Application of circ86591 related to gemcitabine resistance of colon cancer cells

Abstract

The present invention discloses the application of circ86591 related to the resistance of colon cancer cells to gemcitabine, belonging to the field of biomedicine. In the present invention, by overexpressing and knocking down circ86591 in colon cancer cells and detecting the cell viability of colon cancer cells against gemcitabine, it was found that after overexpressing circ86591, there was no significant difference in the response of colon cancer cells to GEM; after knocking down circ86591, the drug resistance of colon cancer cells to GEM was increased. The present invention confirms through cell experiments that circ86591 is expected to be used as a new GEM resistance marker, so as to develop new drugs to overcome the drug resistance response of cells to GEM.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and particularly to the application of circ86591 related to the resistance of colon cancer cells to gemcitabine. Background Art

[0002] Tumor resistance is divided into primary resistance and acquired resistance. The former is mediated by tumor cell heterogeneity. Cytotoxic chemotherapy drugs mainly target actively proliferating cells, while non-actively proliferating cells will escape treatment and promote tumor recurrence. The latter refers to the tumor cell population that is initially sensitive to the drug and develops during the exposure to the drug. The mechanisms of acquired resistance include changes in important pathways or genes in tumor cells, feedback activation of compensatory oncogenic signaling pathways, epigenetic regulation of drug resistance, or overexpression of efflux transporters. Therefore, tumor resistance is the comprehensive result of multiple complex factors. With the combined application of various drugs and monoclonal antibodies, the tumor response rate has gradually increased, but the emergence of drug resistance is still the main reason for the poor treatment effect of patients with colorectal cancer (CRC). Therefore, finding new tumor resistance targets is of great significance for improving the treatment effect of CRC patients, evaluating the medication plan of patients, and predicting the occurrence of drug resistance events.

[0003] Gemcitabine (GEM) is a nucleoside analog-related chemotherapeutic drug widely used in the treatment of hematological malignancies and has now become a conventional chemotherapeutic drug for the treatment of advanced pancreatic cancer. Treatment regimens combining GEM with other drugs or monoclonal antibodies (such as combination therapy with doxorubicin) are also used to treat various cancers including colon cancer. However, tumor drug resistance will greatly reduce the therapeutic potential of GEM. In some colon cancer patients, the roles and effects of GEM in different treatment regimens are as follows: (1) Fixed-dose rate GEM injection, but the results showed that gemcitabine administered by fixed-dose rate infusion had little activity in heavily pretreated advanced colorectal cancer patients. Monotherapy with gemcitabine is not recommended in this patient population. (2) Application in combination with drugs such as paclitaxel. Existing studies have analyzed the efficacy and safety of GEM combined with paclitaxel in the third-line treatment of advanced colorectal cancer. The study found that the treatment effect of GEM combined with paclitaxel was better than that of using gemcitabine alone. The treatment effective rate of the observation group was higher, the incidence of adverse reactions was lower, and the quality of life and satisfaction of patients were also significantly improved. According to the NCCN colon cancer guidelines, GEM can also be combined with other chemotherapeutic drugs, such as FOLFOX, FOLFIRI, CapeOX, etc., for the treatment of metastatic colorectal cancer. (3) In colorectal cancer patients resistant to oxaliplatin, GEM is considered an alternative therapy. Some studies have shown that GEM resists chemotherapy resistance by inhibiting the Akt and src / p38 MAPK pathways, thereby inducing apoptosis and cell death. For patients who do not respond to oxaliplatin-based regimens (such as FOLFOX), gemcitabine may be an alternative therapy. All in all, GEM occupies an important position in the clinical treatment of colon cancer, and the exploration of its drug resistance helps more colon cancer patients to benefit from it.

[0004] Numerous studies have shown that some abnormally expressed proteins and RNAs can affect the sensitivity of colon cancer cells to GEM. For example, low expression of Smurf1 can increase apoptosis of the colon cancer cell line HCT116 induced by GEM and cisplatin. The long non-coding RNA AGAP2-AS1 can promote the proliferation of colorectal cancer cells, inhibit apoptosis, and increase the chemoresistance of cells to GEM.

