Molecular marker IDO1 and application thereof in breast cancer treatment
By discovering the high expression of IDO1 in breast cancer-related fat cells and the regulation of WNT10B-β-catenin signaling axis, the tryptophan metabolism disorder in breast cancer cells was inhibited, and the dedifferentiation of tumor-related fat cells in breast cancer was solved. Effective treatment of breast cancer has been achieved.
Patent Information
- Application Number
- CN202411529918.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-30
- Publication Date
- 2024-12-20
AI Technical Summary
There are few researches on the amino acid metabolism mechanism of tumor-associated fat cells in breast cancer, and the prior art is difficult to effectively inhibit the malignant characteristics and progress of breast cancer cells, especially triple-negative breast cancer.
By exploring the mutual communication between breast cancer cells and adipocytes, it was found that IDO1 is highly expressed in breast cancer-related adipocytes, and IDO1 expression and tryptophan metabolism are regulated through the WNT10B-β-catenin signaling axis to inhibit tumor-related adipocytes. Dedifferentiation characteristics, and the development of treatment methods for IDO1 as a target.
It effectively inhibits the proliferation and invasion ability of breast cancer cells, reduces tryptophan metabolism disorders in tumor-associated fat cells, provides new breast cancer treatment targets and detection methods, and promotes the theoretical basis for breast cancer treatment.
Smart Images
Figure CN119162209A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a molecular marker IDO1 and an application thereof in the treatment of breast cancer. Background Art
[0002] Malignant tumors are diseases that seriously threaten human health and life. Breast cancer, as the "number one cancer" among female cancers, ranks first in incidence and mortality among female malignant tumors.
[0003] A tumor is actually a "tumor organ" that contains a complex ecosystem, of which cancer cells are only a component. In the tumor microenvironment (TME), very early peripheral immune cells, fibroblasts, blood vessels, and adipocytes are recruited by the tumor to promote tumor growth.
[0004] In the human body, fat-rich tissues include breast, subcutaneous, and periprostatic adipose tissue. In these tumors adjacent to adipose tissue, the "success" of tumor formation often depends on the ability of the tumor to induce metabolic transformation and reprogram adipocytes to promote tumor growth. Specifically, normal adipocytes are driven by tumor cells into cancer-associated adipose cells (CAAs). Compared with normal adipocytes, these adipocytes show a series of dedifferentiation characteristics, such as dedifferentiation and fibroblast-like phenotypes, smaller size, small and dispersed lipid droplets, reduced levels of adipose differentiation markers, and metabolic differences dominated by enhanced lipolysis.
[0005] In breast tissue, adipocytes are the most important stromal cells in the breast tumor microenvironment, so it is of great significance to further explore the role and mechanism of metabolic transformation and reprogramming of adipocytes in breast cancer. In existing studies, lipid metabolism, a tumor-associated adipocyte metabolic reprogramming, has been the most extensively studied, while amino acid metabolism also plays a key role in the formation of tumor-associated adipocytes, but there are very few related studies. Therefore, in-depth research is needed on amino acid metabolism in tumor-associated adipocytes.
[0006] Many evidences show that IDO1, a key enzyme in Trp (tryptophan) metabolism, plays an important role in cancer, promoting tumor progression by inhibiting anti-tumor immune responses and increasing the malignant properties of cancer cells. IDO1 can metabolize tryptophan into Kyn (kynurenine). Studies have shown that IDO1 is expressed in approximately 58% of human tumors, and its expression is associated with poor clinical outcomes in different types of cancer, including melanoma, gynecological cancer, breast cancer, colon cancer, and hematological malignancies. In our previous related studies, we found and confirmed that the plasma tryptophan level in patients with breast tumors, especially triple-negative breast cancer, was significantly increased. In addition, recent studies have reported that adipocytes can promote the occurrence and development of breast tumors by producing tryptophan metabolites kyn, indicating that tryptophan metabolism in adipocytes is closely related to the progression of breast tumors. IDO1 may be the key to the transformation of normal adipocytes (NA) into tumor-associated adipocytes (CAAs).
