SNP (Single Nucleotide Polymorphism) molecular marker related to pork quality character gene GAB1, primer pair and application of SNP molecular marker and primer pair

Abstract

The invention discloses an SNP molecular marker related to a pork quality character gene GAB1, a primer pair and application of the SNP molecular marker and the primer pair, and relates to the technical field of pig molecular markers. Wherein the meat quality character is an intramuscular fat content character; the molecular marker is located in the fifth exon of the GAB1 gene of the No.8 chromosome of a pig, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1 in a sequence table, and g.112 Ggt exists at the 112bp position of the sequence; and A basic group mutation. The invention also provides a primer pair for amplifying the molecular marker and a method for breeding by using the molecular marker. According to the invention, the correlation between one SNP molecular marker in the pig GAB1 gene and the intramuscular fat content character of the pig is explored for the first time, so that the SNP molecular marker can be used for marker-assisted selective breeding of the pig, that is, the new application of the SNP molecular marker in the pig GAB1 gene in marker-assisted breeding of the pork quality character is provided, the early screening of the breeding character of the pig is realized, and the breeding efficiency of the pig is improved. The screening method is simple and rapid.

Description

Technical Field

[0001] The present invention relates to the technical field of pig molecular markers, and in particular to a SNP molecular marker related to a pork quality trait gene GAB1, a primer pair and an application thereof. Background Art

[0002] China is a major pig producer, ranking first in the world in terms of both pig farming scale and pork consumption. Meat quality traits are important economic traits in the pig breeding industry, and the quality of pork directly affects the production and economic benefits of pig farms. The heritability of meat quality is between 0.25 and 0.42, and most of them are medium heritability traits. At present, there are still insufficient key genes that can be used to elucidate the mechanism of the effect of intramuscular fat content on meat quality traits. Therefore, finding key molecular genetic markers that control pork quality traits and using them in molecular marker-assisted breeding is of great significance to improving the meat quality traits of pigs and increasing economic benefits.

[0003] GRB2-associated binding protein 1 (GAB1) is a founding member of the GAB / DOS family of proteins containing pleckstrin homology (PH) domains. After various stimuli, GAB1 cellular localization changes from the cytoplasm to the membrane, where it is phosphorylated by a series of kinases and recruits proteins containing SH2 domains, such as SHP2, the p85 subunit of PI3K, CRK, etc., thereby activating different signaling pathways, including MAPK, PI3K / AKT and JNK, thereby regulating various biological processes such as cell proliferation, inhibition of apoptosis, metastasis and angiogenesis.

[0004] Studies have shown that the activation of Gab1 can maintain the downstream activation of PI3K and Akt, and recombinant SNCA, as a new glucose regulator, can promote glucose uptake in adipose tissue and skeletal muscle in vitro and in vivo in mouse adipocyte precursors through the LPAR2 / Gab1 / PI3K / Akt pathway. Other studies have shown that GAB1 is required for fibroblast survival and maintenance of cardiac function.

[0005] However, the molecular mechanism of whether the GAB1 gene can improve pork quality has not been reported. Summary of the invention

[0006] The purpose of the present invention is to overcome the deficiencies in the above-mentioned prior art and provide a SNP molecular marker, a primer pair and their application related to the pork quality trait gene GAB1. The present invention discovers that a SNP in the GAB1 gene of chromosome 8 is associated with pork quality traits, which can be used as a molecular marker for pork quality trait screening and pig breeding.

[0007] In the first aspect, the present invention provides a SNP molecular marker associated with the pork quality trait gene GAB1, wherein the meat quality trait is the intramuscular fat content trait; the molecular marker is located in the 5th exon of the GAB1 gene on pig chromosome 8, and its nucleotide sequence is shown in the sequence table SEQ ID NO.1, and there is a g.112G>A base mutation at the 112bp of the sequence.

[0008] Furthermore, the A or G base polymorphic site at the 112th bp in the sequence SEQ ID NO.1 exhibits three genotypes: AA, AG or GG, wherein the A allele is the dominant allele.

[0009] In a second aspect, the present invention provides a use of the SNP molecular marker as described in the first aspect in pork quality trait screening and / or pig breeding.

[0010] In a third aspect, the present invention provides a primer pair for amplifying the molecular marker as described in the first aspect, the primer pair comprising: the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3.

[0011] In a fourth aspect, the present invention provides a use of the primer pair described in the third aspect in pork quality trait screening and / or pig breeding.

[0012] In a fifth aspect, the present invention provides a kit for rapid breeding using the SNP molecular markers as described in the first aspect, comprising the primer pair as described in the third aspect.

[0013] In a sixth aspect, the present invention provides a method for screening pork quality traits and / or pig breeding, comprising the following steps:

[0014] S1. Extract pig genomic DNA;

[0015] S2, using the genomic DNA obtained in step S1 as a template, performing PCR amplification using the primer pair described in claim 4 to obtain the molecular marker described in claim 1 and purifying it;

[0016] S3. Perform sequencing analysis on the molecular markers purified in step S2, retain the individuals carrying the A allele at the 112 bp of the sequence, and eliminate the individuals carrying the G allele.