[0005] Antisense noncoding RNA in INK4 locus (ANRIL), also known as CDKN2B-AS, is an antisense long non-coding RNA (lncRNA) located at the CDKN2A / B locus on human chromosome 9p21.3. The ANRIL gene contains at least 21 exons and can form linear ANRIL (linANRIL) and circular ANRIL (circANRIL) through splicing. In tumor cells, upregulation of ANRIL can promote cell proliferation, metastasis, and epithelial-mesenchymal transformation (EMT), while downregulation of ANRIL inhibits the growth, invasion, and metastasis of tumor cells and promotes apoptosis and senescence. In metabolic diseases, the polymorphism of the ANRIL gene is associated with type 2 diabetes, atherosclerosis, obesity, etc. In addition to gene polymorphism, the expression level of circANRIL is closely related to the risk and severity of coronary artery disease. circANRIL has been found to have 13 transcripts (hsa_circCDKN2B-AS_001 - 013), which are distributed in the nucleus and cytoplasm, and the different locations suggest the diversity of the functions of circANRIL. hsa_circCDKN2B-AS_005 regulates the maturation of pre-ribosomal RNA by binding to 60S pre-ribosomal assembly factor - pescadillo homologue 1 (PES1), controls ribosome biogenesis and nucleolar stress in vascular smooth muscle cells and macrophages, leading to apoptosis and inhibition of cell proliferation, and ultimately plays a protective role against atherosclerosis. In rheumatoid arthritis, hsa_circCDKN2B-AS_006 regulates the expression of runt-related transcription factor 1 (RUNX1) by binding to miR-1258 molecule, affects the Wnt / β-catenin signaling pathway, and promotes EMT of synovial fibroblasts. In skin cancer, hsa-circ_0025039, hsa-circRNA_006612, hsa-circRNA_005537, and circANRIL can promote tumor progression by targeting different molecular targets (CDK4, DAB2IP, ZEB1, miR-889, and let-7c-3p). However, there is less research on the transcripts of ANRIL in colon cancer and no unified conclusion. Reports have shown that knocking down the expression level of ANRIL can increase the sensitivity of colorectal cancer cells to 5-FU and promote apoptosis.Conversely, upregulating the expression level of ANRIL significantly promotes the chemoresistance of cells. However, there is currently no study on the relationship between gemcitabine (GEM) resistance response in colon cancer and ANRIL. Summary of the Invention

[0006] The object of the present invention is to provide the application of circ86591 related to the gemcitabine resistance of colon cancer cells to solve the problems existing in the above-mentioned prior art. The present invention has confirmed through cell experiments that circ86591 is expected to be used as a new GEM resistance marker, thereby developing new drugs to overcome the drug resistance response of cells to GEM.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides the application of a reagent for detecting the expression level of circ86591 in the preparation of a product for evaluating the gemcitabine resistance of colon cancer cells, and the nucleotide sequence of the circ86591 is shown in SEQ ID NO.1.

[0009] Furthermore, when the expression level of circ86591 decreases, the gemcitabine resistance of the colon cancer cells increases.

[0010] The present invention also provides the application of a reagent for detecting the expression level of circ86591 in screening drugs for reducing the gemcitabine resistance of colon cancer cells, and the nucleotide sequence of the circ86591 is shown in SEQ ID NO.1.

[0011] Furthermore, after treating the colon cancer cells with the drug, if the expression level of circ86591 decreases, the drug cannot be used as a candidate drug for reducing the gemcitabine resistance of colon cancer cells.

[0012] The present invention also provides a method for detecting the gemcitabine resistance of colon cancer cells, including the step of detecting the expression level of circ86591 in the colon cancer cells. If the expression level of circ86591 in the colon cancer cells decreases, the gemcitabine resistance of the colon cancer cells increases; the nucleotide sequence of the circ86591 is shown in SEQ ID NO.1.

