12-oxo-phytodienoic acid reductase and acyl coenzyme A synthetase and application thereof

Abstract

The invention belongs to the technical field of biological engineering, and relates to 12-oxo-plant dienoic acid reductase and acyl coenzyme A synthetase and application thereof. The invention specifically relates to a 12-oxo-plant dienoic acid reductase LiOPR and an acyl coenzyme A synthetase LiOPCL which are derived from filamentous fungi ilantidospora. The LiOPR gene contains 1245 nucleotides, and 414 amino acids are encoded; the LiOPCL gene contains 1593 nucleotides, and 530 amino acids are encoded. 12-OPDA is used as a raw material, the jasmonic acid can be generated through one-pot cascade connection of the recombinant LiOPR and LiOPCL and the saccharomyces cerevisiae, the yield reaches 16.5 mg / L, and a foundation is laid for constructing an excellent jasmonic acid biosynthesis method.

Description

Technical Field

[0001] The invention relates to the discovery of jasmonic acid synthesis-related enzymes including 12-oxo-phytodienoate reductase LiOPR and acyl-CoA synthetase LiOPCL, and application thereof in cascade catalytic synthesis of jasmonic acid, belonging to the technical field of bioengineering. Background Art

[0002] 12-Oxo-phytodienoic acid reductase (OPR) is a key enzyme in the metabolic pathway of octadecenoic acid in plants and an important step in controlling the synthesis of jasmonic acid in plants. As a plant hormone, jasmonic acid plays a special physiological function on organs and tissues of crops during their growth. Jasmonic acid and its derivatives are widely used in the flavor and fragrance and food additive industries because of their light fragrance. At present, the pathway of jasmonic acid synthesis in plants and the functions and effects of each gene have been basically elucidated. Among them, 12-Oxo-phytodienoic acid reductase has three isozymes, OPR1, OPR2, and OPR3. Only OPR3 can reduce 12-Oxo-phytodienoic acid (12-OPDA) to generate the corresponding cyclopentanone. Acyl-CoA synthetase (OPCL) is a class of enzymes responsible for catalyzing the reaction in cells to combine acetic acid or fatty acids with coenzyme A to generate acyl-CoA. In JA biosynthesis in plants, OPCL activates OPC8:0 to CoA ester, thereby initiating subsequent β-oxidation to synthesize JA.

[0003] Some plant pathogenic fungi such as Lachnospermum, Fusarium, Gibberella, etc. also have the ability to produce jasmonic acid, but the related genes for jasmonic acid synthesis in fungi are rarely reported. Compared with plant extraction and chemical synthesis of jasmonic acid, microbial fermentation to produce jasmonic acid has obvious advantages, such as high yield, no pollution, the product is a single configuration, and there is no need to split enantiomers. Chinese patent CN107227264A reported a strain of Iranian bisporus CCTCC NO.M2017288, which can produce 1.5g / L jasmonic acid by shaking flask static fermentation. Chinese patent CN116656517A announced that using Saccharomyces cerevisiae as the chassis cell, by introducing the synthesis pathway of jasmonic acid substances in higher plants, a cell factory for microbial synthesis of jasmonic acid was constructed, but the yield was only 11.1mg / L. Therefore, in view of the fact that the yield of jasmonic acid produced by the existing biosynthesis method needs to be further improved, by exploring the functional genes for the synthesis of jasmonic acid related to fungi, a method for developing excellent biosynthesis of jasmonic acid is expected to be developed. Summary of the invention

[0004] In view of the above-mentioned deficiencies in the prior art, the present invention provides genes of 12-oxo-phytodienoate reductase LiOPR and acyl-CoA synthetase LiOPCL from fungi, and provides a method for synthesizing jasmonic acid in one pot based on recombinant 12-oxo-phytodienoate reductase LiOPR and acyl-CoA synthetase LiOPCL.