[0017] Furthermore, in step S1, genomic DNA is extracted from the ear margin tissue of the pig to be tested.

[0018] Further, in step S2, the PCR reaction system is 50 μL, and the components in the system are: 100 ng of genomic DNA, 25 μL of PCRmix, 1 μL of each of the upstream and downstream primers mentioned above, and ddH2O is added to make up the total volume to 50 μL; the PCR operation program is: pre-denaturation at 98°C for 45s; denaturation at 98°C for 10s, annealing at 60°C for 30s, extension at 72°C for 30s, 40 cycles; extension at 72°C for 5min; storage at 4°C.

[0019] Compared with the prior art, the beneficial effects of the present invention include:

[0020] The present invention has discovered for the first time that SNP molecular markers associated with the porcine GAB1 gene are associated with the meat quality traits of pigs, specifically the intramuscular fat content trait. Therefore, the molecular markers can be used to screen pork quality traits and for breeding. That is, a new use of SNP molecular markers associated with the porcine GAB1 gene in marker-assisted breeding of pork quality traits is provided, thereby achieving early screening of pork quality traits, and the screening method is simple and rapid. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is an agarose gel electrophoresis detection diagram of the PCR product in Example 1 of the present invention, wherein lane M is DL1000 Marker, and lanes 1-3 are amplified fragments in pigs, with a fragment size of 224 bp;

[0022] Figure 2 This is the sequencing map of the g.112G>A site in Example 1 of the present invention. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0024] Example 1 Obtaining the SNP detection fragment of the porcine GAB1 gene and establishing a polymorphic site detection method

[0025] 1. Extraction of pig genomic DNA

[0026] The porcine genomic DNA was extracted using the PureLink DNA Extraction Kit (Invitrogen) produced by the company. TM Pro 96 Genomic DNA Purification Kit, K182104A) was used to extract porcine genomic DNA according to the instructions of the kit. The concentration and quality of the extracted DNA were tested and stored at -20°C for future use.

[0027] 2. Obtaining the SNP genetic marker detection fragment of the porcine GAB1 gene

[0028] (1) PCR amplification

[0029] According to the SNP genetic marker detection sequence in the genomic sequence of the porcine GAB1 gene, a pair of primers is designed to amplify the fragment of the polymorphic site.

[0030] Wherein, the nucleotide sequence of the SNP genetic marker detection sequence is:

[0031] TGTTCGCGGAATCTGGTAAGTATTACCCGGCGTGGGAGGAATGTCATAACTCATGGACACATGCCTCATTTGGGTCTCTAAGCTCGCGGTCCCCGATGGCGTGTTGAATACGTAGAGTTCTCCGTCTGCTTCCGTGCTCGAGGGAGACCTTGGGCAGAACATCGTGGGAGAAACTCCTGGGCAGGTTGTAAAGGCTGGAGTCTACAGAAACGACGGGGCTCG, as shown in SEQ ID NO.1.

[0032] The designed primers are as follows:

[0033] Upstream primer: 5'TGTTCGCGGAATCTGGTAAGTATTA 3', as shown in SEQ ID NO.2.

[0034] Downstream primer: 5'CGAGCCCCGTCGTTTCTGTA 3', as shown in SEQ ID NO.3.

[0035] PCR amplification was performed using the above primers and the pig genomic DNA extracted from the ear margin tissue of the pig to be tested as a template. The PCR reaction system was 25 μL, and the components in the system were: 100 ng genomic DNA, 25 μL PCR mix, 1 μL each of the above upstream and downstream primers, and ddH2O was added to make up the total volume to 50 μL.

[0036] The PCR operation program is: 98℃ pre-denaturation for 45s; 98℃ denaturation for 10s, 60℃ annealing for 30s, 72℃ extension for 30s, 40 cycles; 72℃ extension for 5min; 4℃ storage. PCR products were detected by 1.0% agarose gel electrophoresis. The detection results are shown in the attached Figure 1 As shown, lane M is DL1000 Marker, lanes 1-3 are amplified fragments in pigs, and the size of the amplified fragments is 224 bp.

[0037] (2) PCR product purification

[0038] The PCR amplification product was purified using the Gel Extraction Kit from Shanghai Sangon Biotechnology Co., Ltd. For specific steps, see the kit instructions.

[0039] 3. Detection of molecular markers using direct sequencing of PCR products

[0040] The PCR purified products obtained above were directly sent to Beijing Aoke Company for sequencing, and the genotype of the locus in the test population was determined based on the sequencing results. DNA Star software was used for analysis, and the results are shown in the attached Figure 2 As shown, it was found that there was a G112-A112 allele mutation at the 112bp in the sequence shown in SEQID NO.1, namely g.112G>A, and the above mutation caused the polymorphism of the GAB1 gene.