[0013] The present invention also provides a method for evaluating whether a drug increases the gemcitabine resistance of colon cancer cells, including detecting the expression level of circ86591 after treating the colon cancer cells with the drug. If the expression level of circ86591 decreases, the drug increases the gemcitabine resistance of the colon cancer cells; the nucleotide sequence of the circ86591 is shown in SEQ ID NO.1.

[0014] The present invention also provides the application of circ86591 as a drug target in screening drugs for treating colon cancer, wherein the drugs are used in combination with gemcitabine to treat colon cancer; the nucleotide sequence of the circ86591 is as shown in SEQ ID NO.1.

[0015] Furthermore, if the expression level of circ86591 decreases after the drug acts on colon cancer cells, then the drug cannot be used as a candidate drug for treating colon cancer in combination with gemcitabine.

[0016] The present invention discloses the following technical effects:

[0017] In the present invention, by designing and synthesizing ASO reagents of circ86591 and constructing an adenovirus vector overexpressing circ86591, the circ86591 in different colon cancer cell lines was knocked down and overexpressed respectively, and colon cancer cell lines with circ86591 knockdown and overexpression were obtained. Through CCK-8 experiments, the cell viability of colon cancer cells to GEM drugs after knocking down and overexpressing circ86591 was detected. The results showed that after overexpressing circ86591, there was no significant difference in the response of colon cancer cells to GEM; after knocking down circ86591, the drug resistance of colon cancer cells to GEM increased.

[0018] The present invention confirms through cell experiments that circ86591 is expected to be used as a new GEM drug resistance marker, so as to develop new drugs to overcome the drug resistance response of cells to GEM. Description of the Drawings

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0020] Figure 1 It is a diagram of the existence form and subcellular localization result of circ86591. Among them, A is the Sanger sequencing result of circ86591; B is the qRT-PCR quantification result of circ86591 and linear GAPDH after ActD treatment; C is the detection result of circ86591 and linear ANRIL in colon cancer cells after digesting total cellular RNA with RNase R; D is the localization result of circ86591 detected by nuclear-cytoplasmic separation experiment;

[0021] Figure 2 It is a map of the ADM-CMV-circRNA-mMCV-copGFP plasmid;

[0022] Figure 3 For fluorescence observation of the transfection results of colon cancer cells overexpressing circ86591 (A) and qRT-PCR detection results (B);

[0023] Figure 4 For the response of HCT116 cells infected with circ86591 and control virus supernatants to gemcitabine. Among them, A is the survival rate of the two groups of cells detected by CCK8 assay after treatment with gemcitabine, and B is the normalization result

[0024] Figure 5 For the response of SW480 cells infected with circ86591 and control virus supernatants to gemcitabine. Among them, A is the survival rate of the two groups of cells detected by CCK8 assay after treatment with gemcitabine, and B is the normalization result;

[0025] Figure 6 For the action target of the ASO reagent (A) and the qRT-PCR detection results (B) of colon cancer cells after treatment with ASO;

[0026] Figure 7 For the response of HCT116 cells transfected with ASO and control reagents to gemcitabine. Among them, A is the survival rate of the two groups of cells detected by CCK8 assay after treatment with gemcitabine, and B is the normalization result;

[0027] Figure 8 For the response of SW480 cells transfected with ASO and control reagents to gemcitabine. Among them, A is the survival rate of the two groups of cells detected by CCK8 assay after treatment with gemcitabine, and B is the normalization result;

[0028] Figure 9 For the RNA-seq analysis of LOVO cells transfected with ASO and control reagents. A is the result of volcano plot analysis, and B is the result of KOG enrichment analysis;

[0029] Figure 10 For the qRT-PCR (A) and Western blot detection results (B) of DCK in colon cancer cells with circ86591 knockdown. Detailed implementation manners

[0030] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0031] It should be understood that the terms used in the present invention are only for describing specific embodiments and are not intended to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0032] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0033] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0034] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0035] Example 1 The existence form and subcellular localization of circ86591

[0036] The full-length sequence of circ_86591 (circANRIL-hsa_circCDKN2B-AS_012) was obtained through the CircInteractome (https: / / circinteractome.irp.nia.nih.gov / ) database, as shown in SEQ ID NO.1, with a total of 1077 bp.

