Application of CYP19A1 gene g.44057117T>G site in growth traits of goats

Abstract

The present invention belongs to the technical field of molecular marker-assisted selection of goats, and specifically relates to a molecular marker associated with growth traits in the CYP19A1 gene of goats and its application. The molecular marker is located at g.44057117T>G on chromosome 10 of the goat genome Capra hircus ARS1.2, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. The mutation site is at the 121st base in the sequence, and the SNP site mutation of the present invention can significantly affect the growth traits of goats, providing a new molecular marker for goat growth trait detection or molecular marker-assisted breeding. The present invention also provides a substance for detecting single nucleotide polymorphism of SNP sites associated with goat growth traits, including related primers and a kit. The present invention provides a new selection site for molecular marker-assisted selection of goats, and the site is selected to detect the growth traits of goats, with a high detection rate and short time consumption.

Description

Technical Field

[0001] The invention relates to the technical field of goat molecular marker assisted selection, and in particular to application of a CYP19A1 gene g.44057117T>G site in goat growth traits. Background Art

[0002] With the development of society and the improvement of living standards, people's dietary concepts have changed, and their requirements for healthy diets have increased, from initially eating enough to eating well today. As a high-quality food with high protein, low fat, and low cholesterol, and rich in amino acids, vitamins, and a variety of trace elements, mutton has increased its share in the dietary consumption structure of residents. Compared with other mutton varieties, goat meat is popular among consumers because of its high quality, low mutton smell, and good flavor.

[0003] The growth traits of goats (weight, height, body length, etc.) are quantitative traits affected by micro-effect polygenes and are related to multiple factors such as genetic factors, feeding management and environmental factors. Their size can directly reflect the growth and fattening speed of goats and is an important indicator for evaluating the production performance of mutton sheep. Breeding mutton sheep with excellent meat performance such as large size, fast growth and development, high meat production rate and delicious meat can significantly improve the economic benefits of breeding. However, traditional breeding and improvement work cycles are long and difficult. In order to cope with this problem, molecular marker-assisted selection has become a widely used molecular breeding method. It can accurately locate candidate genes for excellent traits at the DNA level. This method can accurately screen individuals with genetic information that controls or affects excellent traits, greatly improving the breeding speed and efficiency of breeding.

[0004] Single nucleotide polymorphism (SNP) is widely used in animal genetic breeding research due to its large number, wide distribution, strong genetic stability, and easy large-scale rapid detection. It has important application value in the fields of marker-assisted selection, animal genetic map construction, kinship identification, and breed traceability. Using SNP to assist in the selection of goat growth traits will help improve the growth efficiency of goats in my country and increase mutton production. Whole Genome Sequencing (WGS) is a new gene detection technology that uses high-throughput sequencing technology to sequence the complete genome sequence in individuals or groups to discover information such as sequence or structural variations. Then, the association between single nucleotide polymorphism sites and specific complex traits is analyzed through genome-wide association study (GWAS) to determine the genetic variation related to the trait.

[0005] Cytochrome P450 aromatase (CYP19A1) is a key enzyme in the synthesis of gonadal hormones in most animals and is mainly distributed in animal gonads, liver, fat, brain and other tissues. Reducing the expression level of CYP19A1 in animal granulosa cells will lead to a decrease in E2 secretion. Therefore, the expression level of CYP19A1 in the body is closely related to the level of steroid hormones and reproductive diseases. The present invention uses the CYP19A1 gene for the first time to study its relationship with goat growth traits. Summary of the invention

[0006] The purpose of the present invention is to provide a molecular marker in goat CYP19A1 gene and application thereof, and to provide a new molecular marker for goat growth traits and molecular marker-assisted breeding.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] The invention provides an application of a molecular marker in a goat CYP19A1 gene in detecting goat growth traits. The molecular marker is a T>G base mutation at a g.44057117 site in a goat genome version ARS1.2.

