Application of LRTOR in early warning of drug resistance and transfer of NSCLC osimertinib, guidance of clinical medication of osimertinib and disease prognosis

Abstract

The invention belongs to the technical field of biology, discloses application of LRTOR in early warning of NSCLC osimertinib drug resistance and transfer, guiding of osimertinib clinical medication and disease prognosis, and particularly discloses application of LncRNA LRTOR as a biomarker. The invention provides a novel lncRNA (long non-coding ribonucleic acid) which is named as LRTOR (long non-coding ribonucleic acid). The invention discloses that the expression level of LRTOR is remarkably positively correlated with osimertinib drug resistance of NSCLC and tumor cell invasion and metastasis and is remarkably negatively correlated with prognosis (lifetime) for the first time. It is prompted that LRTOR is expected to become a molecular target to be used for early warning of osimertinib drug resistance and metastasis of NSCLC, and clinical medication of osimertinib and disease prognosis are guided.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to the application of LRTOR in early warning of osimertinib resistance and metastasis of NSCLC, guiding the clinical use of osimertinib and disease prognosis. Background Art

[0002] EGFR mutation is the most common driver mutation in non-small cell lung cancer, and approximately 50% of Asian adenocarcinoma patients carry EGFR mutations. Although EGFR tyrosine kinase inhibitors (TKIs) initially work well for most patients with EGFR mutations, almost all patients eventually develop disease progression due to resistance to targeted drugs. T790M mutation is the main mechanism of acquired resistance to first- and second-generation EGFR-TKIs. The third-generation EGFR-TKI represented by osimertinib (OSI) is selective for EGFR T790M resistance mutations, has strong efficacy against EGFR initiating mutations, and has few side effects. Although osimertinib has significant efficacy in the first-line and second-line treatment of non-small cell lung cancer with EGFR mutations, patients usually develop resistance in about a year. So far, there is still a lack of effective alternative therapies for osimertinib resistance. Therefore, the clinical diagnosis of osimertinib resistance urgently requires early and accurate prediction and precise evaluation before osimertinib resistance occurs.

[0003] Only about 1.2% of human genes encode proteins, and more than 98% of RNA is non-coding RNA (ncRNA). Among them, ncRNA with a length greater than 200 nucleotides is called long non-coding RNA (lncRNA). Studies have shown that abnormal expression of lncRNA is common in tumors. LncRNA can induce tumor resistance by enhancing DNA repair, changing signal transduction, affecting mitochondrial function, regulating cell cycle progression, inducing EMT and cancer stem cell (CSC) transformation. Some lncRNAs in tumors and blood have been confirmed by research to be used as biomarkers for diagnosis and prevention of some diseases, such as cancer. Its important significance lies in providing a new diagnostic and prognostic means. Using existing mature laboratory technology, a detection method using lncRNAs as a marker can be quickly established. Compared with other diagnostic technologies, this new method has the characteristics of high specificity, simple method, easy specimen acquisition, and small specimen usage, which makes the new detection method based on lncRNAs have great clinical application potential. Summary of the invention

[0004] The present invention aims to use the lncRNA marker LRTOR to diagnose and warn of NSCLC osimertinib resistance and metastasis, and to guide the clinical use of osimertinib and disease prognosis.

[0005] The purpose of the first aspect of the present invention is to provide the use of LncRNA LRTOR as a biomarker.

[0006] The second aspect of the present invention aims to provide the use of a substance for detecting LncRNA LRTOR in preparing a product.

[0007] The third aspect of the present invention aims to provide a product for diagnosing or evaluating osimertinib resistance in lung cancer.

[0008] The fourth aspect of the present invention aims to provide a system for diagnosing or evaluating osimertinib resistance in lung cancer.

[0009] In order to achieve the above object, the technical solution adopted by the present invention is:

[0010] The first aspect of the present invention provides the use of LncRNA LRTOR as a biomarker, wherein the use includes any one of (a1) to (a3):

[0011] (a1) preparing products for diagnosis, early warning or prognosis of osimertinib resistance in lung cancer;

[0012] (a2) preparing a product for evaluating the invasion and metastasis ability of lung cancer cells;

[0013] (a3) preparing a product for guiding the suitability of clinical drugs for lung cancer, wherein the drug comprises osimertinib;

[0014] The nucleotide sequence of the LncRNA LRTOR is shown in SEQ ID NO:5.

[0015] In some embodiments of the present invention, the product includes at least one of a drug, a reagent, a kit, a test paper, a system and a chip.