[0037] SEQ ID NO.1:

[0038]

[0039] The expression of circ86591 in colon cancer cell lines SW480, LOVO, and RKO was detected using back-to-back primers. The designed amplification primer sequences were F: TGCAGTACAACACTCCAGTAGAGAC (SEQ ID NO.2); R: GAATCACGAGGTCGAGAGTTCA (SEQ ID NO.3), which were designed and synthesized by Guangzhou Ribobio Co., Ltd. The amplification system for qRT-PCR: 2×Mix 10 μL; upstream primer (F, 10 μM) 0.4 μL; downstream primer (R, 10 μM) 0.4 μL; template 1.5 μL; H 2 O 7.7 μL, totaling 20 μL; amplification conditions (ABI 7500 instrument): pre-denaturation at 94°C for 30 s, denaturation at 94°C for 5 s, annealing at 62°C for 15 s, extension at 72°C for 34 s, 40 cycles. The Sanger sequencing results showed that circ86591 was a head-to-tail joined sequence ( Figure 1 of A).

[0040] By treating SW480 cells with actinomycin D (ActD) that inhibits RNA synthesis, the stability of circ86591 and linear GAPDH was compared. The qRT-PCR results found that the stability of circ86591 was higher than that of linear GAPDH ( Figure 1 of B). Further, by digesting the total cellular RNA with RNase R that can degrade linear RNA but retain circular RNA, after enzymatic treatment, the circular circ86591 still existed, but the presence of linear RNA could not be detected ( Figure 1 of C). The localization of circ86591 was detected by nuclear-cytoplasmic separation experiments. Analysis by qRT-PCR showed that circ86591 mainly existed in the nucleus ( Figure 1 of D).

[0041] Example 2 Effects of overexpression and knockdown of circ86591 on gemcitabine resistance in colon cancer cells

[0042] 1. Design and synthesize ASO reagent for circ86591

[0043] An antisense oligonucleotide sequence (ASO) (Guangzhou Ribobio Co., Ltd.) was designed and synthesized for the head-to-tail junction of circ86591. The target sequence recognized by ASO was: CAACACTCCAGTAGAGACGG (SEQ ID NO.4).

[0044] 2. Design and synthesize overexpression vector for circ86591

[0045] According to the full-length sequence of circ86591, Vigene Biosciences Co., Ltd. designed and synthesized an overexpression adenovirus vector pADM-CMV-circRNA-mMCV-copGFP with green fluorescent protein (GFP). The specific requirements are as follows: the CMV promoter drives the target gene, and loop-forming sequences are added to both ends of the target gene, without fusing GFP fluorescence. The map of the pADM-CMV-circRNA-mMCV-copGFP plasmid is as shown in Figure 2 shown.

[0046] The steps for constructing the circ86591 overexpression adenovirus vector are as follows:

[0047] Digest the circ86591 gene and the pADM-CMV-circRNA-mMCV-copGFP vector with AsisI / MluI respectively. The digestion system of circ86591 is shown in Table 1, and the digestion system of the pADM-CMV-circRNA-mMCV-copGFP vector is shown in Table 2.

[0048] Table 1 Digestion system of the target gene

[0049] Reaction solution components Volume DNA fragment (0.1 μg / μL) 10 μL 10× Buffer 3 μL SfaAI 1 μL MluI 1 μL <![CDATA[ddH 2 O]]> 15 μL Total 30 μL

[0050] Table 2 Digestion system of the vector

[0051]

[0052]

[0053] After adding the samples and mixing well, incubate at 37°C for 1 h. After the reaction, detect the size of the digested target band by 1% agarose gel electrophoresis, and recover the target fragment using a gel extraction kit.

[0054] Ligate the circ86591 gene with the vector using T4 ligase. The ligation system is shown in Table 3.

