RPA (recombinase polymerase amplification) primer for rapidly detecting pasteurella multocida and application of RPA primer

Abstract

The invention discloses an RPA (recombinase polymerase amplification) primer for rapidly detecting pasteurella multocida and application of the RPA primer, and belongs to the technical field of biological detection. The RPA primer comprises a forward primer and a reverse primer, and nucleotide sequences of the forward primer and the reverse primer are sequentially shown as SEQ ID No.5-6. A product amplified by the RPA primer does not need to be recovered and purified, and can be directly subjected to agarose gel electrophoresis detection, so that the operation process is simplified, and the detection time limit is shortened; a detection method constructed according to the RPA primer is high in sensitivity, good in specificity and accurate in result, does not depend on expensive instruments, solves the problems that traditional pasteurella multocida detection needs professionals and other nucleic acid amplification technologies are harsh in reaction conditions, and is suitable for rapid detection of pasteurella multocida in animal waste in a breeding site.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and more particularly to an RPA primer for rapid detection of Pasteurella multocida and application thereof. Background Art

[0002] Pasteurella multocida (P. multocida) is a bacterium belonging to the genus Pasteurella of the family Pasteurellaceae. More than 20 species of Pasteurella have been reported. Pasteurella multocida is the most important livestock and poultry pathogen in this genus. Pasteurella multocida can infect humans and a variety of animals. It is a multi-host and zoonotic pathogen that can cause a variety of livestock and poultry pasteurellosis, manifested as hemorrhagic septicemia or infectious pneumonia. Pasteurella multocida is widely distributed throughout the world and can colonize in the nasopharynx, respiratory tract, gastrointestinal tract and other organs of animals, infecting and causing diseases in livestock, poultry, wild animals, companion animals, etc., such as fowl cholera, swine plague, bovine hemorrhagic septicemia, rabbit hemorrhagic septicemia and hoofed animal pneumonia.

[0003] At present, rapid diagnosis of Pasteurella multocida mostly adopts sample smear staining microscopy. However, due to the large subjective factors of microscopy, low sensitivity and specificity, misjudgment and missed detection often occur. In order to improve the sensitivity and accuracy of detection, molecular biological methods such as bacterial isolation and identification, fluorescent quantitative polymerase chain reaction technology (PCR), loop-mediated isothermal amplification technology (LAMP), enzyme-linked immunosorbent assay (ELISA) are used for the detection of P. multocida. For example, Xu Tenglin, Xing Guiling, Liu Jiasen, et al. ("Establishment and application of TaqMan fluorescent quantitative PCR detection method for Pasteurella multocida") designed primers and TaqMan probes based on the KmtΙ gene of Pm70 strain, and established a fluorescent quantitative PCR method for specific detection of P. multocida, with a minimum detection limit of 1.75×10 1 copies / μL. Wu Haotian, Man Churiga, Liu Ang, et al. (“Establishment and application of double nested PCR detection method for Pasteurella multocida and Brucella in sheep”) established a double nested PCR detection method for P. multocida and Brucella, with a minimum detection limit of 70.9 copies / μL for P. multocida KmtΙ. Wang Jinxiang, Sun Shikun, Chen Yanfeng, et al. (“Establishment of a rapid detection method for F-type Pasteurella multocida from rabbits by loop-mediated isothermal amplification”) established a loop-mediated isothermal amplification (LAMP) detection method for the specific detection of the F-type P. multocidafcbD gene, with a minimum detection limit of 1×10 2 However, most of these methods are time-consuming, have low sensitivity, poor specificity, or rely on expensive equipment, strict experimental conditions, and cumbersome operations.