[0005] The first technical solution provided by the present invention is a jasmonic acid synthesis-related enzyme, wherein the jasmonic acid synthesis-related enzyme includes 12-oxo-phytodienoate reductase LiOPR and acyl-CoA synthetase LiOPCL, wherein the amino acid sequence of the 12-oxo-phytodienoate reductase LiOPR is shown in SEQ ID NO: 1, and the amino acid sequence of the acyl-CoA synthetase LiOPCL is shown in SEQ ID NO: 2. Both 12-oxo-phytodienoate reductase LiOPR and acyl-CoA synthetase LiOPCL are derived from Lasiodiplodia iranensis DWH-2. The deposit number of Lasiodiplodiairanensis DWH-2 is: CCTCC NO: M2017288, which has been disclosed in the patent with publication number CN107227264A.

[0006] The second technical solution provided by the present invention is a gene encoding the jasmonic acid synthesis-related enzymes described in the first technical solution, wherein the jasmonic acid synthesis-related enzymes include 12-oxo-phytodienoate reductase LiOPR and acyl-CoA synthetase LiOPCL.

[0007] In certain embodiments, the nucleotide sequence of the gene encoding the 12-oxo-phytodienoate reductase is shown as SEQ ID NO.3, and the nucleotide sequence of the gene encoding the acyl-CoA synthetase is shown as SEQ ID NO.4.

[0008] The third technical solution provided by the present invention is a vector carrying the gene described in the second technical solution.

[0009] In some embodiments, pACYCDuet-1 is used as the expression vector

[0010] The fourth technical solution provided by the present invention is a genetically engineered bacterium that expresses the jasmonic acid synthesis-related enzyme described in the first technical solution, or contains the gene described in the second technical solution, or is transformed with the vector described in the third technical solution.

[0011] In certain embodiments, the genetically engineered bacteria uses Escherichia coli as a host cell.

[0012] The fifth technical solution provided by the present invention is the use of jasmonic acid synthesis-related enzymes in the biosynthesis of jasmonic acid, wherein the jasmonic acid synthesis-related enzymes include 12-oxo-phytodienoate reductase LiOPR and acyl-CoA synthetase LiOPCL, the amino acid sequence of the 12-oxo-phytodienoate reductase LiOPR is shown in SEQ ID NO: 1, and the amino acid sequence of the acyl-CoA synthetase LiOPCL is shown in SEQ ID NO: 2.

[0013] In certain embodiments, the preparation method of 12-oxo-phytodienoate reductase LiOPR is as follows: E. coli BL-21 is used as the host strain, pACYCDuet-1 is used as the expression vector, and the overexpressed LiOPR is derived from L. iranensis DWH-2, whose gene sequence is shown in SEQ ID NO.3.

[0014] In certain embodiments, the preparation method of acyl-CoA synthetase LiOPCL is as follows: E. coli BL-21 is used as the host strain, pACYCDuet-1 is used as the expression vector, and the overexpressed LiOPCL is derived from L. iranensis DWH-2, whose gene sequence is shown in SEQ ID NO.4.

[0015] The sixth technical solution provided by the present invention is a method for synthesizing jasmonic acid in one pot, wherein 12-OPDA is used as a substrate, and a catalytic system is composed of jasmonic acid synthesis-related enzymes and yeast to produce jasmonic acid, wherein the jasmonic acid synthesis-related enzymes include 12-oxo-phytodienoate reductase LiOPR and acyl-CoA synthetase LiOPCL, and the amino acid sequence of the 12-oxo-phytodienoate reductase LiOPR is shown in SEQ ID NO: 1, and the amino acid sequence of the acyl-CoA synthetase LiOPCL is shown in SEQ ID NO: 2.

[0016] In certain embodiments, in the catalytic system, the amount of the 12-oxo-phytodienoate reductase LiOPR enzyme solution added is 0.5-5 mL / mL. Optionally, the amount of the 12-oxo-phytodienoate reductase LiOPR enzyme solution added is 0.25 mL / mL.