[0007] WNT10B is a member of the WNT family of secreted glycoproteins that activates the WNT-β-catenin signaling cascade to control proliferation, stemness, pluripotency, and cell fate determination. WNT10B was first discovered in the mammary gland and plays a very important role in mammary gland development. It is the earliest WNT ligand expressed in the mammary gland. Studies have reported that WNT10B can inhibit the adipogenic differentiation of adipocytes. However, there are no reports on whether tumor cells can regulate adipocytes into tumor-associated adipocytes by secreting WNT10B and whether WNT10B affects tryptophan metabolism.
[0008] Therefore, in this invention, we explore the role of mutual communication between breast cancer cells and adipocytes in the progression of breast tumors. By exploring how tryptophan metabolic reprogramming of tumor-associated adipocytes is regulated by tumors and its specific role and mechanism in the progression of breast tumors, we found the tumor-associated adipocyte dedifferentiation marker IDO1 related to breast cancer progression, providing a new theoretical and experimental basis for finding effective therapeutic targets for breast cancer. Based on the above two aspects of exploration, breast cancer patients can get more clinical benefits during the diagnosis and treatment process. Summary of the invention
[0009] The present invention reveals for the first time that IDO1 is highly expressed in breast cancer-related adipocytes, and finds that breast cancer cells regulate IDO1 expression and tryptophan metabolism in tumor-related adipocytes through the WNT10B-βcatenin signal axis. Inhibiting WNT10B expression in tumor cells, intervening in the WNT10B-βcatenin signal axis, or inhibiting IDO1 expression in tumor-related adipocytes can inhibit the tryptophan metabolism disorder of tumor-related adipocytes, and ultimately inhibit the malignant phenotype of tumors, thereby achieving the treatment of breast cancer. Based on this, the purpose of the present invention is to provide the use of ID01 as a target in the preparation of breast cancer therapeutic drugs, to provide a new theoretical basis for the design of breast cancer therapeutic drugs, and to provide a new means for detecting tryptophan metabolism or dedifferentiation characteristics of tumor-related adipocytes.
[0010] To achieve the above objectives and other related objectives, the present invention provides the use of IDO1 as a target in the preparation of a drug for treating breast cancer.
[0011] Furthermore, the IDO1 gene serves as the target of the drug.
[0012] Furthermore, the gene IDO1 is highly expressed in tumor-associated adipocytes.
[0013] Furthermore, the level of the gene IDO1 in tumor-associated adipocytes is positively correlated with the malignant phenotype of breast cancer cells.
[0014] Furthermore, the drug inhibits the formation of tumor-associated adipocytes by knocking down the expression of IDO1, inhibits its tumor-promoting effect, and inhibits the proliferation and invasion of breast cancer cells.
[0015] Furthermore, the drug inhibits tryptophan metabolism disorders in tumor-associated adipocytes by inhibiting the expression of IDO1.
[0016] Furthermore, the drug includes but is not limited to: nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, polypeptides, proteins or interfering lentiviruses, and the nucleic acid includes but is not limited to: antisense oligonucleotides, double-stranded RNA (dsRNA), ribozymes, small interfering RNA (esiRNA) prepared by endoribonuclease III or short hairpin RNA (shRNA).
[0017] The present invention also provides use of a reagent for detecting IDO1 expression in preparing a kit for detecting tryptophan metabolism or dedifferentiation characteristics of tumor-related adipocytes.
[0018] Furthermore, tumor-associated adipocytes promote the proliferation and invasion of breast cancer cells.
[0019] Furthermore, abnormally active tryptophan metabolism in tumor-associated adipocytes is positively correlated with their tumor-promoting ability.
[0020] Furthermore, the high expression of IDO1 in tumor-associated adipocytes is positively correlated with the dedifferentiation characteristics of adipocytes, promoting the formation of tumor-associated adipocytes.
[0021] The present invention also provides the use of a drug that inhibits the WNT-β-catenin signal axis for regulating IDO1 and tryptophan metabolism in the treatment of breast cancer.
[0022] Furthermore, breast cancer cells can secrete WNT10B protein to promote adipocyte dedifferentiation and high expression of IDO1.
[0023] Furthermore, WNT10B is a WNT family molecule that mainly acts through the classic WNT-βcatenin signaling pathway.