[0004] Recombinase polymerase amplification (RPA) technology is an in vitro isothermal nucleic acid amplification method with low requirements for implementation conditions. It is more suitable for resource-limited environments and has the advantages of simplicity, rapidity, and sensitivity. It has been used to develop and detect a variety of foodborne microorganisms and animal pathogens. The RPA reaction system contains three enzymes: polymerase, single-stranded DNA binding protein, and recombinase, and the amplification of the target DNA sequence can be completed at a constant temperature. However, in the prior art, in order to avoid interference caused by other substances in the reaction system, resulting in unclear target bands and affecting the result judgment; or due to inappropriate external factors such as primer design or template, the amplification result is not a single band, and the specificity is poor. The product after RPA amplification needs to be recovered and purified before agarose gel electrophoresis (AGE), which prolongs the detection time. Therefore, how to provide an RPA primer for Pasteurella multocida and construct a detection method in which the RPA amplification product is directly used for result analysis is of great significance for providing simplified operation and shortening the detection time limit. Summary of the invention

[0005] In view of the above problems, the present invention provides an RPA primer for rapid detection of Pasteurella multocida and its application, so as to overcome the problem that traditional Pasteurella multocida detection requires professional technicians and other nucleic acid amplification technologies with harsh reaction conditions. A simple, rapid, highly sensitive, specific, accurate method for rapid detection of Pasteurella multocida in animal feces at breeding sites is developed, which is not dependent on expensive instruments.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] RPA primer pair for detecting Pasteurella multocida, including forward primer and reverse primer.

[0008] The nucleotide sequence of the forward primer is shown in SEQ ID No. 5, specifically: TTGAGTTTTATGCCACTTGAAATGGGAAATG;

[0009] The nucleotide sequence of the reverse primer is shown in SEQ ID No. 6, specifically: ACTGACACGATCAAACCGTTGAACACGAGGA.

[0010] Another object of the present invention is to provide the use of the above RPA primer pair in detecting Pasteurella multocida.

[0011] Another object of the present invention is to provide the use of the above RPA primer pair in the preparation of a Pasteurella multocida detection reagent or kit.

[0012] Another object of the present invention is to provide a kit for detecting Pasteurella multocida, comprising the above-mentioned RPA primer pair.

[0013] Preferably, the kit further comprises RPA freeze-dried enzyme powder, Rehydration Buffer, magnesium acetate buffer, ddH2O and a DNA template.

[0014] The RPA freeze-dried enzyme powder is a mixture of recombinase, single-stranded binding protein and DNA polymerase required for the RPA amplification reaction, and exists in the RPA reaction tube in the state of RPA freeze-dried enzyme powder.

[0015] Another object of the present invention is to provide the use of the above kit in detecting Pasteurella multocida.

[0016] Another object of the present invention is to provide a method for rapidly detecting Pasteurella multocida, comprising the following steps:

[0017] (1) Extracting DNA from fecal samples to be tested;

[0018] (2) using the fecal sample DNA extracted in step (1) as a template, and performing RPA amplification using the RPA primers or the kit;

[0019] (3) performing 1% agarose gel electrophoresis on the RPA amplification product of step (2);

[0020] (4) Determine the electrophoresis result of step (3): if there is a band, the fecal sample contains Pasteurella multocida; if there is no band, the fecal sample does not contain Pasteurella multocida.

[0021] Preferably, the reaction system of the RPA amplification in step (2) is 50 μL, specifically: 29.5 μL of Rehydration Buffer, 2.4 μL of upstream and downstream primers each with a concentration of 10 μmol / L, 2 μL of DNA template and 11.2 μL of ddH2O, and 2.5 μL of magnesium acetate buffer with a concentration of 280 nm / L are added sequentially to a reaction tube containing RPA lyophilized enzyme powder, and the mixture is thoroughly mixed.

[0022] Preferably, the reaction process of RPA amplification is: inverting the reaction tube to mix evenly, centrifuging to the bottom of the tube to mix evenly, and placing in a 37° C. water bath for 30 min.

