (a) is a schematic diagram of the predicted results of the regulatory elements in the promoter region; (b) is a GUS histochemical staining image of potato plants under different treatments;

[0025] Figure 5 The results of the drought tolerance research experiment of transgenic tobacco; (a) is a GUS histochemical staining picture; (b) is a phenotypic observation picture; (c) is the detection results of the levels of MDA and Pro, and the activities of antioxidant enzymes (SOD, POD and CAT);

[0026] Figure 6 The diagram shows the construction process and identification results of transgenic tobacco; (a) is a physical diagram of the construction of transgenic tobacco by leaf disc transformation method; (b) is the identification result of transgenic plants, where M: DNA Marker; 1-15: transformed plants; W: Wild type; N: Negative control; P: Positive control; (c) is a GUS histochemical staining diagram; (d) is a statistical diagram of the detection results of StPYL16 expression levels in different plants;

[0027] Figure 7 The phenotypic observation diagrams of transgenic lines and wild-type plants under different treatments;

[0028] Figure 8 The phenotypic index detection results of transgenic lines and wild-type plants under different treatments; ac are statistical graphs of fresh weight, plant height and leaf number, respectively;

[0029] Fig. 9 Scanning images of root phenotypes of transgenic lines and wild-type plants under different treatments;

[0030] Fig.10 The diagrams show the results of root index measurements of transgenic lines and wild-type plants under different treatments; among them, ad are statistical diagrams of root diameter, root length, root surface area and root volume, respectively;

[0031] Fig.11 Statistical graph of MDA content of transgenic lines and wild-type plants under different treatments;

[0032] Fig.12Statistical graph of Pro content in transgenic lines and wild-type plants under different treatments;

[0033] Fig.13 Statistical graphs of the expression levels of stress-related genes in transgenic lines and wild-type plants under different treatments; (a)-(f) are statistical graphs of the expression levels of NtSOD, NtCAT, NtPOD, NtRD29A, NtLEA5 and NtP5CS genes, respectively. DETAILED DESCRIPTION

[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0035] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0036] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0037] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0038] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0039] Example 1

[0040] 1. Materials and Methods

[0041] 1.1 Plant materials and growth conditions

[0042] Plant materials: Potato varieties “Atlantic” (Atl) and “Qingshu 9” (Q9) and tobacco “Tobacco (NT12)” were provided by the State Key Laboratory of Arid Habitat Crops, Gansu Agricultural University.

[0043] Potato seedlings were cultured in an artificial growth chamber with 16 h light and 8 h dark, maintained at 22 ± 2 °C, and 60% relative humidity. Tobacco seeds were planted in a greenhouse with a temperature of 25 ± 2 °C, a photoperiod of 12 h light and 12 h dark, and 60% relative humidity.

[0044] Vectors: Plant expression vectors pCAMBIA1304 and pBI101-GUS were provided by the State Key Laboratory of Arid Habitat Crops, Gansu Agricultural University.

[0045] Agrobacterium: Agrobacterium tumefaciens GV3101, provided by the State Key Laboratory of Arid Habitat Crops, Gansu Agricultural University.

[0046] The primer sequences are shown in Table 1:

[0047] Table 1 Primer sequences

[0048]

[0049]

[0050] 1.2 Screening and characterization of the STPYL16 gene

[0051] Total RNA was extracted from potato (Atl and Q9) samples using RNAout kit (Tiandz, Beijing, China) and then reverse transcribed into cDNA using RevertAid First Strand cDNA Synthesis Kit (MBI, USA). A new PYL gene named StPYL16 was identified using specific primers in the potato seedling database under drought stress of the inventor team. The gene sequence was analyzed using the NCBI database. The detailed information of the primers used is shown in Table 1.

