InDel molecular marker of rice grain shape gene GL7 promoter and application

Abstract

The invention belongs to the technical field of molecular marker detection, and particularly relates to an InDel molecular marker of a rice grain shape gene GL7 promoter and application. The nucleotide sequence of the InDel molecular marker is as shown in SEQ ID No.1, and the type of a promoter corresponding to a rice grain shape gene GL7 is GL7pro1; the nucleotide sequence of the InDel molecular marker corresponding to the allelic GL7PRO1 of the InDel molecular marker is as shown in SEQ ID NO. 2. The invention provides an InDel molecular marker of a rice grain shape gene GL7 promoter, the molecular marker is closely linked with the characters of long grains and slender grains of rice grains, and whether a material to be detected contains allelic variation GL7pro1 of a GL7 gene promoter region or not can be judged by detecting the size of an amplified band of the molecular marker. The grain shape of the rice germplasm material is predicted at the gene level or the grain shape of the rice is improved through molecular marker-assisted breeding.

Description

Technical Field

[0001] The present invention relates to the field of molecular marker detection technology, specifically to a rice grain shape gene GL7 InDel molecular markers of promoters and their applications. Background Art

[0002] Rice is one of the most important food crops in my country and is crucial to stabilizing national food security. Grain shape is not only the main indicator of rice quality, but also an important trait affecting rice yield. Rice grain shape breeding has always been an important area for improving rice yield and quality. Long-grain indica rice has always been favored by the vast majority of consumers. In recent years, the market demand for long-grain japonica rice has prompted the selection of long-grain japonica rice germplasm to become a new breeding trend. Therefore, how to improve rice grain length and slender grain shape has become a common goal of breeders and rice production companies. Discovering alleles related to grain shape genes for improving rice grain length and slender grain shape is of great significance for rapid, efficient and accurate molecular breeding of high-yield and high-quality rice.

[0003] The slender grain shape of rice involves grain length, grain width, length-width ratio and grain weight, and is regulated by multiple quantitative trait loci (QTL) or genes. So far, a large number of QTLs or genes related to grain shape have been reported, but most of them have only been located in specific rice germplasm materials. Not many cloned grain shape genes have been found, and even fewer allelic variations related to these cloned grain shape genes have been discovered in different rice germplasm materials. Using homozygous rice varieties with different grain shapes, sequencing and analysis of the gene region and promoter region of the cloned grain shape genes were carried out to explore new allelic variations of these grain shape genes, which can improve their distribution and function in different rice germplasm materials, help to better explain the genetic regulation mechanism of rice grain shape, and thus provide more refined targets and theoretical basis for the breeding of high-yield and high-quality rice varieties with long and slender grains. Summary of the invention

[0004] Based on this, the present invention provides a rice grain shape gene GL7 The InDel molecular marker of the promoter and its application at least solve one problem in the prior art.

[0005] In order to solve the above technical problems, this application is implemented as follows: In the first aspect, a rice grain shape gene GL7 InDel molecular markers of promoters GL7 _pro1-InDel, the nucleotide sequence of the InDel molecular marker is shown in SEQ ID No.1, corresponding to the rice grain shape gene GL7 The promoter type is GL7 _pro1; the InDel molecular marker in its alleleGL7 The nucleotide sequence corresponding to _PRO1 is shown in SEQ ID NO.2.

[0006] The InDel molecular marker of the present invention ( GL7 _pro1-InDel), representing the rice grain shape gene GL7 A novel allelic variation in the promoter region GL7 _pro1, the novel allele GL7 _pro1 is closely linked to long-grain and slender-grain rice and can be used to identify whether the new allele is present. GL7 _pro1 rice germplasm materials, thereby achieving rapid, efficient and accurate breeding of rice germplasm materials with target traits of long-grain and slender-grain phenotypes.