[0041] Example 2 Detection of polymorphic distribution of molecular markers in pigs

[0042] In this example, the polymorphism distribution pattern of the g.112G>A site of the porcine GAB1 gene was detected in 276 pigs with the intramuscular fat content trait. The detection results are shown in Table 1.

[0043] Table 1 Distribution of polymorphism of the GAB1 gene g.112G>A site

[0044]

[0045] From the results in Table 1, we can see that in pigs, the GAB1 gene g.112G>A site shows three genotypes: AA, AG, and GG. Among them, the AA genotype individuals are more numerous, and the frequency of the A allele is 56.9%.

[0046] Example 3 Association analysis between molecular markers and pork quality traits

[0047] In order to determine whether the g.112G>A site of the pig GAB1 gene is related to the difference in pork quality traits, the method established in Example 1 was used to perform polymorphism detection, and the correlation between different genotypes of this polymorphic site and the intramuscular fat content trait was analyzed. The variance analysis of different SNP genotype combinations was performed using the SAS statistical software (SAS Institute Inc, Version 9.4) GLM program, and a significance test was performed. The model used was:

[0048] Yijl=μ+Gi+Wj+eijl;

[0049] Yijl is the phenotypic value of the trait, μ is the mean value, Gi is the genotype effect (including gene additive effect and dominant effect); Wj is the age in days; eijl is the residual effect.

[0050] The association analysis between different genotypes and meat quality traits was conducted in pigs, and the statistical analysis results are shown in Table 2:

[0051] Table 2 Association analysis between the GAB1 gene g.112G>A locus and pork quality traits

[0052]

[0053] Note: The mean values ​​of traits in the table are mean ± standard deviation. Different capital letters in the superscripts indicate significant differences (P<0.01), and * indicates significant differences (P<0.05)

[0054] Table 2 shows that in pigs, the intramuscular fat content of individuals with the AA genotype at the g.112G>A site is significantly higher than that of individuals with the AG and GG genotypes (P<0.05), so the A allele is the dominant allele.

[0055] Example 4 Application of GAB1 gene SNP molecular markers in pork quality trait screening and / or pig breeding

[0056] The SNP molecular marker g.112G>A site on the intron of the GAB1 gene is significantly associated with pork quality traits. Therefore, in the process of pig breeding, this SNP molecular marker can be used to assist in the selection of AA or AG type individuals with good meat quality, and individuals carrying this dominant allele should be retained in breeding, which is beneficial to improving the production performance of the group.

[0057] The specific implementation of the present invention described above does not constitute a limitation on the protection scope of the present invention. Any other corresponding changes and modifications made based on the technical concept of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A SNP molecular marker associated with the pork quality trait gene GAB1, characterized in that: The meat quality trait is the intramuscular fat content trait; the molecular marker is located in the 5th exon of the GAB1 gene on chromosome 8 of the pig, and its nucleotide sequence is shown in the sequence table SEQ ID NO.

1. There is a g.112G>A base mutation at the 112bp of the sequence.

2. The SNP molecular marker associated with the pork quality trait gene GAB1 according to claim 1, characterized in that: The A or G base polymorphic site at the 112th bp in the sequence SEQ ID NO.1 exhibits three genotypes: AA, AG or GG, among which the A allele is the dominant allele.

3. Use of the SNP molecular marker as described in any one of claims 1 or 2 in pork quality trait screening and / or pig breeding.

4. A primer pair for amplifying the molecular marker according to claim 1, characterized in that: The primer pair includes: the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.

3.

5. Use of the primer pair as claimed in claim 4 in pork quality trait screening and / or pig breeding.

6. A kit for rapid breeding using the SNP molecular marker as claimed in claim 1, characterized in that: Comprising the primer pair as claimed in claim 4.

7. A method for screening pork quality traits and / or pig breeding, characterized in that: The following steps are involved: S1. Extract pig genomic DNA; S2, using the genomic DNA obtained in step S1 as a template, performing PCR amplification using the primer pair described in claim 4 to obtain the molecular marker described in claim 1 and purifying it; S3. Perform sequencing analysis on the molecular markers purified in step S2, retain the individuals carrying the A allele at the 112 bp of the sequence, and eliminate the individuals carrying the G allele.

8. The method for screening pork quality traits and / or pig breeding according to claim 7, characterized in that: In step S1, genomic DNA is extracted from the ear margin tissue of the pig to be tested.

9. The method for screening pork quality traits and / or pig breeding according to claim 7, characterized in that: In step S2, the PCR reaction system is 50 μL, and the components in the system are: 100 ng genomic DNA, 25 μL PCR mix, 1 μL each of the upstream and downstream primers mentioned above, and ddH2O is added to make up the total volume to 50 μL; the PCR operation program is: 98°C pre-denaturation for 45 s; 98°C denaturation for 10 s, 60°C annealing for 30 s, 72°C extension for 30 s, 40 cycles; 72°C extension for 5 min; 4°C storage.

Images