[0055] Table 3 Ligation system of linearized fragments

[0056] Components Volume Target fragment 2 - 6 μL Vector fragment 2 - 4 μL 10× T4 Buffer 1 μL T4 DNA ligase (10 U / μL) 1 μL Total 10 μL

[0057] After mixing the ligation system, centrifuge briefly, and incubate at 22°C for 1 h. Transform the ligation product into Escherichia coli DH5α competent cells, spread on an LB plate with the corresponding resistance for screening, pick colonies, and verify by digestion. Select the vector with correct digestion for sequencing. Extract the endotoxin-free correct plasmid and perform adenovirus packaging. The steps for adenovirus packaging are as follows:

[0058] (1) Transfection

[0059] Prepare a Mix by mixing 500 μL of DMEM and 9 μL of PEI, and let it stand for more than 5 min.

[0060] Add 1 μg of shuttle plasmid (pADM target plasmid) and 1 μg of helper plasmid (adenovirus plasmid AD5F35) (mixed at a mass ratio of 1:1), for a total of 2 μg, and vortex to mix evenly.

[0061] Vortex briefly and then centrifuge briefly, and let it stand for more than 30 min.

[0062] During the standing period, seed HEK293A cells in a 6-well plate, with the number of cells being about 0.3 - 0.5×10 6 cells / well.

[0063] Add the standing mixture drop by drop to the cells in the 6-well plate. After cross-mixing, place it in a CO 2 incubator for culture.

[0064] (2) Amplification and virus harvesting steps

[0065] Blow down the cells with CPE in the 6-well plate together with the culture medium, and slowly add them to the HEK293A cells in a 10 cm dish. After cross-shaking, place it in a CO 2 incubator for culture. Observe the virus production after 2 - 3 days and harvest the virus.

[0066] Collect the HEK293A cells in the 10 cm dish with CPE effect, transfer them to a 15 mL centrifuge tube with an electric pipette, and centrifuge at 3500 rpm at 4°C for 7 min.

[0067] After centrifugation, take out the centrifuge tube, pour the supernatant into a new 15 mL tube and store it in a 4°C refrigerator for later use.

[0068] (3) Pretreatment before purification

[0069] Centrifuge the supernatant that has been overnight at 4°C, at 3500 g at 4°C for 30 min, and collect the precipitate. Resuspend the virus precipitate with 4 mL of 1×PBS + PF68 and collect it in a 50 mL tube.

[0070] (4) Purification and concentration

[0071] Purification: Iodixanol density gradient centrifugation.

[0072] Prepare iodixanol with different mass concentration gradients in a certain proportion.

[0073] Use an electric pipette to layer different concentrations of iodixanol in an ultracentrifuge tube. First add 4.2 mL of the 60% layer, then add 5 mL of the 40% layer, then add 6 mL of the 25% layer, and finally add 9 mL of the 15% layer. Add the treated virus solution to the top layer. Ultra-high speed centrifugation, parameters: 4°C, 48000 rpm for 2.5 min. The corresponding ultracentrifuge tubes should be balanced before centrifugation, and the error should be controlled within 0.1 g.

[0074] Concentration: After centrifugation, pierce the bottom of the ultrafiltration tube with a needle, discard the first 3 mL, and collect the solution from the 4th mL to the 8th mL into a 15 mL tube. Dilute the collected virus solution to a volume of 15 mL with 1×PBS + PF68, then filter it through a 0.22 μm filter membrane and a disposable syringe into a 15 mL ultrafiltration tube. Centrifuge the ultrafiltration tube at 3500 g for 45 min, discard the centrifuged liquid, add PBS + PF68 to dilute it again in the ultrafiltration tube, and centrifuge for about 45 min again. Pipette the liquid collected in the ultrafiltration tube repeatedly and aspirate it into a virus storage tube, and make up the volume with 1×PBS + PF68. Finally, add 5×A195 stock solution until the final concentration of the stock solution is 1×. Finally, obtain the supernatant of overexpressed circ86591.

[0075] 2. Overexpression of circ86591

[0076] Transfect N2A cells (mouse neuroblastoma cells) with the supernatant of overexpressed circ86591. After 72 h, collect the cells and extract cellular RNA, and detect the circularization rate by qRT-PCR. The amplification primers, reaction program, and reaction system of qRT-PCR are the same as in Example 1, and the detection results are shown in Table 4.

