ST3GAL4 gene SNP molecular marker related to feed conversion rate of yellow feather broilers and application of ST3GAL4 gene SNP molecular marker

Abstract

The invention discloses an ST3GAL4 gene SNP molecular marker related to the feed conversion rate of yellow feather broilers and application of the ST3GAL4 gene SNP molecular marker, and belongs to the technical field of genetic genes. The RS number of the SNP molecular marker is rs1059726276, the polymorphism of the SNP molecular marker is G / A, and the SNP molecular marker is located at the 471871th basic group of the 24th chromosome of a chicken. The molecular marker provided by the invention is proved to be remarkably related to the feed conversion rate character of the yellow-feather broiler breeding hens, and can be applied to breeding of the yellow-feather broiler breeding hens, the yellow-feather broiler breeding hens with low feed conversion rate are selected and reserved in the breeding process, the feed consumption in the production process can be effectively reduced, and the economic benefits and competitiveness of enterprises are improved; a primer and a kit for identifying the SNP molecular genetic marker can be applied to efficiently screening individual or parent yellow feather broiler breeding hens with excellent characters of feed conversion rate.

Description

Technical Field

[0001] The invention relates to the field of genetic gene technology, and in particular to a ST3GAL4 gene SNP molecular marker associated with the feed conversion rate of yellow-feathered broiler chickens and an application thereof. Background Art

[0002] As an important economic trait, feed conversion rate has always been the focus of attention of domestic and foreign chicken farming companies and breeder improvement companies. In the mid-20th century, feed efficiency was studied using feed / gain ratio (F / G), which is a quantitative trait with medium heritability. Yellow-feathered broilers are a unique germplasm resource in my country. High quality and high efficiency are the breeding directions of yellow-feathered broilers. In 2015, Mignon G et al. detected 13 QTLs related to feed conversion rate in chickens. ST3GAL4 encodes an enzyme involved in glycosylation modification, which adds sialic acid groups to sugar chains. Glycosylation modification plays an important role in protein synthesis and cell signaling, especially in the synthesis of glycolipids and glycoproteins, which are closely related to energy metabolism and metabolic regulation. A study selected the SNP site rs475471G>A on ST3GAL4 and conducted population genetic analysis on 18 chicken breeds. The analysis showed that the QTL in ST3GAL4 was highly correlated with the level of alkaline phosphatase (ALP), and the activity of ALP can reflect the growth traits of animals. Among them, the ALP level of genotype AA individuals was the highest, followed by GA and GG carriers. The body weight, semi-visceral weight, visceral weight and leg weight of AA and GA genotype mutation individuals were higher than those of GG genotype at 4 weeks.

[0003] The use of SNP markers to assist in the selection of traits related to feed efficiency has an important impact on chicken production management and the economic benefits of enterprises. (1) Chickens with low feed conversion rates have high feed utilization efficiency, which can reduce feed usage and production costs in production, thereby saving feed resources and reducing the amount of pollution discharged by chickens to a certain extent, thereby alleviating the pressure of poultry competing with humans for food resources and environmental issues in the poultry industry. (2) The development of effective molecular markers for the selection of traits related to feed efficiency can greatly shorten the breeding cycle, reduce breeding costs, improve the accuracy of selection, accelerate genetic progress, and avoid the phenomenon of introduction-degeneration-reintroduction.

[0004] At present, the number of SNP molecular markers related to feed conversion rate in chickens is still relatively small. Discovering and utilizing new genes related to feed conversion rate is of great significance to the genetic breeding of chickens. Summary of the invention

[0005] In order to solve the above technical problems, the purpose of the present invention is to provide a ST3GAL4 gene SNP molecular marker related to the feed conversion rate of yellow-feathered broiler chickens and its application, so as to solve the problem that the number of existing SNP molecular markers related to the feed conversion rate of chickens is relatively small, and there is a lack of research on the breeding of yellow-feathered hens with low feed conversion rate using SNP molecular markers.

[0006] The technical solution of the present invention to solve the above technical problems is as follows:

[0007] A ST3GAL4 gene SNP molecular marker associated with the feed conversion rate of yellow-feathered broilers, the RS number of the SNP molecular marker is rs1059726276, the polymorphism is G / A, and it is located at the 471871th base of chromosome 24 of the chicken.