[0009] The present invention also provides an application of a molecular marker in a goat CYP19A1 gene in detecting goat growth traits, wherein the molecular marker is a T>G base mutation existing at the 121 bp position in the sequence shown in SEQ ID NO.1 in the goat genome.

[0010] The present invention also provides a method for detecting growth traits of goats, which detects the base type at the g.44057117 site in the goat genome version ARS1.2 or the 121 bp in the sequence shown in SEQ ID NO.1. The March weight, March body height and March body oblique length of the GG genotype goats are all higher than those of the TT genotype and the TG genotype.

[0011] The present invention also provides a substance for detecting single nucleotide polymorphism of a goat SNP site, including a PCR primer for amplifying a genomic DNA fragment including the SNP site or a kit containing the primer.

[0012] The present invention also provides a molecular marker associated with goat growth traits in the CYP19A1 gene, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and a T>G base mutation exists at the 121 bp position in the SEQ ID NO.1.

[0013] The above-mentioned substance for detecting single nucleotide polymorphism of goat SNP site or molecular marker associated with goat growth traits is used in goat genetic breeding, and the genetic breeding is to improve the growth traits of offspring goats.

[0014] The present invention also provides a genetic breeding method for improving goat growth traits, and corresponding selection is made according to the single nucleotide polymorphism of the goat SNP site: the successive breeding of breeding goats selects individuals with a GG type base at the 121bp position in the sequence shown in SEQ ID NO.1, and eliminates TT and TG type individuals.

[0015] Preferably, the goat growth traits are the goat's March weight, March body height and March body oblique length.

[0016] Beneficial effects of the present invention:

[0017] (1) The present invention discovered a molecular marker associated with goat growth traits in the goat CYP19A1 gene, wherein the molecular marker contains a SNP site of g.44057117T>G; the haplotype composed of the above SNP site can be used as a molecular marker for goat growth traits.

[0018] (2) The present invention verifies the effects of SNP molecular markers on goat weight, body height and body length in March, which can be used to improve the growth performance of offspring, thereby increasing the market competitiveness of breeding enterprises.

[0019] (3) The present invention provides a new molecular marker for molecular marker-assisted breeding of goat growth traits, thereby achieving early selection of goat growth traits and shortening the breeding process; the detection method is fast and accurate, and is not affected by breeding environment conditions. DETAILED DESCRIPTION

[0020] The invention provides an application of a molecular marker in a goat CYP19A1 gene in detecting growth traits of a goat.

[0021] The present invention firstly obtains all SNP sites on the CYP19A1 gene by whole genome resequencing of goat genomic DNA, and then obtains a molecular marker g.44057117T>G associated with the growth trait by analyzing the correlation between each site and the growth trait.

[0022] The embodiment of the present invention performs whole genome resequencing on 500 black-headed goats (the offspring of Macheng black goats and Boer goats), of which 466 are sequenced at a low depth of 1X and 34 are sequenced at a high depth of 15X, with the purpose of filling the genotype of the low depth sequencing results (more) with the high depth sequencing results (less) to reduce the sequencing cost. Then, the resequencing data is compared with the goat reference genome (genome version ARS1.2), and the Sentieon+Beagle strategy is used to detect genetic variations and fill genotypes for all autosomes of the 500 samples, and all SNP sites on the CYP19A1 gene are obtained. Finally, the SNP sites are associated with the growth traits of goats, and the molecular markers related to the growth traits of goats are screened: g.44057117T>G.

[0023] Molecular marker of g.44057117T>G site: The nucleotide sequence of this fragment is shown in SEQ ID NO:1, and there is a T>G base mutation at the 121 bp position in the sequence;

[0024] ATTTCTTTTTCTGGAGGAGAGATAATAGAAACCAACAAGGGAGAT CTGGTGGGATAAAGATTGTGCAGTTGGCTTGGACTCCCCTTAGGGCACCATAGGGAGACCTCAGCCACAAGCTTNCCTTACACATAGGAAAGACAGTTGATGGTGCCTGAAAGGCAAGTTTCTCTAGTAAATATCAAAATCTACATTTCACATGAGCACACAGATCCAAAGCTCTTGAGTGTCAGGCAGGCCTGGGGCT (SEQ ID NO. 1).