[0007] Among the above GL7 The nucleotide sequence of the InDel molecular marker of the _pro1 promoter type is shown in SEQ ID NO.1: GCTGGACATGGACCATCGACACGCCTTGACCCACACCCCACCAATCCCCCATCCCTCCCGCTTATTTCAACCC, and its allele GL7 The nucleotide sequence of _PRO1 is shown in SEQ ID NO.2: GCTGGACATGGACCATCGACACGCCTTGACCCACACACCCCCCACCCCACCAATCCCCCATCCCTCCCGCTTATTTCAACCC, and the 34th base in SEQ ID NO.1 is C, that is, GL7 The nucleotide sequence of the InDel molecular marker of the _pro1 type promoter contains a CACACCCCC sequence deletion.

[0008] In a second aspect, the present invention provides a primer pair for detecting the above-mentioned InDel molecular marker, the primer pair comprising GL7 _pro1-InDel-F and GL7 _pro1-InDel-R; GL7 _pro1-InDel-F and GL7 The nucleotide sequence of _pro1-InDel-R is shown in SEQ ID NO.3 and SEQ ID NO.4.

[0009] SEQ ID NO.3: GCTGGACATGGACCATCGA; SEQ ID NO. 4: GGGTTGAAATAAGCGGGAGG.

[0010] In a third aspect, the present invention provides a kit for detecting rice grain shape, the kit comprising the above-mentioned primer pair.

[0011] In some optional embodiments, the kit further comprises Taq DNA polymerase, 20 mM MgCl 2 10× Taq buffer, dNTPs and water.

[0012] In a fourth aspect, the present invention provides a method for detecting rice grain shape, comprising the following steps: Using the genomic DNA of the rice germplasm material to be tested as a template, using the above primer pair or the above kit to perform PCR amplification, and performing electrophoresis analysis on the obtained amplification product; When the length of the amplified product is 82 bp, the grain shape gene in the rice germplasm material to be tested GL7 The promoter type is GL7 _PRO1, the grain shape is short; When the length of the amplified product is 73 bp, the grain shape gene in the rice germplasm material to be tested GL7 The promoter type is GL7 _pro1, the grain shape is long grains and elongated grains; When the amplified product is a heterozygous type with 82 bp and 73 bp coexisting, the rice grain shape gene to be tested GL7 The promoter type is GL7 _PRO1 / GL7 _pro1, the grain shape is between long grains and short grains.

[0013] In some optional embodiments, the reaction system for the PCR amplification is: 5 μL containing 20 mM MgCl 2 10× Taq buffer, 2 μL 10 mM dNTPs, 0.5 μL 10 μM forward primer GL7 _pro1-InDel-F, 0.5 μL 10 μM reverse primer GL7 _pro1-InDel-R, 0.25 μL 5 U / μL Taq DNA polymerase, 1 μL 10 pg – 1 μg DNA, and add water to a total volume of 50 μL.

[0014] In some optional embodiments, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 15 s, 35 cycles, and extension at 72°C for 10 min.

[0015] In some optional embodiments, the electrophoresis analysis is performed by agarose gel electrophoresis analysis.

[0016] In a fifth aspect, the present invention provides the rice grain shape gene GL7 Application of the InDel molecular marker of the promoter or the primer pair or the kit in detecting the grain shape of rice germplasm materials.

[0017] In a sixth aspect, the present invention provides the rice grain shape gene GL7 Application of the InDel molecular marker of the promoter, the primer pair, the kit or the method in molecular marker-assisted breeding to improve rice grain shape.

[0018] Due to the adoption of the above technical solution, the embodiments of the present invention have at least the following beneficial effects: (1) The present invention provides a rice grain shape gene GL7 The InDel molecular marker of the promoter can be used to determine whether the material to be tested contains the promoter by detecting the size of the amplified band of the molecular marker. GL7 Allelic variation in gene promoter region GL7 _pro1, which can predict the grain shape of rice germplasm materials at the genetic level or improve rice grain shape through molecular marker-assisted breeding, can be used to identify or screen rice germplasm materials with long-grain and slender-grain phenotypes.