[0077] Table 4 Quantitative values and analysis (2 -△△Ct analysis method)

[0078]

[0079] Then, infect the colon cancer cell lines HCT116 and SW480 with the virus supernatant overexpressing circ86591, and observe the transfection efficiency of the cells under a fluorescence microscope. As Figure 3 shown in A, compared with the wild-type control (Ctrl), more fluorescence was observed in the group overexpressing circ86591 (Circ86591-OE). The qRT-PCR results showed that the expression of circ86591 was increased in the overexpression group (ADV circ86591) Figure 3 shown in B, proving the successful overexpression of circ86591.

[0080] Detect the cell viability of HCT116 and SW480 cells against GEM drug after upregulating circ86591 by CCK-8 assay. The process of GEM drug treatment is as follows:

[0081] (1) Collect tumor cells in the logarithmic growth phase, dilute the cell concentration to a cell suspension of 100000 cells / mL with complete medium, inoculate 100 μL of the cell suspension into each well of a 96-well plate, and inoculate 3 - 5 wells for each cell concentration. Then place it in a cell culture incubator and culture overnight.

[0082] (2) Drug addition treatment: First, gem was prepared into a storage concentration of 0.01 mM. HCT116 cells (1 / 4IC 50 = 8 nM) were added with 100 μL / well of the diluted gem drug (i.e., 0.8 μL of the gem with storage concentration was added to 1 mL of complete medium), and SW480 cells (1 / 4IC 50 = 4 nM) were added with 100 μL / well of the diluted gem drug (i.e., 0.4 μL of the gem with storage concentration was added to 1 mL of complete medium), and then incubated in an incubator for 48 - 72 hours.

[0083] (3) After the incubation ended, the 96-well plate was taken out, the drug solution in the wells was aspirated and discarded, and 100 μL / well of the prepared 10% CCK8 solution (100 μL of the CCK8 stock solution was added to 1 mL of basal medium) was added, and then it was placed in the cell culture incubator for 2 - 4 hours.

[0084] (4) The absorbance was measured with an enzyme-linked immunosorbent assay (ELISA) reader at a detection wavelength of 450 nm and a reference wavelength of 630 nm.

[0085] The test results showed that when the expression of circ86591 was up-regulated, there was no significant difference in the response of HCT116 and SW480 cells to GEM ( Figure 4 and Figure 5 ).

[0086] 3. Knockdown of circ86591

[0087] Cell culture: LOVO cells were cultured in DMEM medium containing 10% fetal bovine serum, and the culture medium was changed every 3 days for subculture.

[0088] Cell transfection: The cells were seeded in a 6-well plate and cultured overnight. The corresponding reagents were taken out, reconstituted, shaken gently, and then centrifuged briefly. According to the instructions of the lipo3000 transfection kit (Lipofectamine TM 3000 Transfection Reagent, Invitrogen, catalog number L3000015), the dosage was calculated, and the transfection system was prepared:

[0089] 1) Preparation of solution A (Lip03000 dilution solution): 125 μL of Opti-MEM and 5 μL of Lipo3000 were used for each well, and each well was prepared separately, gently mixed, and not shaken;

[0090] 2) Preparation of solution B (ASO premix): 125 μL of Opti-MEM + 5 μL of ASO were used for each well, and the volume to be added was calculated according to the concentration of the reagent to be transfected; each well was prepared separately, gently mixed, and not shaken.

[0091] 3) Add the liquid B of each well to the corresponding liquid A, mix well and let stand for 12 min;

[0092] 4) During the standing period, change the medium for the cells in the plates: aspirate the original medium, add 1 mL of PBS to each well to wash once (add along the inner wall), and then add 2 mL of complete DMEM medium to each well along the inner wall.

[0093] 5) Slowly and suspendedly drip the completed standing system into the corresponding wells, and mix it evenly with the cells. After all wells are added, gently shake it evenly.

[0094] RNA extraction: Carry out according to the instructions of Tsingke RNA extraction kit (Total RNA Extraction Kit for Animal Tissues / Cells (Double-column Type), product number TSP413)).