[0052] Nucleotide sequence of StPYL16 gene (SEQ ID NO.1):

[0053] 5'-ATGGGTGTGAATACCTATACTTGTGAGTCAACGACCACAATTTCCCCTACAAGAC TATTCAAAGCTTTGGTTCTTGATTTTGACAACCTTGTACCTAAATTGTTGTCACAACATGTTAAGAACAATGAGACTATTGAGGGAGATGGTGGTGTTGGAAGCATCAAGCAAATGAACTTTGTTGAAGGTGGTCCAATTAAATACTTGAAACACAAGATTCATGTGATTGATGACAAGAACTTAGAAACAAAATATTCACTTATAGAAGGTGATG TTCTTGGAGACAAATTGGAATCAATTACCTATGATATCAAATTTGAAGCTTATGATAATGGAGGTTGTGTTTACAAGACAACAACTGAGTATCACACAAAGGGTGATTATGTTGTTACTGAAGAAGAACACAATGTAGGCAAAGAGAGAATCATGAATATTTCCAAGGCTGTAGAAGCATACCTTCTCGCGAATCCTTCTGTCTACGCTTAG-3'.

[0054] 1.3 Expression analysis of StPYL16 gene

[0055] The present invention studies the tissue-specific expression of the StPYL16 gene in potatoes and its response to various abiotic stresses. For the tissue-specific expression of the StPYL16 gene, the present invention downloaded relevant data from the potato database (http: / / spuddb.uga.edu / ) for analysis. For abiotic stress, potato seedlings grown normally for 20 days were exposed to a solution containing 50 μM ABA, 100 mM mannitol or MS (as a control). For drought treatment, 20-day-old seedlings were transferred to liquid MS medium supplemented with 100 mM mannitol, and samples were collected at different time intervals (0, 2, 4, 6, 12, 24 and 48 hours) for gene expression analysis. The seedlings transferred to normal MS medium were used as a reference. For precision, each stress treatment was repeated three times. qPCR primers are shown in Table 1.

[0056] 1.4 Promoter cis-element analysis

[0057] TBtools was used to extract the 2000 bp promoter sequence upstream of the start codon of the StPYL16 gene. Subsequently, the cis-acting elements in the sequence were analyzed using the PlantCARE website (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ). Next, the StPYL16 promoter was inserted into the plant expression vector pBI101-GUS by homologous recombination. Tobacco leaves were transiently transformed with Agrobacterium tumefaciens strain GV3101, and GUS staining was performed 2 days later to evaluate promoter activity. At the same time, tobacco plants with the StPYL16 promoter were exposed to stress by transferring them to Hoagland solution containing 100 mM mannitol, while control plants were grown in regular Hoagland solution. In addition, hormone treatment included spraying 50 μM ABA, while another group was sprayed with alcohol as a control. After 4 hours of treatment, samples were collected for GUS histochemical staining.

[0058] 1.5 Evaluation of drought resistance after transient transformation of tobacco

[0059] The CDS coding sequence of StPYL16 (SEQ ID NO.1) was obtained by PCR amplification using specific primers (see Table 1). The PCR product was then digested with BglⅡ and SpeⅠ and then inserted into the pCAMBIA1304 vector to construct the recombinant plasmid pCAMBIA1304-StPYL16. The recombinant plasmid was subsequently introduced into the Agrobacterium tumefaciens strain GV3101 using the heat shock method for further experiments.

[0060] To investigate the function of StPYL16, tobacco plants were transferred from normal growth conditions to Hoagland nutrient solution after about 30 days of growth and cultured for 2 days. Subsequently, tobacco leaves were infiltrated with GV3101 carrying pCAMBIA1304-StPYL16. Empty vector pCAMBIA1304 vector infiltrated tobacco leaves were used as negative controls. After 2 days of normal growth, both the experimental and control groups were subjected to stress treatment by transferring the whole plants to Hoagland nutrient solution containing 200 mM mannitol. Samples were collected after 6 hours and subjected to GUS histochemical staining to confirm successful transformation. In addition, various physiological parameters related to stress response were evaluated.

[0061] 1.6 Evaluation of drought resistance after stable transformation of tobacco

[0062] The recombinant plasmid pCAMBIA1304-StPYL16 was transformed into tobacco (T12) by the Agrobacterium-mediated leaf disc method. The transgenic plants were then cultured on Murashige and Skoog (MS) medium and treated with kanamycin (50 mg L -1, w / v) 1 / 2MS medium was screened for selection. Positive strains were identified and confirmed by qPCR and GUS histological staining. From the qPCR results, three transgenic lines showing the highest expression of StPYL16 were selected. These lines were then cut into uniform stem segments and subjected to stress treatment by inoculation on MS medium containing 100mM, 200mM and 300mM mannitol, respectively, with normal MS medium as control. After a 30-day stress period, the corresponding indexes were evaluated.