[0008] Furthermore, the mutation site and upstream and downstream sequences of the above SNP molecular marker are shown in SEQ ID NO.1, wherein n is a G>A mutation site, and when n is G, it is a yellow-feathered broiler with low feed conversion rate;

[0009] SEQ ID NO.1: 5'-CTGGGACGCGAGGATGCTCACCCCGAAGGAGA ACATCGGTGGGACTTTGCTCACTCGGCGGTGGTGTTTGGAGAGGTCTCATTGTTCTTAGCGGAGAACAAAGGGATTCTTCCCCCGGGGGGTTCGCTCCCGTATGGGCGCAGTGCTCGGTGGCCGCGGTCCGTGGGCAGGGAGATGAGGTGCTGAGCGCCGGGTGTTTGnGGAACCGTGCTGGATTT GTGCTGGATTTCAGTGCCGCGGGACCTGGGGAGGTCCCCGTCCTGCTCGGCTGTTGGCAGCTCCAACGCTTTAAGGGCACGTCCGAGCTGCAGTGAGCTCCTGACGTTGCTACCAGCCATAGCATGGGAGCTGCTGGACTCTTCCTACCGCCTGTGCTTAATTATCTGCATCATTAAGGGCTG-3'.

[0010] A primer combination for amplifying the above-mentioned SNP molecular marker, wherein the sequence of the upstream primer is shown in SEQ ID NO.2, and the sequence of the downstream primer is shown in SEQ ID NO.3;

[0011] SEQ ID NO.2: 5'-AACATCGGTGGGACTTTGCTC-3';

[0012] SEQ ID NO. 3: 5'-AATTAAGCACAGGCGGTAGGA-3'.

[0013] A kit for detecting the above-mentioned SNP molecular marker comprises the above-mentioned upstream primer and downstream primer.

[0014] The use of the above-mentioned SNP molecular marker or primer combination or kit in screening yellow-feathered broilers with excellent traits of low feed conversion rate.

[0015] A method for screening yellow-feathered broilers with excellent traits of low feed conversion rate, using PCR technology to amplify and sequence SNP molecular markers of individuals to be tested, and screening to obtain homozygous individuals with GG genotype at the SNP molecular marker position.

[0016] Furthermore, the SNP molecular markers are amplified and sequenced using the above primer combination or kit.

[0017] Furthermore, the PCR amplification system was: 2×Taq Master Mix 10 μL, forward and reverse primers 1 μL each, DNA template 1 μL, and ddH2O to 20 μL.

[0018] Furthermore, the PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 15 s, annealing at 56°C for 10 s, extension at 72°C for 15 s, 35 cycles; and extension at 72°C for 5 min.

[0019] The present invention has the following beneficial effects:

[0020] (1) The molecular markers provided by the present invention have been verified to be significantly correlated with the feed conversion rate trait of yellow-feathered broiler breeder hens, and can be applied to the breeding of yellow-feathered broiler breeder hens. During the breeding process, yellow-feathered broiler breeder hens with low feed conversion rates are selected, which can effectively reduce feed consumption in the production process and improve the economic benefits and competitiveness of the enterprise.

[0021] (2) The present invention provides a primer and a kit for identifying the above-mentioned SNP molecular genetic markers, which can be used to efficiently screen yellow-feathered broiler breeder hens whose individuals or parents have excellent feed conversion rate traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Manhattan plot of the SNP molecular markers in Example 1;

[0023] Figure 2 This is the SNP molecular marker genotype sequencing diagram in Example 2. DETAILED DESCRIPTION

[0024] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. If specific conditions are not specified in the embodiments, they are carried out according to normal conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0025] Example 1: Screening of SNP molecular markers

[0026] 1892 healthy yellow-feathered broiler breeder hens were selected and mixed and fed until 56 days old, then transferred to individual cages for feeding. The experiment ended at 98 days old. The daily feed intake, initial test weight and final weight of each chicken were recorded, and the feed conversion rate was calculated using the following formula:

[0027]

[0028] Where, FCR is feed conversion rate; W f is the feed consumption, in g; W a It is the live body weight gain, in g.

[0029] The lower the FCR value, the lower the feed conversion rate, which means that the same production capacity consumes less feed during the production process, that is, feed is saved. 1872 chickens were selected for blood extraction and DNA quality testing. The DNA concentration was tested using QubitFluorometer, and the DNA fragment size and degradation degree were tested using agarose gel electrophoresis. The test results showed that 99 samples were unqualified, and the qualified 1773 yellow-feathered chicken breeder hen DNA samples were used for library construction and sequencing. Simplified genome sequencing was performed using high-throughput sequencing technology. The sequencing data was quality controlled and filtered to remove low-quality sequencing reads and possible false-positive SNPs. Feed conversion rate was used as a phenotype and was associated with SNP data for analysis. The EMMAX program (http: / / genetics.cs.ucla.edu / emmax / index.html) was used for GWAS analysis, and the analysis model is as follows:

[0030] y=Xb+Za+Wp+e;

[0031] In the model, y represents the true value of the trait record, X represents the fixed effect association matrix, b represents the fixed effect vector, the fixed effect includes batch effect and three principal component effects, Z represents the additive genetic effect association matrix, u represents the individual additive genetic effect vector, e represents the residual, u~N(0, Gσ 2 α ), e~N(0,Iσ 2 ε α), G represents the genome kinship matrix, I represents the identity matrix, σ2 α , σ 2 ε α represents the additive genetic effect variance and residual variance, and m represents the SNP marker effect.