[0024] Furthermore, the drug is a WNT-βcatenin signaling pathway inhibitor.
[0025] Furthermore, the drug inhibits adipocytes from receiving WNT signals transmitted by WNT10B secreted by breast cancer cells, thereby inhibiting the regulation of WNT10B on adipocyte IDO1, thereby inhibiting the formation of tumor-associated adipocytes and inhibiting the proliferation and invasion of breast cancer cells.
[0026] The research process of the present invention is: first explore the level of tryptophan metabolism in tumor-associated adipocytes, and then clarify the specific situation of tryptophan metabolism in tumor-associated adipocytes and the enzymes that play a key role therein through technical means such as WB, PCR and metabolic mass spectrometry. Then, by knocking down the relevant key metabolic enzymes in adipocytes, the role and mechanism of the differential metabolic enzymes in the formation of tumor-associated adipocytes and their promotion of tumor malignant progression are clarified. Then, through bioinformatics screening, PCR and immunoblotting experiments are used to verify the key secretory proteins that tumor cells regulate tryptophan metabolism in adipocytes. Then, the expression of the secretory protein in breast cancer cells or the corresponding signal pathway is intervened to explore the specific mechanism by which breast cancer cells regulate tryptophan metabolism in tumor-associated adipocytes, and the inhibitory effect on the malignant phenotype of breast cancer cells is achieved through intervention means, so as to achieve the purpose of treating breast cancer.
[0027] The experimental results of the present invention show that IDO1, a key enzyme in tryptophan metabolism, is significantly highly expressed in tumor-associated adipocytes, and tumor cells can activate the adipocyte WNT-β-catenin signaling pathway by secreting secretory protein WNT10B to promote the expression of adipocyte IDO1 and promote the dedifferentiation characteristics of tumor-associated adipocytes. Intervention of IDO1 expression in adipocytes or intervention of WNT10B secretion in breast cancer cells can inhibit adipocyte dedifferentiation, inhibit tumor-associated adipocyte formation and tryptophan metabolism disorders, and further inhibit the proliferation and invasion of breast cancer cells, thereby inhibiting the malignant phenotype of breast cancer cells.
[0028] The beneficial effects of the present invention are as follows: the present invention confirms that IDO1 is highly expressed in breast cancer-related adipocytes, and finds that breast cancer cells regulate the IDO1 level and tryptophan metabolism of tumor-related adipocytes through the WNT10B-βcatenin signaling axis. Inhibiting the secretion of WNT10B in breast cancer cells, intervening in the WNT10B-βcatenin signaling axis, or inhibiting IDO1 expression in tumor-related adipocytes can inhibit tryptophan metabolic disorders and their dedifferentiation characteristics in tumor-related adipocytes, ultimately achieving the effect of inhibiting their tumor-promoting malignant phenotypes and achieving the purpose of breast cancer treatment. The present invention further studies how breast cancer cells regulate adipocytes and how adipocytes promote breast cancer progression, providing new insights into the detection of tumor-related adipocytes, tumor-promoting mechanisms, and the treatment of breast cancer. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 The results of the study showed that IDO1 is significantly overexpressed in tumor-associated adipocytes
[0030] Figure 2 The results of a study on the abnormally active tryptophan metabolism in tumor-related adipocytes
[0031] Figure 3 Knockdown of IDO1 in tumor-associated adipocytes inhibits the tumor-promoting effects of tumor-associated adipocytes
[0032] Figure 4 The results of the study showed that knocking down IDO1 inhibited the formation of tumor-associated adipocytes.
[0033] Figure 5 The results of a study on breast cancer cells regulating tumor-associated adipocyte formation and IDO1 levels through the WNT-β-catenin axis DETAILED DESCRIPTION
[0034] This application studies the important mechanism of IDO1, a key molecule in the formation of tumor-associated adipocytes, in promoting the proliferation and invasion of breast cancer cells, and discovers the specific mechanism by which breast cancer cells regulate tumor-associated adipocytes through WNT10B, which can provide a scientific theoretical basis for subsequent drug design targeting IDO1 and detection of tumor-associated adipocytes.
[0035] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.