[0023] It can be seen from the above technical scheme that, compared with the prior art, the present invention discloses an RPA primer for rapid detection of Pasteurella multocida and its application. The product amplified by the RPA primer of the present invention does not need to be recovered and purified, and can be directly detected by agarose gel electrophoresis, which simplifies the operation process and shortens the detection time limit; and the detection method constructed according to the RPA primer of the present invention has high sensitivity, good specificity, accurate results, and does not rely on expensive instruments, which overcomes the problem that traditional Pasteurella multocida detection requires professional technicians and other nucleic acid amplification technologies have harsh reaction conditions, and is suitable for the rapid detection method of Pasteurella multocida in animal feces at breeding sites. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 : 1% AGE test results of the amplification products of different RPA primers before and after purification in Example 1, wherein A: 1% AGE test results of the amplification products of Kmt-RPA-F1 / Kmt-RPA-R1 before purification,

[0025] B: 1% AGE test results of Kmt-RPA-F1 / Kmt-RPA-R1 amplification products after purification.

[0026] C: 1% AGE test results of Kmt-RPA-F2 / Kmt-RPA-R2 amplification products before purification.

[0027] D: 1% AGE test results of Kmt-RPA-F3 / Kmt-RPA-R3 amplification products before purification.

[0028] M: DL2000 DNA Marker; 2, 4, 6, 8: negative control (ddH2O);

[0029] Figure 2 : 1% AGE test results of positive plasmid, M: DL2000 DNA Marker; 1: KmtΙ target fragment PCR results; 2: negative control (ddH2O);

[0030] Figure 3 : The screening results of the optimal reaction temperature of RPA in Example 2, wherein 1-7: 15°C, 20°C, 25°C, 30°C, 35°C, 37°C, 40°C, M: DL2000 DNA Marker, 8: negative control (ddH2O);

[0031] Figure 4 : The screening results of the optimal reaction time of RPA in Example 2, wherein 1-7: 10min, 15min, 20min, 25min, 30min, 35min, 40min, M: DL2000 DNA Marker, 8: negative control (ddH2O);

[0032] Figure 5 : The detection results of the sensitivity test of the RPA method in Example 3, wherein M: DL2000 DNA Marker; 1-8: 2.26×10 0 ~2.26×10 7 copies / μL, N: negative control (ddH2O);

[0033] Figure 6 : The detection results of the RPA method specificity test in Example 3, wherein, M: DL2000 DNA Marker, 1-5: Escherichia coli, Listeria, Staphylococcus aureus, Pseudomonas aeruginosa, Salmonella typhimurium, 6: negative control (ddH2O);

[0034] Figure 7 : The test results of the RPA method repeatability test in Example 3, wherein M: DL2000 DNA Marker, 1: 2.26×10 6 copies / μL, 2: 2.26×10 5 copies / μL, 3: 2.26×10 1 copies / μL, 4: negative control (ddH2O);

[0035] Figure 8 : The RPA detection results of Pasteurella multocida in the clinical samples of seed goose feces in Example 4, wherein, M: DL2000 DNA Marker; 1-15: clinical samples; 16: negative control (ddH2O);

[0036] Fig. 9 : The conventional PCR detection results of Pasteurella multocida in the clinical samples of seed goose feces in Example 4, wherein, M: DL2000 DNA Marker; 1-15: clinical samples; 16: negative control (ddH2O). DETAILED DESCRIPTION

[0037] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0038] The reagents involved in the embodiments of the present invention are all purchased from commercial channels, and the methods not mentioned are conventional experimental methods and will not be described in detail here.

[0039] The following is an example description:

[0040] Basic RPA kit was purchased from Twist Dx, UK;

[0041] E. coli DH5α competent cells and pMD-18T vector were purchased from Dalian Bao Bioengineering Co., Ltd.;

[0042] PCR product recovery kit, 2× Taq Plus Master Mix II, DL2000 DNA Marker, and 6× Loading Buffer were purchased from Shanghai Sangon Biotechnology Co., Ltd.;

[0043] Axygen plasmid miniprep kit was purchased from Axygen, USA;

[0044] Martin's broth agar medium and Martin's broth were purchased from Qingdao Haibo Biotechnology Co., Ltd.;

[0045] The composition of LB liquid medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L.