[0032] According to the results of association analysis, a SNP molecular marker associated with the feed conversion rate trait of yellow-feathered hens was found. The molecular marker is located on chromosome 24 of the chicken. Figure 1 Manhattan map.

[0033] The 200bp sequence upstream and downstream of the mutation site of the SNP molecular genetic marker is as follows:

[0034] 5'-CTGGGACGCGAGGATGCTCACCCCGAAGGAGAACATCGGTGG GACTTTGCTCACTCGGCGGTGGTGTTTGGAGAGGTCTCATTGTTCTTAGCGGAGAACAAAGGGATTCTTCCCCCGGGGGGTTCGCTCCCGTATGGGCGCAGTGCTCGGTGGCCGCGGTCCGTGGGCAGGGAGATGAGGTGCTGAGCGCCGGGTGTTTGnGGAACCGTGCTGGATTTGTGCTGG ATTTCAGTGCCGCGGGACCTGGGGAGGTCCCCGTCCTGCTCGGCTGTTGGCAGCTCCAACGCTTTAAGGGCACGTCCGAGCTGCAGTGAGCTCCTGACGTTGCTACCAGCCATAGCATGGGAGCTGCTGGACTCTTCCTACCGCCTGTGCTTAATTATCTGCATCATTAAGGGCTG-3'(SEQ ID NO.1);

[0035] n is a mutation site. n at the 101st nucleotide of the above sequence is A or G, ie n(G / A), resulting in the above sequence polymorphism. 5'- and -3' are the 5' end and 3' end of the nucleotide sequence, respectively.

[0036] Example 2: Validation of SNP Molecular Markers

[0037] The SNP molecular markers obtained in Example 1 were verified in another group of yellow-feathered broiler breeder hens, with a total of 1773 healthy individuals. All experimental chickens were mixed and fed until 56 days of age, and then transferred to individual cages for feeding. The experiment ended at 98 days of age. The daily food intake, initial test weight and final weight of each chicken were recorded to calculate the feed conversion rate. 150 individuals with low feed conversion rate (FCR less than 3.0) and high feed conversion rate (FCR greater than 3.0) were selected, and blood was taken for DNA extraction. The average FCR of the 150 individuals with low feed conversion rate was 2.8±0.18, and the average FCR of the individuals with high feed conversion rate was 3.2±0.19.

[0038] Taking the extracted DNA as a template, the forward primer sequence added to the primer is as shown in SEQ ID NO.2, specifically: 5'-AACATCGGTGGGACTTTGCTC-3'; the reverse primer sequence is as shown in SEQ ID NO.3, specifically: 5'-AATTAAGCACAGGCGGTAGGA-3'.

[0039] PCR reaction was performed, and the PCR amplification system was: 2×Taq Master Mix 10μL, forward and reverse primers 1μL each, DNA template 1μL, ddH2O supplemented to 20μL. PCR reaction conditions were: 94℃ pre-denaturation for 2min; 94℃ denaturation for 15s, 56℃ annealing for 10s, 72℃ extension for 15s, 35 cycles; 72℃ extension for 5min. PCR products were sequenced using the Sanger sequencing method.

[0040] Analyze the sequencing results and record the genotype corresponding to each individual according to the sequencing peak graph of each sample, such as Figure 2 As shown, there is only one peak at the corresponding site in the sequencing peak graph of the genotype GG, indicating that the alleles are the same, both are G; there are two peaks at the corresponding site in the sequencing peak graph of the genotype GA, indicating that the alleles are different, one is G and the other is A.