[0036] The present invention is further described below in conjunction with the examples, but the present invention is not limited thereby. The experimental methods in the following examples are conventional methods unless otherwise specified.
[0037] Example 1
[0038] IDO1 is significantly overexpressed in tumor-associated adipocytes and promotes disordered tryptophan metabolism
[0039] To explore the regulatory effect of breast cancer cells on tryptophan metabolism in adipocytes, we first induced adipocytes and collected tumor-conditioned medium. The adipocyte line used was 3T3-L1, and the breast cancer cell lines were 4T1 and E0771. Tumor-associated adipocytes were collected 3 days after the differentiated mature adipocytes were treated with tumor-conditioned medium. First, the tryptophan level of adipocytes after treatment with tumor-conditioned medium was detected by ELISA experiment, and differences were found. Therefore, we further explored the important role of tryptophan in the formation of tumor-associated adipocyte characteristics by depleting tryptophan in the culture medium. The differentiation characteristics of adipocytes were detected by oil red staining and immunoblotting experiments. Adipocyte dedifferentiation is an important feature of tumor-associated adipocyte formation. Then, the expression of tryptophan metabolism-related genes in tumor-associated adipocytes was detected by fluorescence quantitative PCR and immunoblotting. After finding that there were differential tryptophan acid metabolic enzymes in tumor-associated adipocytes. To clarify whether there is indeed abnormal tryptophan metabolism in tumor-associated adipocytes, we further performed tryptophan targeted metabolomics by mass spectrometry to detect tryptophan metabolism in tumor-associated adipocytes.
[0040] Cell culture:
[0041] 3T3-L1 preadipocytes were cultured in DMEM supplemented with 1% penicillin / streptomycin (biosharp, China) and 10% calf serum (Tianhang Biotech, China), and breast cancer cell lines 4T1 and E0771 were cultured in RPMI 1640 medium (BasalMedia, Shanghai, China) supplemented with 1% penicillin / streptomycin and 10% fetal bovine serum (vivacell, Germany) and maintained in a 5% CO2 incubator at 37°C.
[0042] Adipocyte Adipogenic Differentiation:
[0043] Confluent 3T3-L1 preadipocytes were cultured in a medium containing 1% penicillin / streptomycin and 10% FBS for 24 h to inhibit their growth, and then a differentiation cocktail of 1 μM dexamethasone (Sigma Aldrich), 500 μM 3-isobutyl-1-methylxanthine (Sigma Aldrich) and 5 μg / mL insulin (Sigma Aldrich) were added for two days, and then 5 μg / mL insulin was used alone for 4 days. Mouse embryonic fibroblasts 3T3-L1 (CL-137), 4T1 cells and E0771 cells were obtained from ATCC.
[0044] Conditioned medium (CM) collection:
[0045] The cell supernatant was collected, centrifuged at 2000 rpm for 10 min, and stored at -80°C. When used, it was mixed with the culture medium used for the cells to be treated at a ratio of 1:1 to prepare a conditioned medium.
[0046] RNA extraction and fluorescence quantitative PCR detection:
[0047] Total RNA was extracted from cells using Trizol reagent (biosharp, China), and RNA was reverse transcribed using HB221205 (YEASEN, China). Universal Blue qPCR SYBR Green Master Mix (YEASEN, China) was used for quantitative PCR. All experiments were performed according to the manufacturer's instructions. The amplification program for quantitative PCR was: 95°C pre-denaturation for 2 min, 95°C denaturation for 10 s, 60°C annealing and extension for 30 s, for a total of 40 cycles.
[0048] Immunoblotting:
[0049] The cells were lysed in RIPA buffer containing PMSF (phenylmethylsulfonyl fluoride), and the extracted proteins were separated by SDS-PAGE and transferred to PVDF membrane (Millipore, Germany) according to standard methods. The membrane was blocked with 5% BSA for half an hour and then incubated with the primary antibody at 4°C overnight, and then the membrane was incubated with the secondary antibody at room temperature for 1 hour. Finally, the developer was fully contacted with the protein surface of the strip, and the strip was placed on the tray of the exposure instrument for development.
[0050] Oil Red O staining:
[0051] The relevant operations were performed according to the instructions of the Oil Red O staining kit (Solarbio, China).