[0095] cDNA synthesis: Carry out according to the instructions of the reverse transcription kit (Roche, product number Product No.04897030001).

[0096] qRT-PCR detection of mRNA level: Carry out according to the instructions of PerfectStartTM Green qPCR SuperMix(+DyeI / +DyeII)(TransGen Biotech, product number AQ602), and the amplification system and amplification conditions are the same as those in Example 1.

[0097] After the LOVO colorectal cancer cell line was treated with ASO reagent for 48 hours, qRT-PCR detection found that the content of circ86591 decreased ( Figure 6 ). By detecting the cell viability of HCT116 and SW480 cells against GEM drug (1 / 4 - 1 / 8IC 50 dose) after knocking down circ86591 through CCK-8 experiment, the process of GEM drug treatment was the same as that in the "Overexpression of circ86591" part, and the results showed that down-regulating the expression of circ86591 could improve the drug resistance of tumor cells to GEM ( Figure 7 and Figure 8 ).

[0098] Perform transcriptome sequencing analysis on the RNA of the control group (ASO-NC) and the knockdown group (ASO-circ86591). In order to obtain significantly different genes, the screening conditions were set as q value < 0.05 and the fold change |Fold Change| > 2. 148 up-regulated differential genes and 195 down-regulated differential genes were screened out in this way. Perform KOG analysis on the differential genes that were down-regulated with the decrease of circ86591 expression. The results of KOG enrichment analysis showed that the down-regulated genes were mainly concentrated in the nucleotide transport and metabolism pathway ( Figure 9)。The DCK gene is enriched in the nucleotide transport and metabolism pathways. It was found through qRT-PCR and Western blot experiments that the expression of DCK decreased after knocking down circ86591( Figure 10 )。DCK can catalyze the phosphorylation of the drug gemcitabine, which exerts its anti-tumor effect by inhibiting DNA replication and repair in tumor cells. Therefore, downregulating circ86591 can inhibit the expression level of DCK, thereby affecting the sensitivity of colon cancer cells to GEM.

[0099] The embodiments described above are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a reagent for detecting the expression of circ86591 in the preparation of a product for evaluating the resistance of colon cancer cells to gemcitabine, characterized in that: The nucleotide sequence of circ86591 is shown in SEQ ID NO.1; When the expression level of circ86591 decreases, the resistance of the colon cancer cells to gemcitabine increases; The reagents are back-to-back primers with nucleotide sequences as shown in SEQ ID NOs. 2-3.

2. Use of a reagent for detecting the expression level of circ86591 in screening drugs that reduce the resistance of colon cancer cells to gemcitabine, characterized in that: The nucleotide sequence of circ86591 is shown in SEQ ID NO.1; After the colon cancer cells are treated with the drug, the expression level of the circ86591 is reduced, and the drug cannot be used as a candidate drug for reducing the resistance of colon cancer cells to gemcitabine; The reagents are back-to-back primers with nucleotide sequences as shown in SEQ ID NOs. 2-3.

3. A method for detecting the resistance of colon cancer cells to gemcitabine for non-disease diagnosis and treatment purposes, characterized in that: The method comprises the steps of detecting the expression level of circ86591 in the colon cancer cells, and if the colon cancer cells When the expression level of circ86591 decreases, the drug resistance of the colon cancer cells to gemcitabine increases; the nucleotide sequence of circ86591 is shown in SEQ ID NO.1; and the expression level of circ86591 in the colon cancer cells is detected using back-to-back primers with nucleotide sequences shown in SEQ ID NOs.2 to 3.

4. A method for evaluating whether a drug increases the resistance of colon cancer cells to gemcitabine for non-disease diagnosis and treatment purposes, characterized in that: The method comprises treating colon cancer cells with the drug, and then detecting the expression level of circ86591. If the expression level of circ86591 decreases, the drug increases the drug resistance of colon cancer cells to gemcitabine. The nucleotide sequence of circ86591 is shown in SEQ ID NO.

1. The expression level of circ86591 is detected using back-to-back primers with nucleotide sequences shown in SEQ ID NOs.2 to 3.

Images