[0019] (2) The molecular markers of the present invention can be used to identify and differentiate rice germplasm materials at the seedling stage. GL7 The gene promoter nucleotide sequence type can quickly, efficiently and accurately identify and screen target gene-related sequences in rice germplasm resources and their breeding offspring, greatly reducing the time and labor costs required for breeding work and is not affected by human and environmental factors. It helps to better explain the genetic regulation mechanism of rice grain shape and provide more refined targets and theoretical basis for the breeding of high-yield and high-quality rice varieties with long grains and slender grains. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0021] Figure 1 The rice germplasm materials with different grain shapes provided in some embodiments of the present application are GL7The size of the amplified product of the InDel molecular marker of the gene promoter; M is a marker, indicating the 50 bp and 100 bp positions; the serial numbers 1 to 15 respectively represent: 1, Chenghui 377; 2, Nipponbare; 3, Wushan Simiao; 4, Huangguangyouzhan; 5, Yuejinnongzhan; 6, Efeng Simiao; 7, Fudao 88; 8, Guiyu 11; 9, Yuexiangzhan; 10, Longjing 25; 11, Heijing 8; 12, Kendao 11; 13, Longdun 103; 14, Sanjiang 2; 15, Jijing 88.

[0022] Figure 2 Some embodiments of the present application provide GL7 Identification of 24 rice germplasm materials with gene promoter InDel molecular markers GL7 _pro1 allelic variation; M is a marker, indicating the 50 bp and 100 bp positions. Sequence numbers 1 to 24 represent: 1, Huangguangtaizhan; 2, Jinggangruannian; 3, QiguiB; 4, LiB; 5, Aizizhan; 6, Yuenongsimiao; 7, Nongxiang39; 8, Meitezhan; 9, Longjing40; 10, Suijing18; 11, IR64; 12, Huahang38; 13, Huangxianzhan; 14, Yuehesimiao; 15, Yuebiao5; 16, Yulong7; 17, Suijing4; 18, Xiangyaxiangzhan; 19, R9822; 20, Nanguizhan; 21, Kendao20; 22, Longjing57; 23, Longdao24; 24, Kendao14. DETAILED DESCRIPTION

[0023] The following will be combined with the drawings in the embodiments of the present application to clearly and completely describe the technical solutions in the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of this application.

[0024] Example 1 Rice grain shape gene GL7 InDel molecular markers of promoters GL7 Development and validation of _pro1-InDel (1) Rice grain shape gene GL7 Discovery and molecular markers of sequence variation sites in promoter regions GL7 Design of _pro1-InDel GL7It is a major gene that controls grain length and slender grain shape cloned on chromosome 7 of rice. The gene number is LOC_Os07g41200. Its up-regulated expression will lead to slender grains (Wang et al., The OsSPL16-GW7 regulatory module determines grain shape and simultaneously improves riceyield and grain quality, Nature genetics, 2015, 47(8):949-954. doi: 10.1038 / ng.3352.). Based on this, it is speculated that the OsSPL16-GW7 gene in natural rice germplasm materials GL7 The gene promoter region may contain sequences that regulate the transcriptional expression level of the gene to regulate rice grain length and slender grain shape. GL7 The promoter region of the gene was sequenced and compared with the corresponding genome sequence of Nipponbare, which had completed genome sequencing, and it was found that GL7 The promoter region of the gene has a CACACCCCC sequence deletion. Based on the sequence variation site, the Primer Premier 5 software was used to design the particle shape gene of the present invention. GL7 InDel molecular markers of promoters GL7 _pro1-InDel, the primer sequences are shown in Table 1, and the product sizes are 73 bp and 82 bp in Chenghui 377 and Nipponbare, respectively.