[0017] Specifically, the preparation method of 12-oxo-phytodienoate reductase LiOPR enzyme solution is as follows: E. coli BL-21 overexpressing LiOPR is dissolved in 50 mM pH 7.4 Na2HPO4 / NaH2PO4 buffer at a volume of 0.1 g / mL and then subjected to ultrasonic disruption.

[0018] In certain embodiments, in the catalytic system, the amount of the acyl-CoA synthetase LiOPCL enzyme solution added is 0.5-5 mL / mL, and optionally, the amount of the acyl-CoA synthetase LiOPCL enzyme solution added is 0.25 mL / mL.

[0019] Specifically, the preparation method of acyl-CoA synthetase LiOPCL enzyme solution is as follows: E. coli BL-21 expressing LiOPCL is dissolved in 50 mM Na2HPO4 / NaH2PO4 buffer solution with a pH of 7.4 at a volume of 0.1 g / mL and then subjected to ultrasonic disruption.

[0020] In certain embodiments, in the catalytic system, the concentration of the 12-OPDA is 0.01-50 mM, optionally, the concentration of the 12-OPDA is 0.5 mM.

[0021] In certain embodiments, the yeast is Saccharomyces cerevisiae.

[0022] In certain embodiments, in the catalytic system, the yeast addition amount is 0.01-20 g / mL, and optionally, the yeast addition amount is 0.2 g / mL.

[0023] In certain embodiments, coenzyme NADH is further added to the catalytic system. Optionally, the concentration of coenzyme NADH is 0.001-10.0 mM, preferably 2.5 mM.

[0024] In certain embodiments, ATP is further added to the catalytic system. Optionally, the concentration of ATP is 0.001-10.0 mM, preferably 1 mM.

[0025] In certain embodiments, CoA is further added to the catalytic system. Optionally, the concentration of CoA is 0.001 to 10.0 mM, preferably 1 mM.

[0026] The seventh technical solution provided by the present invention is the use of the jasmonic acid synthesis-related enzyme described in the first technical solution, or the gene described in the second technical solution, or the vector described in the third technical solution, or the genetically engineered bacteria described in the fourth technical solution, or the method described in the sixth technical solution in the preparation of jasmonic acid or jasmonic acid-containing products.

[0027] The technical effects of the present invention are as follows:

[0028] The invention proposes a pathway for synthesizing jasmonic acid by enzyme / cell cascade catalysis. With 12-OPDA as a raw material, 12-OPDA is firstly reduced to OPC8:0 by LiOPR; then it is activated to coenzyme A by LiOPCL to generate OPC8:0-CoA; finally, yeast is co-incubated, and a beta-oxidation system in the yeast is utilized to shorten the carbon chain of OPC8:0-CoA, and jasmonic acid is finally obtained, with a yield of 16.5 mg / L, thereby providing a new idea for the synthesis of jasmonic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is a diagram of LiOPR phylogenetic analysis.

[0030] Figure 2 This is the LiOPCL phylogenetic analysis diagram.

[0031] Figure 3 Diagram for the one-pot synthesis of jasmonic acid. DETAILED DESCRIPTION

[0032] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0033] The plasmids and cells involved in the following examples are as follows:

[0034] The strain E. coli BL21 (DE3) and plasmid pACYCDuet-1 are commercial strains and plasmids. Primer sequence synthesis, reagent purchase and gene sequencing verification were all purchased and completed at Suzhou Jinweizhi Biotechnology Co., Ltd.

[0035] The culture medium involved in the following examples is as follows:

[0036] LB medium: 10 g / L peptone, 10 g / L sodium chloride, 5 g / L yeast extract, sterilized at 121°C for 15 min.

[0037] YPD medium: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, sterilized at 115°C for 20 min.

[0038] The methods involved in the following embodiments are as follows:

[0039] Jasmonic acid detection method: High performance liquid chromatography was performed using a C18 10×250mm×5μm column, the mobile phase was methanol and 0.1% phosphoric acid in a ratio of 11:9, 1mL·min-1, UV=210nm, the detection temperature was 35°C, and the injection volume was 20μL.