[0046] The flexcycler2 PCR instrument was purchased from Analytik Jena AG, Germany;

[0047] The electric constant temperature water bath was purchased from Shanghai Yiheng Scientific Instrument Co., Ltd.;

[0048] The electrophoresis apparatus was purchased from Beijing Liuyi Biotechnology Co., Ltd.

[0049] Escherichia coli CVCC10141 strain and Salmonella typhimurium SL1344 strain have been published in [“Analysis of antibacterial activity of recombinant bovine lactoferrin peptide expressed in Lactococcus lactis”, Yu Shuyuan, Ji Yutong, Chen Qiuyan, et al., Journal of Microbiology, Vol. 61, No. 2, pp. 428-443];

[0050] Listeria CVCC0586 and Staphylococcus aureus CVCC26003 have been used in [“Expression of porcine lactoferrin in four recombinant lactobacilli and comparison of their antibacterial activities”, Yu Hui, Jiang Yanping, Cui Wen, et al., Chinese Journal of Biotechnology, Vol. 9, Vol. 30, pp. 1372-1380];

[0051] Pseudomonas aeruginosa ATCC9027 strain has been published in [“Synergistic Inhibition of Pseudomonas aeruginosa Biofilm by Combination of Nisin and Honokiol”, Zhu Zekang, Wang Zhao, Nie Rong, et al., Journal of Chinese Institute of Food Science and Technology, Vol. 23, No. 10, pp. 12-22];

[0052] The sheep-derived P. multocida type D has been published in [“Isolation, Identification and Pathogenicity of a Strain of Pasteurella multocida from Sheep”, Zhang Lei, Chen Liang, Jin Zhenhua, et al., Chinese Journal of Animal Husbandry and Veterinary Medicine, Vol. 51, No. 1, pp. 347-356];

[0053] The above strains are all strains preserved by the Animal Husbandry and Veterinary Branch of Heilongjiang Academy of Agricultural Sciences. The public can obtain them through the Animal Husbandry and Veterinary Branch of Heilongjiang Academy of Agricultural Sciences for experiments or research.

[0054] The above six strains were streaked onto Martin broth agar medium and cultured at 37°C for 12-16 h. A single colony was picked out and placed in 5 mL of Martin broth, cultured at 37°C with shaking for 12 h. 1 mL of fresh bacterial solution was aspirated and DNA was extracted according to the instructions of the Genomic DNA Rapid Extraction Kit (Xinhai Gene Detection Co., Ltd.) and stored at -20°C for later use.

[0055] Example 1 Primer screening

[0056] 1.RPA primer design and screening

[0057] By comparing and analyzing the P. multocida KmtΙ gene sequences KX348143.1, KP222299.1, DQ871028.1, and MF776876.1 published on GeneBank, the conserved sequences were further determined, and three sets of specific primers as shown in Table 1 were designed for experimental screening. The primers were synthesized by Sangon Biotechnology Co., Ltd.

[0058] Table 1 RPA primer sequences

[0059]

[0060] The above-extracted sheep-derived D-type P.multocida DNA fragment (88.45 ng / μL) was used as a template, and the three sets of primers in Table 1 were used for RPA amplification. RPA reaction system (50 μL): Rehydration Buffer 29.5 μL, RPA freeze-dried enzyme powder (50 μL system dosage), upstream and downstream primers (10 μmol / L) 2.4 μL each, DNA template 2 μL and ddH2O 11.2 μL, magnesium acetate buffer (280 nm / L) 2.5 μL. The RPA reaction conditions are: pre-mix Rehydration Buffer 2, upstream and downstream primers, DNA template and ddH2O, add to the reaction tube containing freeze-dried enzyme powder, wait until the dry powder is completely dissolved, add magnesium acetate buffer, mix upside down, centrifuge to the bottom of the tube to mix, and place in a 37°C water bath for reaction for 30 minutes. In order to compare the results, the RPA amplification products of the three primer sets were divided into two parts. One part was directly detected by 1% AGE, and the other part was purified and recovered by a PCR product recovery kit and then detected by 1% AGE (1% agarose gel electrophoresis). The results are shown in Figure 1 .