[0025] Table 1 Grain shape genes GL7 InDel molecular markers of promoters GL7 Primer sequence of _pro1-InDel (2) Validation of molecular markers using 15 rice germplasms with different grain shapes GL7 Relationship between _pro1-InDel and long-grain and elongated-grain phenotypes The grain shape of 15 rice germplasm materials with different grain shapes, including Chenghui 377, Nihonbare, Wushan Simiao, Huangguangyouzhan, Yuejinnongzhan, Efeng Simiao, Fudao 88, Guiyu 11, Yuexiangzhan, Longjing 25, Heijing 8, Kendao 11, Longdun 103, Sanjiang 2, and Jijing 88, was analyzed for the grain length, grain width, length-to-width ratio, and 1000-grain weight of mature grains. It was found that the grain shapes of these materials were significantly different from those of the other materials. There were obvious phenotypic differences in grain length and length-width ratio among the varieties. Chenghui 377, Wushan Simiao, Huangguang Youzhan, Yuejin Nongzhan, Efeng Simiao, Fudao 88 and Guiyu 11 had longer grains and larger length-width ratios, showing long and slender grain shape, while Nipponbare, Yuexiangzhan, Longjing 25, Heijing 8, Kendao 11, Longdun 103, Sanjiang 2 and Jijing 88 had shorter grains and smaller length-width ratios (Table 2).

[0026] The leaves of these 15 rice germplasm materials were taken and the leaf DNA was extracted by CTAB method. The extracted DNA was used as template and InDel molecular marker was used to identify the DNA residues in the leaves. GL7 _pro1-InDel forward and reverse primers were used for PCR amplification.

[0027] The PCR reaction system was: 5 μL containing 20 mM MgCl 2 10× Taq buffer, 2 μL dNTPs (10 mM), 0.5 μL 10 μM forward primer GL7 _pro1-InDel-F, 0.5 μL 10 μM reverse primer GL7 _pro1-InDel-R, 0.25 μL 5 U / μL Taq DNA polymerase, 1 μL DNA (10 pg – 1 μg), and double distilled water to a total volume of 50 μL.

[0028] The PCR reaction program was as follows: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 15 s, 35 cycles, and extension at 72°C for 10 min.

[0029] Molecular markers were used to identify the 15 rice germplasm materials. GL7 The PCR product obtained by _pro1-InDel amplification was detected by 5% (g / 100 ml, m / v) agarose gel electrophoresis.

[0030] The electrophoresis results are as follows Figure 1As shown in the figure, the PCR banding pattern of long-grain and slender-grain varieties such as Chenghui 377, Wushan Si Miao, Huangguang You Zhan, Yuejin Nong Zhan, Efeng Si Miao, Fudao 88, and Guiyu 11 is about 73 bp, and the PCR banding pattern of short-grain varieties such as Nipponbare, Yuexiangzhan, Longjing 25, Heijing 8, Kendao 11, Longdun 103, Sanjiang 2, and Jijing 88 is about 82 bp. There is a 9 bp size difference in the PCR banding pattern between long-grain and slender-grain germplasm materials and short-grain germplasm materials.

[0031] The molecular marker amplification product electrophoresis band was 73 bp and there was a CACACCCCC sequence deletion in the sequence. GL7 Gene promoter alleles are named GL7 _pro1, the electrophoresis band of the molecular marker amplification product is 82 bp, and the sequence contains the CACACCCCC sequence insertion GL7 Gene promoter alleles are named GL7 _PRO1. GL7 The gene promoter allele is GL7 The rice germplasm materials with _pro1, such as Chenghui 377, Wushan Si Miao, Huangguang Youzhan, Yuejin Nongzhan, Efeng Si Miao, Fudao 88, and Guiyu 11, have long and slender grains; GL7 The gene promoter allele is GL7 _PRO1 rice germplasm materials, such as Nipponbare, Yuexiangzhan, Longjing 25, Heijing 8, Kendao 11, Longdun 103, Sanjiang 2, and Jijing 88, have short grains (Table 2). GL7 Gene promoter allele GL7 The _pro1 mutation causes rice grains to appear long and slender.