[0040] The primer information involved in the following examples is as follows:

[0041] Table 1 Primer information

[0042] Primer name Primer sequences LiOPR1 CACAGCCAGGATCCGAATATGCCAGCTCCAATTACTGCTCCAG LiOPR2 TTATGCGGCCGCAAGCTTAGCAGAAGCTTCTTCGAAGAATGGG LiOPCL1 ACAGCCAGGATCCGAATTCGATGCCTGTCACCTCGCCCTT LiOPCL2 CATTATGCGGCCGCAAGCTTCACTGGCTCCAAATGCTCGT

[0043] Example 1 Preparation of recombinant 12-oxo-phytodienoate reductase LiOPR and acyl-CoA synthetase LiOPCL

[0044] The 12-oxo-phytodienoate reductase LiOPR provided by the present invention was discovered from the genome of L.iranensis DWH-2. The similarities with the amino acid sequences of NP_001077884.1, NP_001233873.1, NP_001105833.1 and NP_001105910.138-40, which have been confirmed to have OPR3 activity, from Solanum lycopersicum, Zea mays and Arabidopsis thaliana are 40.99%, 42.68%, 42.4% and 41.56% respectively. Figure 1 Phylogenetic analysis showed that LiOPR was on a different branch from plant-derived OPR3 and was a new type of fungal-derived 12-oxo-phytodienoate reductase.

[0045] The acyl-CoA synthetase LiOPCL provided by the present invention is discovered from the genome of L.iranensis DWH-2. It has an amino acid sequence similarity of 30.95% with NP_564115.1 from Arabidopsis thaliana, which has been confirmed to have OPCL activity. Figure 2 Phylogenetic analysis showed that LiOPR was on a different branch from plant-derived OPCL and was a new type of fungal acyl-CoA synthetase.

[0046] Using the L.iranensis DWH-2 genome mini template, the 12-oxo-phytodienoate reductase LiOPR and acyl-CoA synthetase LiOPCL genes g4442 and g8524 were retrieved using the primers in Table 1. The codon-optimized gene sequences were SEQ ID NO.3 and SEQ ID NO.4, respectively, and inserted between EcoRI and HindIII of pACYCDuet-1 to obtain recombinant plasmids. After the plasmids were transformed into E.coli BL-21, recombinant bacteria E.coli LiOPR and E.coli LiOPC were obtained.

[0047] E. coli LiOPR and E. coli LiOPC were inoculated into 50 mL LB medium containing chloramphenicol, incubated until OD600 = 0.6-0.8 (37 ° C, 220 rpm), then cooled and IPTG (final concentration 0.5 mM) was added, and induced for 18 hours (20 ° C, 220 rpm). After the induction, the cells were collected by centrifugation at 8000 × g for 5 minutes, washed once with sterile water, and then centrifuged, resuspended with buffer and ultrasonically broken, and the supernatant was collected by centrifugation at 8000 × g for 5 minutes to obtain LiOPR and LiOPCL crude enzyme solutions, respectively.

[0048] Example 2 Synthesis of JA by cascade reaction of recombinant LiOPR and LiOPCL with Saccharomyces cerevisiae BY4741

[0049] The reaction substrate solution is a 50mM NaH2PO4 / Na2HPO4 buffer with a pH of 7.4, containing 0.5mM 12-OPDA, 10mM NADH, 4mM ATP and 4mM CoA. Take the recombinant E. coli LiOPR and E. coli LiOPC cells, and ultrasonically treat them with a suspension of 0.1g / mL to obtain the recombinant LiOPR and LiOPCL crude enzyme solutions. Saccharomyces cerevisiae BY4741 was inoculated in YPD and cultured for 48 hours (30°C, 220rpm), and suspended in phosphate buffer at a ratio of 0.2g / mL. The above two enzyme crude enzyme solutions (500μL each), BY4741 cell suspension (500μL) and reaction substrate solution (500μL) were mixed and shaken at 30°C and 220rpm for 12 hours. After the reaction, the product was extracted with the reaction solution, methanol and chloroform in a ratio of 1:1:2. As Figure 3 As shown, the jasmonic acid content was 16.5 mg / L as determined by HPLC.