[0052] Tryptophan ELISA test:
[0053] After collecting the cell pellet, the cellular tryptophan level was detected according to the experimental steps of the kit (Langton, China).
[0054] Mass spectrometry detection:
[0055] Wash the cells to be treated twice with PBS, collect the cell pellet at the bottom of the centrifuge tube by low-speed centrifugation at 3000rpm for 5min, and discard the supernatant. Add 400ul of a mixed solution of methanol and acetonitrile to the cell pellet, then add 2.5ul of the internal standard, shake and mix, ice bath overspeed, and then incubate at -80℃ for half an hour. After centrifugation, retain the supernatant, drain it in a vacuum tube, add 50ul of a mixed solution of methanol and water to dissolve it, shake and mix, ice bath ultrasonic, and finally centrifuge at low temperature to take the supernatant and put it in the sample bottle for machine detection.
[0056] Depend on Figure 1 It can be seen that after we collected the tumor conditioned medium ( Figure 1 AB), tryptophan accumulation in adipocytes after 72 hours of treatment with breast cancer cell conditioned medium ( Figure 1 C),. In addition, we also found that tryptophan metabolic enzymes had significant differences, among which the key metabolic enzyme IDO1 was significantly overexpressed (Figure FG). The lack of tryptophan during adipocyte culture reduced adipocyte lipid droplets and related differentiation marker levels, and adipocytes dedifferentiated and became tumor-associated adipocytes ( Figure 1 DE) This suggests that compared with normal adipocytes, adipocytes affected by tumor cells have abnormal tryptophan metabolism. We need to further clarify this phenomenon and mechanism.
[0057] We then performed principal component analysis on the mass spectrometry results of tryptophan metabolism in tumor-associated adipocytes, and further confirmed that tumor-associated adipocytes do have different tryptophan metabolism ( Figure 2AB). After further analysis of the metabolic profile of tumor-associated adipocytes, we found that a large number of tryptophan downstream metabolites accumulated in tumor-associated adipocytes ( Figure 2 C). In addition, the ratio of kynurenine (kyn) to tryptophan (Trp) levels increased significantly, indicating that the level of tryptophan metabolism downstream in tumor-associated adipocytes increased, and this ratio was consistent with our previous metabolic enzyme detection to a certain extent. Kyn is mainly the product of IDO1 metabolism of tryptophan ( Figure 2 DF).
[0058] Example 2
[0059] Knockdown of IDO1 in tumor-associated adipocytes inhibits the tumor-promoting effects of tumor-associated adipocytes
[0060] First, we clarified the tumor-promoting effect of tumor-associated adipocytes through CCK8, Transwell, and immunoblotting experiments. Then, in order to explore whether tumor-associated adipocytes promote the progression of breast tumors by overexpressing IDO1, we knocked down IDO1 in tumor-associated adipocytes through siRNA, collected tumor-associated adipocyte conditioned medium, processed tumor cells, and similarly clarified the role of IDO1 through CCK8, Transwell, and immunoblotting experiments.
[0061] CCK8 experiment:
[0062] Cell counting kit (CCK-8) (Biosharp, China) was used to detect cell growth. The treated 4T1 cells and E0771 cells were seeded in 96-well plates at a density of 2 × 10 3 cells per well and 2.5×10 3 After culturing the cells for 24 h, 48 h and 72 h, 10% CCK-8 reagent was added, and the optical density (OD) value at 450 nm was measured 1.5 h later.
[0063] Transwell experiment:
[0064] Matrigel (BD Bioscience) was diluted with serum-free medium at a ratio of 1:8, and the transwell upper chamber containing 100ul of diluted Matrigel was incubated at 37°C for 2 hours. The transwell chamber was placed on a 24-well plate, and 700ul of medium containing 10% FBS was added to the lower chamber. The treated cells were centrifuged and resuspended in serum-free medium, and 200ul of serum-free medium containing 2×104 cells was added to each transwell chamber. After 48h of culture, the invasive cells transferred to the lower layer were fixed with 4% paraformaldehyde, stained with crystal violet for 15min, and the non-invaded cells in the upper chamber were gently wiped with a cotton swab, then washed with distilled water, and the chamber was dried and the image was taken using a microscope.