[0016] The second aspect of the present invention provides use of a substance for detecting LncRNA LRTOR in preparing a product.

[0017] In some embodiments of the present invention, the substance for detecting LncRNA LRTOR comprises a substance for quantitatively detecting LncRNA LRTOR.

[0018] In some embodiments of the present invention, the substance includes a substance for detecting LncRNA LRTOR at the gene or protein level.

[0019] In some embodiments of the present invention, the substance for detecting LncRNA LRTOR includes a substance for detecting the LncRNA LRTOR by enzyme-linked immunosorbent assay, immunofluorescence, radioimmunoassay, immunocoprecipitation, immunoblotting, high performance liquid chromatography, capillary gel electrophoresis, near infrared spectroscopy, mass spectrometry, immunochemiluminescence, colloidal gold immunoassay, fluorescence immunochromatography, surface plasmon resonance, PCR, immuno-PCR, flow cytometry, single cell sequencing or biotin-avidin technology.

[0020] In some embodiments of the present invention, the substance for detecting LncRNA LRTOR is selected from: a substance specific to LncRNA LRTOR, a probe specific to LncRNA LRTOR, a gene chip, and a PCR primer.

[0021] In some embodiments of the present invention, the substance specific to LncRNA LRTOR is any one of (f1) to (f3):

[0022] (f1) Antibodies that specifically bind to LncRNA LRTOR;

[0023] (f2) a ligand protein or polypeptide that specifically binds to LncRNA LRTOR;

[0024] (f3) Non-protein compounds that specifically recognize LncRNA LRTOR.

[0025] In some embodiments of the present invention, the antibody comprises at least one of a polyclonal antibody, a monoclonal antibody, a single-chain antibody, a functional antibody fragment, an antibody Fab region, a nanobody, a chimeric antibody, and a multispecific antibody.

[0026] In some embodiments of the present invention, the LncRNA LRTOR-specific probe is shown as SEQ ID NO: 3 or SEQ ID NO: 4.

[0027] In some embodiments of the present invention, the PCR primers include an upstream primer and a downstream primer, and the sequences of the upstream primer and the downstream primer are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0028] In some embodiments of the present invention, the substance may also include enzymes and reagents commonly used in detection reactions.

[0029] In some embodiments of the present invention, the product includes at least one of a reagent, a kit, a test paper, a system and a chip.

[0030] In some embodiments of the present invention, the lung cancer includes non-small cell lung cancer.

[0031] In some embodiments of the present invention, the test sample of the product is selected from at least one of the body fluids (such as blood, urine, etc.), tissues (such as tumor tissue), cells, and excrement of the subject to be tested.

[0032] In some embodiments of the present invention, the product has at least one of the following functions: used for diagnosing, warning or prognosing osimertinib resistance in lung cancer, used for evaluating the invasion and metastasis ability of lung cancer cells, or guiding clinical drug use in lung cancer.

[0033] The third aspect of the present invention provides a product for diagnosing or evaluating osimertinib resistance in lung cancer, comprising the substance for detecting LncRNA LRTOR as described in the second aspect of the present invention.

[0034] A fourth aspect of the present invention provides a system for diagnosing or evaluating osimertinib resistance in lung cancer, comprising:

[0035] A detection module, used to detect the expression level of LncRNA LRTOR in lung cancer patient samples;

[0036] The analysis module is used to obtain the above test results and determine the diagnosis results according to predetermined rules.

[0037] In some embodiments of the present invention, the predetermined rule is: when the expression level of LncRNA LRTOR is detected to be higher than that of normal samples, it is judged that the osimertinib resistance of lung cancer is high.

[0038] The beneficial effects of the present invention are:

[0039] The present invention proposes a novel lncRNA, which is named LRTOR. It is disclosed for the first time that the expression level of LRTOR is significantly positively correlated with osimertinib resistance and tumor cell invasion and metastasis of NSCLC, and significantly negatively correlated with prognosis (survival period). This suggests that LRTOR is expected to become a molecular target for early warning of osimertinib resistance and metastasis of NSCLC, guiding the clinical use of osimertinib and the prognosis of the disease.

[0040] By detecting LRTOR expression in tumor tissues and body fluids (such as blood, urine, etc.), NSCLC osimertinib resistance and metastasis can be warned, osimertinib clinical use can be guided, and disease prognosis can be evaluated. Compared with traditional clinical detection methods, the method of the present invention is simpler, more sensitive, more specific, and more accurate, and has broad clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1Figure 2 shows the growth (A), clone formation (B), invasion and metastasis (C), and LRTOR expression level (RT-qPCR) (D) of osimertinib-resistant and sensitive NSCLC cells. In the figure, ** represents p < 0.01, *** represents p < 0.001, and **** represents p < 0.0001.