[0025] The results of GWAS analysis showed that the molecular marker of the g.44057117T>G locus was significantly correlated with the growth traits of goats. The weight, body height, body length and chest circumference in March of individuals with genotype GG were significantly higher than those of individuals with TT and TG genotypes, indicating that G is an allele that is beneficial to the improvement of growth traits and is of great significance to goat breeding.

[0026] The molecular markers screened by the present invention can be applied to the genotype of genes related to goat growth traits or the association analysis related to goat growth traits, providing a new molecular marker resource for molecular marker-assisted selection of goat growth traits.

[0027] The present invention does not limit the breed of goats, and preferably goats such as Dongbao black-headed goats, Macheng black goats and Boer goats. The blood / cell genomic DNA kit of the present invention was purchased from Beijing Tianmo Technology Development Co., Ltd.; the production process, experimental method or detection method involved in the embodiments of the present invention, unless otherwise specified, are conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the art.

[0028] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0029] Example 1 Goat Whole Genome Resequencing

[0030] 1. Blood collection and leukocyte separation

[0031] Collect 5 mL of goat venous blood in an EDTA anticoagulant tube, place the anticoagulant tube in an ice box with ice packs, bring it back to the laboratory and store it in a 4°C refrigerator, and extract white blood cells. The specific steps are as follows:

[0032] (1) Take 2 mL of blood into a 10 mL centrifuge tube;

[0033] (2) Add ultrapure water to the 9-10 mL mark, invert 20 times, and let stand for 10 minutes;

[0034] (3) Place the centrifuge tube in a centrifuge and centrifuge at 5000 rpm for 10 min. Discard the supernatant (try to pour out the supernatant as much as possible and do not pour out the white blood cells at the bottom);

[0035] (4) Repeat steps (2) and (3);

[0036] (5) Store the separated white blood cells in a -80°C refrigerator for future use.

[0037] 2. Genomic DNA extraction and whole genome resequencing

[0038] The blood / cell genomic DNA kit was used to extract DNA from leukocytes. The specific method is described in the instructions. The genomic DNA that passed the quality inspection was sent to Beijing Novogene Technology Co., Ltd. for secondary quality inspection and library construction, and the whole genome resequencing of PE150 was performed on the BGI platform. The original data was obtained in FASTQ format. 34 samples were subjected to high-depth whole genome resequencing, with an average sequencing depth of approximately 19.72X and a total data size of 1.4T; 466 samples were subjected to low-depth whole genome resequencing, with an average sequencing depth of approximately 1.65X and a total data size of 1.6T.

[0039] Example 2 Genome alignment, genetic variation detection and genotype filling

[0040] 1. Raw sequencing data analysis and genome alignment

[0041] The high-depth sequencing data and low-depth sequencing data were quality controlled using the same process.

[0042] (1) The raw data were filtered using Fastp software. The filtering criteria were as follows: reads with a base quality value lower than 20 and a ratio of more than 30% were removed; reads with an n base greater than 5% were removed. Clean reads were obtained after quality control in the above steps.

[0043] (2) Use BWA software to align clean reads to the goat reference genome Capra_hircus.ARS1.2).

[0044] (3) Use Samtools software to sort the aligned BAM files.

[0045] (4) Use Picard to mark duplicate reads.

[0046] (5)Samtools software builds the index.

[0047] 2. Detection of variant sites and genotype filling

[0048] (1) GATKHaploytypeCaller generates a gvcf file for each sample according to the autosome number.

[0049] (2) GATKCombineGVCFs merges the gvcf files of each sample of a single chromosome.