[0063] 1.7β-Glucuronidase (GUS) staining

[0064] For histochemical staining of GUS activity, transgenic plant leaves were harvested and immersed in a reaction solution (2mM 5-bromo-4-chloro-3-indolyl-β-d-glucuronic acid, 50mM sodium phosphate, 10mM EDTA, 2mM ferrocyanide and 0.1% Triton X-100, pH 7.0) and incubated at 37°C in the dark for 12 hours. Subsequently, the stained leaves were gradiently eluted with 30%, 60% and 100% ethanol in an 80°C water bath. After the chlorophyll disappeared, micrographs were captured using an optical microscope.

[0065] 1.8 Determination of phenotypic and physiological indicators

[0066] Proline content (Pro) was determined using the ninhydrin method. MDA content was determined according to the method of Zheng et al. (2008). Enzyme activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) in transgenic lines and control plants were measured spectrophotometrically using commercial assay kits (BC0170, BC0220, and BC0200 Beijing Sola Biotechnology Co., Ltd., Beijing, China). Phenotypic traits mainly included plant height, stem diameter, and root length. In addition, a root scanner (LD-WinRHIZO) was used to evaluate parameters such as total root length, number of root tips, root area, and root volume of plant roots.

[0067] 1.9 Expression determination of stress response genes

[0068] Total RNA was extracted from tobacco plants and reverse transcribed to synthesize cDNA. The expression of stress-related genes was assessed by qPCR using specific primers (see Table 1).

[0069] 1.10 Statistical analysis

[0070] In each treatment, three plants were sampled for each of the three biological replicates.

[0071] The mean and standard deviation (SD) of each treatment were calculated based on the data collected from these replicates. One-way analysis of variance (ANOVA) in SPSSv19.0 (SPSS Inc., Chicago, IL, USA) was used to evaluate the variance between the three overexpression (OE) lines and the control plants, and statistical significance was set at P < 0.05 or P < 0.01.

[0072] 2. Results

[0073] 2.1 Screening and molecular characterization of StPYL16

[0074] PYL acts as a key ABA receptor in plant resistance to abiotic stresses such as drought. Therefore, the inventor team conducted a thorough analysis of the potato PYL gene family at an early stage and identified a total of 23 potato PYL gene sequences. Subsequently, the inventor used transcriptome data to detect the expression profiles of all PYL genes in two potato varieties with different levels of drought resistance. This analysis aimed to identify the key PYL genes that play a role in the potato response to drought stress. Finally, the inventor identified the gene PGSC0003DMT400003773, which showed a significant response to drought stress, and named it the StPYL16 gene ( Figure 1 ). Tissue-specific expression analysis showed that StPYL16 was mainly expressed in underground organs, including young tubers, mature tubers, tuber pith, tuber skin, tuber buds, and tuber cortex. In contrast, among aboveground organs, its expression was significantly increased in the stems, while relatively weakened in other tissues ( Figure 2 ).

[0075] 2.2StPYL16 is strongly induced by drought and ABA treatment

[0076] To elucidate the response of StPYL16 gene to abiotic stress, its expression level under ABA and drought treatment was further analyzed by qPCR. Figure 3 . Two varieties, Atl (drought-sensitive) and Q9 (drought-tolerant), were selected for the study. Under ABA treatment conditions, StPYL16 showed a significant response in Q9. Significant differences were observed after 1 h of stress, and its expression level gradually increased with the extension of treatment time, reaching a peak at 12 h. At this time, the expression level was 7.98 times higher than that at 0 h. In contrast, in the drought-sensitive material, StPYL16 showed the opposite pattern, showing a significant decrease after 6 h of stress and then stabilizing. Under drought stress, StPYL16 in Q9 showed an expression pattern similar to that under ABA treatment, with a significant increase in expression from the beginning of stress and reaching a peak after 12 h. In Atl, there were significant differences in the expression levels of StPYL16 at 3 and 12 h of stress, but the overall expression level did not show a regular trend.