[0065] Cell transfection:
[0066] siRNA targeting IDO1 (Jinkairui, China) and corresponding controls were transfected into 3T3-L1 induced mature adipocytes treated with tumor culture medium. All transfections were performed by Lipofectamine 2000 (Invitrogen, USA) according to the instructions of the product.
[0067] Collect tumor-associated conditioned medium ( Figure 3 A) After treating tumor cells 4T1 and E0771 for 48 hours, the cells were collected for CCK8, Transwell and immunoblotting experiments to explore the tumor-promoting effect of tumor-associated adipocytes. We determined that tumor-associated adipocytes can promote the proliferation and invasion of breast cancer cells 4T1 and E0771 ( Figure 3 To explore whether IDO1 plays a key role in this process, we used small interfering RNA to knock down IDO1 in tumor-associated adipocytes. We found that knocking down IDO1 in tumor-associated adipocytes could inhibit its original ability to promote tumor proliferation and invasion ( Figure 3 EG). It is clear that IDO1 is indeed a key molecule that promotes tumors in tumor-associated adipocytes.
[0068] Example 3
[0069] IDO1 promotes the delipidation and differentiation of adipocytes into tumor-associated adipocytes
[0070] Tumor-associated adipocytes have dedifferentiation characteristics, which are manifested by reduced lipid droplets and decreased markers such as Pparγ, Cebpα, and Fabp4. Therefore, we want to clarify whether adipocytes treated with breast cancer cell conditioned medium become tumor-associated adipocytes and whether the high expression of IDO1 in tumor-associated adipocytes is the key to their formation. So we performed experiments such as Oil Red O staining, triglyceride (TG) detection, fluorescence quantitative PCR, and immunoblotting to explore the effects of tumor cells on adipocytes and the role of IDO1 in the formation of tumor-associated adipocytes.
[0071] Triglyceride (TG) test:
[0072] The relevant operations were performed according to the instructions of the triglyceride (TG) content detection kit (Solarbio, China)
[0073] We first determined that treatment with breast cancer cell-conditioned medium promotes the formation of tumor-associated adipocytes. Figure 4 (AE) It can be seen that tumor-conditioned medium leads to a decrease in fat droplets in adipocytes, a decrease in related markers such as Pparγ, Cebpα, Fabp4, and a decrease in triglyceride levels. After knocking down IDO1 in tumor-associated adipocytes, the dedifferentiation of tumor-associated adipocytes is significantly inhibited, and related markers and triglyceride levels are restored ( Figure 4 FG), so we can clearly see that IDO1 plays an important role in the formation of tumor-associated adipocytes. IDO1 may be another marker of tumor-associated adipocyte formation, which provides a new focus for us to detect the mechanism of tumor-associated adipocyte formation.
[0074] Example 4
[0075] Breast cancer cells regulate IDO1 expression and dedifferentiation of tumor-associated adipocytes by secreting WNT10B
[0076] We wanted to find out how tumor cells lead to the formation of tumor-associated adipocytes, and the interaction between cells is most likely produced through secretory proteins. Therefore, we used bioinformatics analysis to find the differential proteins produced by tumor cells after being affected by adipocyte-conditioned medium. After verification, we screened out the key tumor secretory proteins, and further clarified the role of the tumor secretory protein WNT10B in adipocyte IDO1 expression and tumor-associated adipocyte formation through secretory protein detection, fluorescence quantitative PCR, immunoblotting and other experiments.
[0077] Secretory protein detection:
[0078] The cells to be tested were replaced with serum-free culture medium and cultured for 24 hours, then the culture supernatant was collected and the secreted protein was concentrated by ultrafiltration tube centrifugation and the protein concentration was detected by BCA method. The protein was quantitatively analyzed by immunoblotting and Ponceau red staining.