[0050] (3) GATKGenotypeGVCFs performs population SNP calling by chromosome.

[0051] (4) GATKMergeVcfs merges autosomal population vcf files.

[0052] (5) GATKSelectVariants screens SNPs in population vcf files.

[0053] (6) GATKVariantFiltration marks false positive SNP sites.

[0054] (7) The grep command filters the marked SNP sites.

[0055] (8) Plink software was used to filter SNP sites (geno0.1--maf0.05--hwe1e-06).

[0056] (9) Beagle software was used to fill in the missing sites.

[0057] (10) Use Sentieon Haplotyper and GVCFtyper modules to detect and type genetic variations in population genomes.

[0058] (11) Beagle was used for genotype filling, and ultimately 26,131,221 high-quality SNPs were obtained.

[0059] Example 3 Detection of polymorphic distribution of molecular markers in goat populations

[0060] The genotype frequency and allele frequency of the SNP loci of the CYP19A1 gene after typing in black-headed sheep were calculated. The specific formula and method are as follows:

[0061] Genotype frequency = number of individuals with the genotype / total number of samples in the test population;

[0062] Allele frequency = homozygous genotype frequency of the allele + heterozygous genotype frequency of the gene / 2.

[0063] SPSS software was used to perform differential analysis on the distribution of different genotypes at SNP sites. Hardy-Weinberg equilibrium is an ideal situation for a population (not affected by specific interference factors, such as non-random mating, selection, migration, mutation or limited population size). After many generations, the gene frequency and genotype frequency will remain constant and in a stable equilibrium state.

[0064] p 2 represents the frequency of homozygous alleles (such as Y), q2 represents the frequency of homozygous alleles (such as y), and 2pq represents the frequency of heterozygotes (such as Yy). If a population reaches genetic equilibrium, its genotype frequency should meet 2(p+q)=p 2 +2p2q2+q2=1. Based on the theoretical value, the actual value can be calculated to perform a chi-square test to determine whether each gene in the population is in a Hardy-Weinberg equilibrium state:

[0065] χ2=∑(Oi-Ei) 2 / Ei

[0066] Among them, O represents the observed value of gene frequency, E represents the expected value of gene frequency, and χ2 is the obtained chi-square test value. Compare the calculated chi-square value with the corresponding chi-square table. If the p-value range is greater than 0.05, it means that this site conforms to Hardy-Weinberg equilibrium. If it is less than 0.05, this site deviates from Hardy-Weinberg equilibrium.

[0067] The test results are shown in Table 1: The SNP loci showed three genotypes in the goat population, g.44057117T>G was dominated by homozygous TT, and allele T was the dominant allele. And the chi-square test found that this polymorphic locus did not conform to the Hardy-Weinberg law (P>0.05).

[0068] Table 1 Genetic information parameters of CYP19A1 gene SNPs in goat population

[0069]

[0070]

[0071] Example 4 Association analysis and application of molecular markers with goat growth traits

[0072] In order to determine the association analysis between the g.44057117T>G locus of the CYP19A1 gene and the growth traits of goats, the fixed linear model was used for calculation using the SAS self-programming language. The fixed effects for subsequent analysis were determined by performing multiple regression and analysis of variance on the traits. Several models with all possible combinations of fixed effects were tested, and the significance of each effect was systematically evaluated, and each non-significant effect was removed from the model in a stepwise manner. The final model is as follows:

[0073] Yikjlm=μ+Ii+Ak+Bj+Cl+Dm+Eikjlm

[0074] Y is the trait value, I is the genotype fixed effect, A is the ram fixed effect, B is the litter fixed effect, C is the sex fixed effect, D is the animal random effect, μ is the mean of a single trait, and E is the random error.