[0077] 2.3 Drought and ABA enhance the promoter activity of StPYL16

[0078] To further elucidate the mechanism of StPYL16 gene response to stress environment, TBtools was used to obtain the 1986 bp promoter fragment (proStPYL16) upstream of the start codon of StPYL16. Plant CARE (http: / / bioinformatics.psb.ugent.be / webtools / plant care / html / ) was used to predict the regulatory elements in the promoter region. The results showed that the identified cis-regulatory elements were divided into two main categories according to their response functions: hormone-responsive elements and stress-responsive elements, see Figure 4 In addition, the promoter sequence also contains various other types of regulatory elements, such as light-responsive elements and development-related elements.

[0079] The proStPYL16 sequence is as follows:

[0080] AAAAAAATTGAAAATTTGGATGACTCTCCAAATTTCATTTGTGTCACATAAATTGAG

[0081] ACAACAAAAATAACATATATTGGGTCCATTTTAATTTATTTGTCTTATTTTTTTTATATTTAA

[0082] AAATTGCGTAAAAATATTATAAATCATGATAATTGACAACATAAAATATTTCAAAAATGTT

[0083] GTATGTGGGTAGTCTTATTATGCCTTAAATAGCGTAAAGAAAATACAGATTTGTGATTAAA

[0084] AAAACTTATTCCTTTATCCATGCAAACAATCGCTTCAAAAACTCGGTTATTAGCCCCAAA

[0085] ACATACCATTTATATTATTGGGCCCGTGCATAGCACGATATGTATATATATATCTCACAAATG

[0086] GAAAAGTTCCAATCAAGGAAGCAACATATATCATTTACAATGACTTAAAAAATATTTAA

[0087] AATTACAATAATTACCAATTTAAAATATTTAAAAGCTATGTAATAAAATAGGTTTACTCTCA

[0088] GAATTCTATCAGGCTCACATATATTGGGACAGAAAAAATAACACATATCATTTTAAAGTTA

[0089] CCAAAAAAGTATTATAAATAATAATAATTAACAACTTAAAATATCTTAAAAGACATTTTAAA

[0090] AGGGTTAATTTTGTAATTTTATCCATATCACATAAATTAGGACAAAGTGACCAGTAATGTA

[0091] CATTATTTCAAAGTTACATAAAAATATTATAAATCACAATAATTAATAACTTCAAACATTTT

[0092] TTAAAAATATATGAAAATTTGGATGACTCTCCAAATTTCATTTGTGTCACATAAATTGAGA

[0093] CAACAAAAATAACATATATTGGGTCTATTTTAATTTATTTGTCTTATTTATTTTTTTTTTATATT

[0094] TAAAAATTGCGTAAAAATACTATAAATCGTGATAATTGACAATATAAAATATGTTTTGAAA

[0095] AAATTCCACTGATTCTTGAAGTGAATCTATCGTAAAAATACTATAAATCATGATAATTGAC

[0096] AACATAAAATATTTCAAAAATGTTGTATGTGGGTAGTCTTATTATGCCTTAAATAGCGTCA

[0097] AAGAAAGTACATGTTTGTGATAAAAAAACTTATTCCTTTATCCACGCAAACAATCACTTC

[0098] AAAAACTCGGTTATTAGCCCCAAAACATACCATTTATATTATATAGCACCGGGCCACATTAT

[0099] CTAGTATATATATATATACTAGGTTTCCACCGTCCAATCAAATTAATTATTAAGAGAATGAT

[0100] GACACTATATGTAGATAAAAAAAATAAAATTGACACGAATGTCAACAATGGACTGCTTTGA

[0101] ATGTAGAAATTAATATTAGAGCTAATGACTGAACTCTTAGGGTGTGTTTGGGGAGTAAAA

[0102] AAACATTTTCTGTGAAATAATATTTTGTTGAAAAAAATAAGTAGTTTCTGATGGTTTGATAA

[0103] ATAAGTAAGAAAATATTATAGAGATGGGTGGGTTGAAGTGGGGAGTGGGGATCCGGGGT

[0104] GGTCAAAGTGTCGGGGTTAAACGCGATGAGGGATAATGAACTTGAAATGTTATAGAATTT

[0105] ATTTTTCCTATTTTTTAGGAAAGTTTTTTTTTTATTCTTAAGAAATTTACAGCAACAACATAC

[0106] TTCGTGTAATATCAAAAGTGGTAATCTGAAAATGATAGTGTACTGCAAAGACCTTACCTC

[0107] TATCTTATGAAGGTAGAAAATTGTTTTTAGTACACCACCAACTCAAGTTAGTCAATTCAA

[0108] AGCAGGTTTCAAAAGGAAATATAATAGTGAATAAACCCATGATGAATAGTGGGAAAA

[0109] AATAAAATTTTTAAGTTAACTAAACATGAAAAAATTGAATAATTTTATTCTATATTTTTTTC

[0110] AAAAATTGTTTTCCTCCATTCCAAACACACCCTACAATATCCCTATAAATACTATCTTAAA

[0111] CTTTCATAAAGCACACACCTCAGAACATTAATTCATCTTATCCTTAGCTCTTTTTAATTTCC

[0112] TTTTTGTTCAAAAGCAAATATAAATCAAAAAAACATC (SEQ ID NO. 22).