[0041] The genotype and allele of SNP molecular markers and residual feed intake were analyzed by one-way analysis of variance using SPSS26.0, and the results are shown in Tables 1 and 2. In this SNP molecular marker, there were extremely significant differences in genotype frequency and allele frequency between the low feed conversion rate group and the high feed conversion rate group (P < 0.01). In the low feed conversion rate group, the frequency of allele G was higher than that of allele A, and the frequency of genotype GG was higher than that of genotype GA, indicating that the GG genotype individual at position 201 had a better residual feed intake phenotype than the GA genotype individual. It further shows that the polymorphism of the screened molecular markers is significantly correlated with the feed conversion rate trait, and it is a SNP site associated with the feed conversion rate trait, which can be used for the breeding of yellow-feathered broiler breeder hens with low feed conversion rate traits. Table 1 Statistical table of the distribution differences of SNP molecular marker genotypes between low feed conversion rate and high feed conversion rate

[0042] chromosome Location genotype High FCR (%) Low FCR(%) Chi-square value (P) Chr24 471871bp GG 62(41.3％) 93(62％) 14.321 GA 88(58.7％) 57(38％) <![CDATA[3.1×10 -6 ]]>

[0043] Table 2 Statistical table of the distribution difference of SNP molecular marker alleles between low feed conversion rate and high feed conversion rate

[0044] chromosome Location genotype High FCR (%) Low FCR(%) Chi-square value (P) Chr24 471871bp G 212(70.7％) 243(81％) 10.231 A 88(29.4％) 57(19％) <![CDATA[2.1×10 -6 ]]>

[0045] Example 3: Method for assisted molecular breeding of feed conversion rate traits using SNP molecular marker alleles

[0046] This embodiment provides a method for performing low feed conversion rate trait assisted molecular breeding using the above-mentioned SNP molecular marker kit, comprising the following steps:

[0047] (1) Blood was collected from the wing vein of the individual to be tested, anticoagulated with EDTA, and stored at -20°C for DNA extraction.

[0048] (2) Amplification was performed using the kit with the DNA extracted in step (1) as a template. The PCR amplification system was: 10 μL of 2×Taq Master Mix, 1 μL of each forward and reverse primer, 1 μL of DNA template, and ddH2O to 20 μL. The PCR reaction conditions were: 94°C pre-denaturation for 2 min; 94°C denaturation for 15 s, 56°C annealing for 10 s, 72°C extension for 15 s, 35 cycles; 72°C extension for 5 min.

[0049] (3) Sequence the PCR product obtained in step (2) using the Sanger sequencing method.

[0050] (4) Based on the genotyping results, homozygous individuals with the SNP marker rs1059726276 GG genotype were selected for breeding to reduce feed conversion rate and effectively reduce feed consumption and breeding costs; selecting individuals with this marker to join the core breeding population can achieve rapid homozygosity of the alleles related to this trait, which can provide technical support for accelerating the progress of genetic selection.

[0051] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A ST3GAL4 gene SNP molecular marker associated with feed conversion rate of yellow-feathered broiler chickens, characterized in that: The RS number of the SNP molecular marker is rs1059726276, the polymorphism is G / A, and it is located at the 471871th base of the 24th chromosome of the chicken.

2. The ST3GAL4 gene SNP molecular marker associated with feed conversion rate of yellow-feathered broiler chickens according to claim 1, characterized in that: The mutation site and upstream and downstream sequences of the SNP molecular marker are shown in SEQ ID NO.1, wherein n is a G>A mutation site, and when n is G, it is a yellow-feathered broiler with low feed conversion rate.

3. A primer combination for amplifying the SNP molecular marker according to claim 1 or 2, characterized in that: The sequence of the upstream primer is shown in SEQ ID NO.2, and the sequence of the downstream primer is shown in SEQ ID NO.

3.

4. A kit for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: It comprises the upstream primer and the downstream primer as described in claim 3.

5. Use of the SNP molecular marker according to claim 1 or 2, the primer combination according to claim 3, or the kit according to claim 4 in screening yellow-feathered broilers with excellent traits of low feed conversion rate.

6. A method for screening yellow-feathered broilers with excellent traits of low feed conversion rate, characterized in that: The PCR technology is used to amplify and sequence the SNP molecular markers of the individual to be tested, and the homozygous individuals with the GG genotype at the SNP molecular marker position are screened.

7. The method for screening yellow-feathered broilers with excellent traits of low feed conversion rate according to claim 6, characterized in that: The SNP molecular marker is amplified and sequenced using the primer combination described in claim 3 or the kit described in claim 4.

8. The method for screening yellow-feathered broilers with excellent traits of low feed conversion rate according to claim 6, characterized in that: The PCR amplification system was as follows: 2×Taq Master Mix 10 μL, forward and reverse primers 1 μL each, DNA template 1 μL, and ddH2O to 20 μL.

9. The method for screening yellow-feathered broilers with excellent traits of low feed conversion rate according to claim 6, characterized in that: The PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 15 s, annealing at 56°C for 10 s, extension at 72°C for 15 s, 35 cycles; and extension at 72°C for 5 min.

Images