[0042] Figure 2 The expression levels of LRTOR in osimertinib-resistant and -sensitive NSCLC tumors (probe and RT-qPCR) (A), pathological section analysis of tumors (B), the relationship between LRTOR expression level and survival rate (C), and ROC curve (D). DETAILED DESCRIPTION

[0043] The present invention is further described in detail below through specific examples.

[0044] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0045] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0046] The gene sequence of lncRNA LRTOR (abbreviated as LRTOR) mentioned in the example is shown in SEQ ID NO:5.

[0047]

[0048] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0049] Example 1 Establishment of osimertinib-resistant NSCLC cell line and detection of its proliferation, invasion and metastasis ability

[0050] The method for establishing an NSCLC osimertinib-resistant cell line is as follows: osimertinib-sensitive NSCLC cell lines HCC827 and H1975 cells are cultured in a culture medium containing 0.3 μM osimertinib, respectively, and the osimertinib concentration is gradually increased to 1 μM, and the resistant cell lines are maintained in a culture medium containing 1 μM osimertinib to obtain NSCLC osimertinib-resistant cell lines.

[0051] To evaluate cell viability, osimertinib-sensitive or -resistant cells were plated at a density of 2,000 cells per well in 96-well plates. TM II luminescent cell viability assay reagent was used to measure cell viability and the manufacturer's instructions were followed. To evaluate cell proliferation and clone formation, cells were cultured in 6-well plates at a density of 700 cells per well and allowed to grow for 14 days. Afterwards, cells were fixed with 4% paraformaldehyde and clone formation was observed with crystal violet staining.

[0052] The results are as follows Figure 1 As shown in A and B, the resistance of osimertinib-resistant cells to osimertinib was significantly enhanced. PAR, osimertinib-sensitive cell line, OSIR, osimertinib-resistant cell line.

[0053] In order to evaluate the invasion and metastasis ability of cells, 50,000 osimertinib-sensitive and -resistant cells were reselected with serum-free medium and inoculated in the upper chamber. 1 mL of complete medium containing 20% ​​serum was added to the lower chamber. After 24 hours, the cells were fixed with 4% paraformaldehyde and stained with crystal violet. After wiping off the cells that did not pass through the membrane in the upper chamber, the number of cells was observed under a microscope and recorded.

[0054] The results are as follows Figure 1 As shown in C, osimertinib-resistant cells have stronger invasion and metastasis capabilities. PAR, osimertinib-sensitive cell line, OSIR, osimertinib-resistant cell line.

[0055] Example 2 Detection of LRTOR expression levels in osimertinib-sensitive and -resistant cells and patient tumor tissues

[0056] Total RNA from cells (Example 1) or frozen tumor tissue (patient samples from the Department of Pathology of the Fifth Affiliated Hospital of Sun Yat-sen University) was extracted using TRIZOL, and the RNA integrity and concentration were measured. The RNA was then reverse transcribed into cDNA, specifically by preparing a reaction system as shown in Table 1, incubating at room temperature for 5 minutes, and obtaining cDNA. Then, RT-qPCR was performed according to the reaction system prepared in Table 2 to measure the expression of LRTOR, and the LRTOR primers used were: upstream primer: GGAGTGGGCCTTGAGATTCT (SEQ ID NO: 1), downstream primer: TTTTGGAGGAAGGGCTAGGG (SEQ ID NO: 2).

[0057] Table 1 Reaction system for reverse transcription of RNA into cDNA

[0058]

[0059] Table 2 RT-qPCR reaction system

[0060]

[0061] The results are as follows Figure 1 Medium D and Figure 2 As shown in middle A, the expression of LRTOR was significantly increased in osimertinib-resistant cells and tumor tissues, while LRTOR was hardly expressed in osimertinib-resistant cells and tumor tissues.