[0113] To examine the response of the StPYL16 promoter to abiotic stress, the proStPYL16 sequence was cloned from potato genomic DNA and inserted into the pBI101-GUS vector for further analysis. Figure 4 As shown in (b), under normal conditions, transgenic plants containing proStPYL16 showed blue color in the histological GUS assay, while the negative control showed pale yellow. This observation indicated that proStPYL16 activated downstream GUS reporter gene expression, indicating its intrinsic promoter strength. Subsequent exposure to drought stress resulted in a more intense GUS staining pattern in proStPYL16 transgenic tobacco plants, indicating that the promoter activity of proStPYL16 was enhanced under drought conditions. In contrast, there was no significant difference in GUS staining between the negative control and the empty vector control.

[0114] 2.4 Transient transformation of StPYL16 improves drought tolerance of transgenic tobacco

[0115] In order to preliminarily study the function of StPYL16, the present invention transiently expressed it in tobacco and subjected the transgenic tobacco to drought treatment to explore whether it could affect the drought resistance of transgenic tobacco under drought stress. Figure 5 As shown in (a), the GUS staining results of transgenic tobacco showed that leaves transformed with empty vector and StPYL16 showed obvious blue color, indicating the successful introduction of the target gene. At the same time, a significant difference in the degree of wilting of plants overexpressing the gene was observed compared with the control, indicating that the expression of StPYL16 enhanced the drought resistance of tobacco, see Figure 5 Middle (b).

[0116] In addition, in order to clarify the effect of StPYL16 on transgenic plants, the present invention detected the levels of MDA and Pro, which are closely related to plant stress resistance, and the activities of antioxidant enzymes (SOD, POD and CAT). Figure 5 As shown in (c), overexpression of StPYL16 led to a significant increase in Pro accumulation in transgenic plants under drought stress conditions, while reducing MDA content. In contrast, no significant difference was observed between the two indicators under normal conditions. The activities of antioxidant enzymes showed different patterns. SOD and CAT activities showed significant increases under both control and stress conditions; POD showed a significant increase under drought stress, while no significant difference was observed between transgenic plants and control plants under normal conditions.

[0117] 2.5 Generation of stable transgenic tobacco

[0118] To further investigate the role of StPYL16 under drought stress conditions, transgenic tobacco plants overexpressing StPYL16 were generated using Agrobacterium-mediated leaf disc transformation. Figure 6 (a). Fifteen resistant transgenic plants were selected through hygromycin screening, gene cloning analysis and GUS histochemical staining. The identification results are shown in Figure 6 (b) and (c). The results showed that the expression of the tag gene NPTII on the vector was detected in all resistant plants and the positive control vector, but not in the wild type and negative control plants (primer sequences: F-GGACGAAACATGCTTCTTTGTG (SEQ ID NO.23), R-CGTCGTCCTTGAAGAAGATGG (SEQ ID NO.24)). Consistent results were obtained from GUS histochemical staining.

[0119] Subsequently, the present invention used qPCR to quantify the expression level of StPYL16 in each positive plant, and the results are shown in Figure 6 Middle (d), three transgenic lines (OE-4, OE-6, and OE-7) with high levels of StPYL16 expression were selected for further study.