[0079] After bioinformatics analysis, we screened out 4 key secretory protein molecules ( Figure 5 AB), and after PCR verification, it was found that only the WNT10B protein was significant and indeed increased in secretion under the influence of adipocyte conditioned medium (NA CM) ( Figure 5 CD), and after knocking down the WNT10B gene in tumor cells, we found that IDO1 expression in tumor-associated adipocytes was inhibited and β-catenin levels were significantly reduced ( Figure 5 EF). This indicates that WNT10B may play a key role in the regulation of adipocytes by tumor cells. To clarify this finding, we further investigated the dedifferentiation characteristics of tumor-associated adipocytes and treated adipocytes (NA) with WNT10B recombinant protein and WNT-β-catenin signaling pathway inhibitor XAV-939. We found that adipocyte dedifferentiation was enhanced after WNT10B treatment, while adipocyte differentiation was deepened under the action of the inhibitor ( Figure 5 GI).
[0080] In summary, the present invention emphasizes the importance of IDO1 in regulating the dedifferentiation characteristics of tumor-associated adipocytes. The research results of the present invention reveal the intrinsic connection between tryptophan metabolism and dedifferentiation of tumor-associated adipocytes, providing a new theoretical basis for clinical targeting of tumor-associated adipocytes to treat breast cancer.
[0081] The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Anyone familiar with the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by a person of ordinary skill in the art without departing from the spirit and technical concept disclosed by the present invention shall still be covered by the claims of the present invention.
Claims
1. Application of IDO1 (indoleamine 2,3-dioxygenase 1) gene as a target in the preparation of anti-tumor related adipocyte formation and breast cancer treatment drugs.
2. The use according to claim 1, Features: IDO1 is a therapeutic target for breast cancer. IDO1 is significantly overexpressed in tumor-associated adipocytes and promotes adipocyte dedifferentiation. Tumor-associated adipocytes provide energy for tumor cells and promote the proliferation and invasion of breast cancer cells.
3. Application of IDO1 gene inhibitors in the preparation of drugs for the treatment of tumor-related adipocyte formation and breast cancer.
4. The use according to claim 3, Features: The claimed IDO1 gene inhibitor is a small interfering RNA (siIDO1), whose sense strand is: 5'CGGGCAGCUUCGAGAAGAA3', and antisense strand is: 5'UUCUUCUCGAAGCUGAAAG3'; siIDO1 can modulate the transcription and translation levels of IDO1 in adipocytes and inhibit their dedifferentiation, thereby inhibiting the formation of tumor-associated adipocytes and its promotion of the malignant phenotype of breast cancer cells.
5. Application of WNT-β-catenin pathway inhibitors in the preparation of anti-tumor related adipocyte formation and breast cancer treatment drugs.
6. The use according to claim 5, Features: The inhibitor is XAV-939, and the treatment scheme is: XAV-939 at a concentration of 10 μM is used to treat adipocytes for 48 hours; XAV-939 can effectively inhibit adipocyte WNT signaling, inhibit adipocyte IDO1 levels and tumor-associated adipocyte formation, thereby inhibiting the proliferation and invasion ability of breast cancer cells.
7. Application of WNT10B gene inhibitors in the preparation of drugs for the treatment of tumor-related adipocyte formation and breast cancer.
8. The use according to claim 7, Features: The WNT10B gene inhibitor claimed is a small interfering RNA (siWNT10B), whose sense chain is: 5'GAGUGGGUCAAUGUGUGUAAA3', and antisense chain is: 5'UUUACACACAUUGACCCACUC3'; siWNT10B can inhibit the transcription, translation and secretion levels of WNT10B in breast cancer cells; inhibiting the secretion of WNT10B in breast cancer cells can inhibit the regulation of IDO1 levels in adipocytes by the WNT10B-β-catenin signaling axis, thereby inhibiting the formation of tumor-associated adipocytes, thereby achieving the purpose of inhibiting the malignant progression of breast cancer.
9. Use of a reagent for detecting the expression of IDO1 in the preparation of a product for detecting the tryptophan metabolism level or dedifferentiation characteristics of tumor-associated adipocytes.
10. The use according to claim 9, Features: The detection reagent is an antibody, which reacts the IDO1 level by immunoblotting. The expression of IDO1 is positively correlated with the formation of tumor-associated adipocytes. In tumor-associated adipocytes with high expression of IDO1, tryptophan metabolism is abnormally vigorous.