[0062] Example 3 Detection of LRTOR expression levels in osimertinib-sensitive and osimertinib-resistant patients

[0063] Patient paraffin-embedded tumor tissue sections were obtained from the Department of Pathology of the Fifth Affiliated Hospital of Sun Yat-sen University. Tumor sections were first fixed with 4% paraformaldehyde for 10 minutes and then permeabilized with 0.5% Triton X-100 for 15 minutes at room temperature. After permeabilization, they were incubated with 40nM LRTOR probe (probe sequences were UAUAAUGCUCUGAACUUUCUU (SEQ ID NO: 3) and GAAAGUUCAGAGCAUUAUACU (SEQ ID NO: 4)) at 37°C for 12 hours. After incubation, the samples were washed with 4x, 2x, 1xSSC and PSB in sequence, and finally, stained with DAPI and images were taken using a Leica TCS SP8 confocal laser scanning microscope system.

[0064] The results are as follows Figure 2 As shown in B, the red color indicates the expression of LRTOR. The expression of LRTOR is significantly increased in patients with osimertinib resistance, indicating that the expression of LRTOR is significantly positively correlated with osimertinib resistance and invasion and metastasis of NSCLC cells.

[0065] Example 4 Relationship between LRTOR expression and overall survival (OS) of osimertinib-resistant patients and ROC curve analysis

[0066] 68 NSCLC patients treated with osimertinib were recruited (recruited by the Department of Thoracic Oncology, Tumor Center, Fifth Affiliated Hospital of Sun Yat-sen University, and the frozen samples of the patients were from the Department of Pathology, Fifth Affiliated Hospital of Sun Yat-sen University, and the patients were different from those in Examples 2-3). The basis for recruitment was: osimertinib-sensitive and osimertinib-acquired resistance NSCLC patients. According to the median LRTOR expression of tumor tissue, they were divided into LRTOR high expression group and LRTOR low expression group. The tumor tissues of each group were analyzed to obtain the relationship between LRTOR expression level and patient overall survival rate and ROC curve.

[0067] The results are as follows Figure 2 As shown in Figure C, the LRTOR expression level is significantly negatively correlated with the patient's overall survival rate. The overall survival rate of patients with high LRTOR expression is significantly lower than that of patients with low LRTOR expression. Figure 2 As shown in D, the expression of LRTOR was detected in osimertinib-resistant tumor tissues, but not in sensitive tissues (Ct value > 35), with a sensitivity and specificity of 100%, indicating that the detection of LRTOR expression levels in clinical samples has broad clinical application prospects for early warning of osimertinib resistance and metastasis of NSCLC, guiding the clinical use of osimertinib and disease prognosis.

[0068] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Application of LncRNA LRTOR as a biomarker, characterized by: The application includes any one of (a1) to (a3): (a1) preparing products for diagnosis, early warning or prognosis of osimertinib resistance in lung cancer; (a2) preparing a product for evaluating the invasion and metastasis ability of lung cancer cells; (a3) preparing a product for guiding clinical medication for lung cancer, wherein the drug comprises osimertinib; The nucleotide sequence of the LncRNA LRTOR is shown in SEQ ID NO:

5.

2. Application of substances for detecting LncRNA LRTOR in product preparation.

3. The use according to claim 2, characterized in that The substance for detecting LncRNA LRTOR includes a substance for quantitatively detecting LncRNA LRTOR.

4. The use according to claim 2, characterized in that The substance includes a substance for detecting LncRNA LRTOR at the gene or protein level.

5. The use according to any one of claims 2 to 4, characterized in that: The substance for detecting LncRNA LRTOR includes a substance for detecting the LncRNA LRTOR by enzyme-linked immunosorbent assay, immunofluorescence, radioimmunoassay, immunoprecipitation, immunoblotting, high performance liquid chromatography, capillary gel electrophoresis, near-infrared spectroscopy, mass spectrometry, immunochemiluminescence, colloidal gold immunoassay, fluorescence immunochromatography, surface plasmon resonance, PCR, immuno-PCR, flow cytometry, single-cell sequencing or biotin-avidin technology.

6. The use according to any one of claims 2 to 4, characterized in that: The product includes at least one of a reagent, a kit, a test paper, a system and a chip.

7. The use according to any one of claims 2 to 4, characterized in that The lung cancer includes non-small cell lung cancer.

8. The use according to any one of claims 2 to 4, characterized in that The test sample of the product is selected from at least one of the body fluids, tissues, cells, and excretions of the subject to be tested.

9. A product for diagnosing or evaluating osimertinib resistance in lung cancer, comprising the substance for detecting LncRNA LRTOR according to any one of claims 2 to 8.

10. A system for diagnosing or evaluating osimertinib resistance in lung cancer, comprising: A detection module for detecting the expression level of LncRNA LRTOR in lung cancer patient samples; The analysis module is used to obtain the above test results and determine the diagnosis results according to predetermined rules.

Images