[0032] Table 2 Grain shape analysis and GL7 Promoter allele identification results Example 2 Rice grain shape gene GL7 InDel molecular markers of promoters GL7 _pro1-InDel identifies whether rice germplasm materials contain GL7 _pro1 allelic variation Take Huangguangtaizhan, Jinggangruannian, Qigui B, Li B, Aizizhan, Yuenongsi Miao, Nongxiang 39, Meitezhan, Longjing 40, Suijing 18, IR64, Huahang 38, Huangxianzhan, Yuehesi Miao, Yuebiao 5, Yulong 7, Suijing 4, Xiangyaxiangzhan, R9822, Nanguizhan, Kendao 20, Longjing 57, Longdao 24, Kendao 14 as examples to identify whether they contain GL7_pro1 allele variation, the specific steps are as follows: (1) DNA extraction from materials: Leaves of 24 rice germplasm materials were collected at the seedling stage, and leaf DNA was extracted using the CTAB method; (2) Amplify molecular markers using a standard PCR amplification system GL7 _pro1-InDel related fragments: using molecular marker primers GL7 _pro1-InDel-F and GL7 _pro1-InDel-R, using the rice DNA to be detected as a template, PCR amplification is performed, and the PCR reaction system and procedure are consistent with those in step (2) of Example 1; (3) Electrophoresis analysis of amplified products: The PCR products were detected by 5% (g / 100 ml, m / v) agarose gel electrophoresis. If the molecular marker could amplify a 73 bp band, it indicated that the detected rice germplasm material was present. GL7 The CACACCCCC sequence in the gene promoter region is missing, and the promoter allele is GL7 _pro1; if the molecular marker can expand the 82 bp band type, it means that the tested rice germplasm material exists GL7 The CACACCCCC sequence is inserted into the gene promoter region, and the promoter allele is GL7 _PRO1; if the molecular marker amplifies the 73 bp / 82 bp heterozygous band type, it means that the material GL7 The gene promoter allele is GL7 _pro1 / GL7 _PRO1; According to the electrophoresis results ( Figure 2 ), the PCR banding pattern of rice germplasm materials such as Huangguangtaizhan, Jinggangruannian, Yuenongsimiao, Nongxiang 39, Meitezhan, IR64, Huahang 38, Huangxianzhan, Yuehesimiao, Yuebiao 5, Xiangyaxiangzhan, R9822, and Nanguizhan is 73 bp, GL7 There is a CACACCCCC sequence deletion in the gene promoter region, and the promoter allele is GL7 _pro1; while the PCR banding pattern of rice germplasm materials such as Qigui B, Li B, Aizaizhan, Longjing 40, Suijing 18, Yulong 7, Suijing 4, Kendao 20, Longjing 57, Longdao 24, and Kendao 14 was 82 bp, GL7 There is a CACACCCCC sequence inserted in the gene promoter region, and the promoter allele is GL7 _PRO1.

[0033] (4) Grain shape verification analysis of 24 rice germplasm materials: At maturity, the grain length, grain width, length-to-width ratio, 1000-grain weight and other traits of mature grains of these 24 rice germplasm materials with different grain shapes were analyzed for grain shape. The results are shown in Table 3.GL7 The gene promoter allele is GL7 The rice germplasm materials of _pro1, Huangguangtaizhan, Jinggangruannian, Yuenongsimiao, Nongxiang 39, Meitezhan, IR64, Huahang 38, Huangxianzhan, Yuehesimiao, Yuebiao 5, Xiangyaxiangzhan, R9822, Nanguizhan, have longer grains and larger length-width ratios, showing long and slender grain shapes; GL7 The gene promoter allele is GL7 The rice germplasm materials of _PRO1, Qigui B, Li B, Aizaizhan, Longjing 40, Suijing 18, Yulong 7, Suijing 4, Kendao 20, Longjing 57, Longdao 24, Kendao 14, have shorter grain length and smaller length-width ratio. The rice grain shape gene of the present invention GL7 InDel molecular markers of promoters GL7 _pro1-InDel can be used to identify whether rice germplasm contains grain shape genes GL7 Promoter GL7 _pro1 allele variation, thereby predicting the grain shape of rice germplasm materials at the genetic level.