[0120] 2.6 Overexpression of StPYL16 improves tobacco drought tolerance

[0121] In order to study the phenotypic changes of transgenic tobacco before and after drought stress, the transgenic lines and wild-type plants under various treatments were photographed and observed. The results are shown in Figure 7. The results showed that under normal conditions, there was no significant difference between each transgenic plant and the control plant. However, under stress conditions, the growth of all plants was hindered, and the control plants showed more significant inhibition. Specifically, at 100mM, the plant height and root development of the transgenic plants were significantly better than the control. In contrast, at 200mM and 300mM, the root growth of all plants was completely inhibited.

[0122] The present invention further measured a variety of phenotypic indicators. The results showed that overexpression of StPYL16 did not affect the fresh weight of transgenic plants under drought conditions ( Figure 8 As a key indicator of plant growth and development, the height of StPYL16 transgenic plants was significantly higher than that of the control plants under 100 and 200 mM conditions, and the height of the three transgenic lines was almost 1.5-1.8 times that of the control ( Figure 8 Similarly, the number of leaves showed a comparable pattern, with transgenic plants under 100 mM stress showing significantly more leaves than the control, reaching 2.1 times the number ( Figure 8 (c).

[0123] In addition, the root system of each plant was scanned for phenotypes and related data indicators were measured. The results are shown in Fig. 9 and Fig.10 The results showed that under drought stress, the root length of StPYL16 transgenic plants was significantly greater than that of the control. Although other indicators, such as root diameter, root surface area, and root volume, showed some differences, these differences were not statistically significant.

[0124] Finally, the present invention measured two key physiological indices closely related to drought stress: MDA and Pro ( Fig.11 and Fig.12 ). Under normal conditions, no significant differences were observed between the lines. However, under stress conditions, the MDA content in each transgenic line was significantly lower than that in the control, while the Pro content was significantly higher than that in the control. This difference became more obvious as the stress level increased. In conclusion, overexpression of StPYL16 significantly enhanced the drought resistance of transgenic tobacco.

[0125] 2.7 Expression of stress-related genes in StPYL16 transgenic tobacco plants under drought stress

[0126] To explore the potential mechanism of increased drought tolerance in StPYL16 transgenic plants, the present invention conducted a comparative analysis of the expression profiles of stress-related genes in StPYL16 transgenic lines and control plants under normal and drought conditions. When exposed to drought stress, certain stress-related genes (including NtSOD, NtCAT, NtPOD, NtRD29A, NtLEA5, and NtP5CS) showed significantly increased expression levels in StPYL16 transgenic plants compared with control plants ( Fig.13 ). However, with the exception of the NtCAT gene, there were no significant differences in gene expression levels between StPYL16 transgenic plants and control plants grown under normal conditions. Notably, after drought stress, the expression levels of all genes tested in both wild-type and transgenic plants showed significant increases compared with those under normal conditions. These findings suggest that overexpression of StPYL16 may regulate the expression of these stress-related genes to enhance plant tolerance to drought stress.

[0127] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. An application of a StPYL16 gene with drought resistance in enhancing plant drought stress resistance, characterized in that: The nucleotide sequence of the StPYL16 gene is shown in SEQ ID NO.1; By overexpressing the StPYL16 gene in the plant, the drought stress resistance of the plant is enhanced; The plant is potato or tobacco.

2. Use of a recombinant expression vector in enhancing plant drought stress resistance, characterized in that: The recombinant expression vector comprises the StPYL16 gene described in claim 1; By overexpressing the StPYL16 gene in the plant, the drought stress resistance of the plant is enhanced; The plant is potato or tobacco.

3. Use of a host cell in enhancing plant drought stress resistance, characterized in that: The host cell is a recombinant Agrobacterium; the recombinant Agrobacterium comprises the recombinant expression vector described in claim 2; By overexpressing the StPYL16 gene in the plant, the drought stress resistance of the plant is enhanced; The plant is potato or tobacco.

4. A method for enhancing plant drought stress resistance, characterized in that: The method comprises the steps of genetically transforming the StPYL16 gene into a plant body, causing the gene to be overexpressed in the plant body, and cultivating a transgenic plant with drought resistance; The nucleotide sequence of the StPYL16 gene is shown in SEQ ID NO.1; The plant is potato or tobacco.

5. The method according to claim 4, characterized in that The genetic transformation adopts Agrobacterium transformation method.

6. The method according to claim 5, characterized in that The Agrobacterium transformation method adopts the Agrobacterium-mediated leaf disc transformation method.

Images