[0050] Comparative Example 1

[0051] The recombinant LiOPR and LiOPCL crude enzyme solutions in Example 2 were replaced with E. coli BL-21 disrupted liquid transferred into the empty vector pACYCDuet-1, and other conditions or parameters were the same as those in Example 1. The reaction results showed that no jasmonic acid was detected, proving that LiOPR and LiOPCL are key genes that catalyze the conversion of 12-OPDA to jasmonic acid.

[0052] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. An enzyme related to jasmonic acid synthesis, characterized in that: The jasmonic acid synthesis-related enzymes include 12-oxo-phytodienoate reductase LiOPR and acyl-CoA synthetase LiOPCL, the amino acid sequence of the 12-oxo-phytodienoate reductase LiOPR is shown in SEQ ID NO: 1, and the amino acid sequence of the acyl-CoA synthetase LiOPCL is shown in SEQ ID NO:

2.

2. The gene encoding the jasmonic acid synthesis-related enzyme according to claim 1, characterized in that: The jasmonic acid synthesis-related enzymes include 12-oxo-phytodienoate reductase LiOPR and acyl-CoA synthetase LiOPCL.

3. The gene according to claim 2, characterized in that The nucleotide sequence of the gene encoding the 12-oxo-phytodienoate reductase is shown in SEQ ID NO.3, and the nucleotide sequence of the gene encoding the acyl-CoA synthetase is shown in SEQ ID NO.

4.

4. A vector carrying the gene according to claim 2 or 3.

5. A genetically engineered bacterium expressing the jasmonic acid synthesis-related enzyme according to claim 1, or containing the gene according to claim 2 or 3, or transformed with the vector according to claim 4.

6. Application of jasmonic acid synthesis-related enzymes in biosynthesis of jasmonic acid, characterized in that: The jasmonic acid synthesis-related enzymes include 12-oxo-phytodienoate reductase LiOPR and acyl-CoA synthetase LiOPCL, the amino acid sequence of the 12-oxo-phytodienoate reductase LiOPR is shown in SEQ ID NO: 1, and the amino acid sequence of the acyl-CoA synthetase LiOPCL is shown in SEQ ID NO:

2.

7. A method for synthesizing jasmonic acid in one pot, characterized in that: The method uses 12-OPDA as a substrate and utilizes the jasmonic acid synthesis-related enzymes and yeast to form a catalytic system to produce jasmonic acid. The jasmonic acid synthesis-related enzymes include 12-oxo-phytodienoate reductase LiOPR and acyl-CoA synthetase LiOPCL. The amino acid sequence of the 12-oxo-phytodienoate reductase LiOPR is shown in SEQ ID NO: 1, and the amino acid sequence of the acyl-CoA synthetase LiOPCL is shown in SEQ ID NO:

2.

8. The method according to claim 7, characterized in that In the catalytic system, the addition amount of the 12-oxo-phytodienoate reductase LiOPR enzyme solution is 0.5-5mL / mL; the addition amount of the acyl-CoA synthetase LiOPCL enzyme solution is 0.5-5mL / mL; the addition amount of the yeast is 0.01-20g / mL; and the concentration of the 12-OPDA is 0.01-50mM.

9. The method according to claim 7, characterized in that: The catalytic system further includes coenzyme NADH at a concentration of 0.001 to 10.0 mM, ATP at a concentration of 0.001 to 10.0 mM, and CoA at a concentration of 0.001 to 10.0 mM.

10. Use of the jasmonic acid synthesis-related enzyme according to claim 1, or the gene according to claim 2 or 3, or the vector according to claim 4, or the genetically engineered bacteria according to claim 5, or the method according to any one of claims 7 to 8 in the preparation of jasmonic acid or a jasmonic acid-containing product.

Images