[0034] Table 3 contains GL7 _pro1 or GL7 _Pro1 allele differences in grain shape of 24 rice germplasms From the above results, it can be seen that the rice grain shape gene of the present invention GL7 InDel molecular markers of promoters GL7 _pro1-InDel and its detection primers, kits and methods are mainly used to identify rice grain shape genes GL7 Whether there is a CACACCCCC sequence deletion in the promoter region. Through PCR detection and electrophoresis identification, it can be determined as early as possible and accurately whether there is a new allele variation in the rice germplasm material to be tested that causes the grain to be long or slender. GL7 _pro1, thereby achieving rapid, efficient and accurate breeding selection and accelerating the breeding process.

[0035] The embodiments of the present application are described above in conjunction with the accompanying drawings. Specific examples are used herein to illustrate the principles and implementation methods of the present application. The description of the above embodiments is only used to help understand the core idea of ​​the present application, but the present application is not limited to the above-mentioned specific implementation methods. The above-mentioned specific implementation methods are merely illustrative and not restrictive. Under the inspiration of the present application, ordinary technicians in this field can also make many forms without departing from the scope of protection of the purpose of the present application and the claims, all of which are within the protection of the present application.

Claims

1. A rice grain shape gene GL7 The InDel molecular marker of the promoter is characterized in that The nucleotide sequence of the InDel molecular marker is shown in SEQ ID No. 1, corresponding to the rice grain shape gene GL7 The promoter type is GL7 _pro1; the InDel molecular marker in its allele GL7 The nucleotide sequence corresponding to _PRO1 is shown in SEQ ID NO.

2.

2. A primer pair for detecting the InDel molecular marker according to claim 1, characterized in that: The primer pair comprises GL7 _pro1-InDel-F and GL7 _pro1-InDel-R; GL7 _pro1-InDel-F and GL7 The nucleotide sequence of _pro1-InDel-R is shown in SEQ ID NO.3 and SEQ ID NO.

4.

3. A kit for detecting rice grain shape, characterized in that: The kit comprises the primer pair according to claim 2.

4. The kit according to claim 3, characterized in that The kit also includes Taq DNA polymerase, 10×Taq buffer containing 20 mM MgCl 2 , dNTPs and water.

5. A method for detecting rice grain shape, characterized in that: The following steps are involved: Using the genomic DNA of the rice germplasm material to be tested as a template, PCR amplification is performed using the primer pair described in claim 2 or the kit described in claim 3, and the obtained amplification product is analyzed by electrophoresis; When the length of the amplified product is 82 bp, the grain shape gene in the rice germplasm material to be tested GL7 The promoter type is GL7 _PRO1, the grain shape is short; When the length of the amplified product is 73 bp, the grain shape gene in the rice germplasm material to be tested GL7 The promoter type is GL7 _pro1, the grain shape is long grains and elongated grains; When the amplified product is a heterozygous type with 82 bp and 73 bp coexisting, the rice grain shape gene to be tested GL7 The promoter type is GL7 _PRO1 / GL7 _pro1, the grain shape is between long grains and short grains.

6. The method according to claim 5, characterized in that The PCR amplification reaction system is: 5 μL of 10×Taq buffer containing 20 mM MgCl2, 2 μL of 10 mM dNTPs, 0.5 μL of 10 μM forward primer GL7 _pro1-InDel-F, 0.5 μL 10 μM reverse primer GL7 _pro1-InDel-R, 0.25 μL 5 U / μL Taq DNA polymerase, 1 μL 10pg – 1 μg DNA, and add water to a total volume of 50 μL.

7. The method according to claim 5, characterized in that The reaction procedure of the PCR amplification was as follows: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 15 s, 35 cycles, and extension at 72°C for 10 min.

8. The method according to claim 5, characterized in that The electrophoresis analysis was performed using agarose gel electrophoresis.

9. The rice grain shape gene according to claim 1 GL7 Use of the InDel molecular marker of the promoter, the primer pair described in claim 2, or the kit described in any one of claims 3 to 4 in detecting the grain shape of rice germplasm materials.

10. The rice grain shape gene according to claim 1 GL7 Use of the InDel molecular marker of a promoter, the primer pair described in claim 2, the kit described in any one of claims 3-4, or the method described in any one of claims 5-8 in molecular marker-assisted breeding to improve rice grain shape.

Images