[0075] (3) Additive dominant effect value SAS statistical software was used to analyze the genetic effect of genotype on ewe growth traits using linear models, and the GLM program was used to analyze the association between markers and traits. The statistical model for gene effect analysis: except for the individual ewe as a random effect, all other factors were fixed effects. The model used is as follows:

[0076] Model 1: Y = overall mean + genotype + farm environment effect + residual

[0077] Model 2: Y = overall mean + additive effect + dominant effect + farm environment effect + residual

[0078] Among them, Y is the phenotypic value of the trait, additive effect = (homozygous 1 - homozygous 2) / 2, with 1, 0, and -1 representing homozygous 1, heterozygous, and homozygous 2 respectively; dominant effect = heterozygous - (homozygous 1 + homozygous 2) / 2, with 1, -1, and 1 representing homozygous 1, heterozygous, and homozygous 2 respectively.

[0079] The statistical analysis results are shown in Table 2: The weight, height and oblique length of the GG genotype in the g.44057117T>G locus in March were significantly higher than those of the TT genotype and the TC genotype (P<0.05). The results show that the selection of ewes with the GG genotype in the g.44057117T>G locus is expected to improve the growth traits of goats.

[0080] Table 2 Association analysis between CYP19A1 gene polymorphisms and goat growth traits

[0081]

[0082]

[0083] Note: The values ​​in the table are expressed as mean ± standard error. Different lowercase letters in the same row of data indicate significant differences (P<0.05), and the same letters indicate insignificant differences (P>0.05).

[0084] From the above examples, it can be seen that the CYP19A1 gene g.44057117T>G site of the present invention can be used as a new molecular marker for genetic improvement of goat growth traits, applied to the detection of goat growth traits, and helpful for the selection of goats with excellent growth traits.

[0085] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. The use of a reagent for detecting molecular markers in goat CYP19A1 gene in detecting growth traits of goats, characterized in that: The molecular marker is a T>G base mutation at the g.44057117 site of chromosome 10 in goat genome version ARS1.2, or a T>G base mutation at the 121 bp in the sequence shown in SEQ ID NO.1; the goat is a black-headed goat; The growth traits of the goats are the goat's weight in March, body height in March and body oblique length in March; the weight in March, body height in March and body oblique length in March of the GG genotype goats with the base mutation are all higher than those of the TT genotype and TG genotype goats.

2. A method for detecting growth traits of goats, characterized in that: The growth traits of the goat are the goat's body weight in March, body height in March and body oblique length in March; The T>G base mutation at the g.44057117 site of chromosome 10 in the goat genome version ARS1.2, or the T>G base mutation at the 121bp in the sequence shown in SEQ ID NO.1, is detected. The March weight, March body height and March body oblique length of the GG genotype goats with the base mutation are all higher than those of the TT genotype and TG genotype; the goats are black-headed goats.

3. Application of a reagent for detecting molecular markers in goat CYP19A1 gene in goat genetic breeding, characterized in that: The genetic breeding is to improve the growth traits of offspring goats, the growth traits of the goats are the goats' weight in March, body height in March and body oblique length in March; the goats are black-headed goats; The molecular marker is a T>G base mutation at the g.44057117 site of chromosome 10 in goat genome version ARS1.2, or a T>G base mutation at the 121 bp in the sequence shown in SEQ ID NO.1; The sub-breeding of breeding sheep selects individuals with GG type bases at the g.44057117 site in the goat genome version ARS1.2 or at the 121 bp in the sequence shown in SEQ ID NO.1, and eliminates TT and TG type individuals.

4. A genetic breeding method for improving goat growth traits, characterized in that: Make corresponding selections based on the goat SNP sites; for the successive breeding of breeding goats, select individuals with a GG base at the g.44057117 site on chromosome 10 in the goat genome version ARS1.2 or at the 121 bp in the sequence shown in SEQ ID NO.1, and eliminate TT and TG individuals; The goat is a black-headed goat; the growth traits of the goat are the goat's weight in March, body height in March and body oblique length in March.

Images