[0061] Depend on Figure 1 It can be seen that after amplification using primers Kmt-RPA-F1 / Kmt-RPA-R1, the same size band (234 bp, Figure 1 A-1B), indicating that the RPA amplification product under the experimental conditions can be directly used for detection without gel recovery and purification. The amplification products of the templates with two pairs of primers Kmt-RPA-F2 / Kmt-RPA-R2 and Kmt-RPA-F3 / Kmt-RPA-R3 were also detected by 1% AGE, and the target genes of the expected sizes (340bp and 371bp) were all visible ( Figure 1 C, D), retaining a longer conservative sequence of the KmtΙ gene is more conducive to obtaining detection results with better specificity, so Kmt-RPA-F3 / Kmt-RPA-R3 were selected for subsequent experiments.

[0062] Example 2 Optimization of RPA reaction conditions

[0063] The above-extracted sheep-derived D-type P.multocida DNA fragment was used as a template, and the KmtΙ gene common PCR-specific primers in "NYT 564-2016 Diagnostic Technology for Swine Pasteurellosis" were used for amplification (the PCR amplification system and procedure were all referred to the above document). The obtained amplified product was purified by a PCR product recovery kit to obtain a 460bp genus-specific KmtΙ gene target fragment, and the recovered target fragment was connected to the pMD 18T vector and thermally transformed into E. coli DH5α competent cells (the operation and conditions of connection and thermal transformation refer to the corresponding instructions), cultured on an LB plate containing 100 μg / mL ampicillin, and a typical colony was picked and inoculated into 5 mL of LB liquid culture medium containing 100 μg / mL ampicillin, and cultured at 37°C with shaking for 10 to 12 hours. The plasmid was extracted from 1 mL of fresh bacterial solution according to the instructions of the Axygen plasmid mini-extraction kit, and sent to Sangon Biotech Co., Ltd. for sequencing analysis while performing PCR identification. The plasmid concentration (ng / μL) was measured using a micro-spectrophotometer and the copy concentration was calculated using the following formula:

[0064]

[0065] The cloned plasmid obtained above was used as a template, and PCR amplification was performed using the common PCR specific primers of the KmtΙ gene. After 1% AGE identification, a target band of 460 bp was shown ( Figure 2 ), and the sequencing results of the plasmid also showed that the target gene was successfully cloned, and the constructed positive plasmid was named pMD 18T-KmtΙ.

[0066] (1) Determination of the optimal reaction temperature

[0067] With a concentration of 2.26×10 9 The pMD 18T-KmtΙ plasmid with a volume of 100 copies / μL was used as a template, and the Kmt-RPA-F3 / Kmt-RPA-R3 in Table 1 was used as primers. The RPA reaction system was the same as in Example 1. The prepared RPA reaction tubes were placed at 15°C, 20°C, 25°C, 30°C, 35°C, 37°C and 40°C, respectively, and the reaction was terminated 30 minutes after the start. The amplification results at different temperatures were detected and determined by 1% AGE to determine the optimal reaction temperature. The results are shown in Figure 3 .

[0068] Depend on Figure 3 It can be seen that specific bands of expected sizes can be observed starting from 20°C, and the content of the amplified product increases with increasing temperature, but there is no obvious change after 30°C. Therefore, 30°C is selected as the most suitable reaction temperature.

[0069] (2) Determination of the optimal reaction time

[0070] With a concentration of 2.26×10 9 The pMD 18T-KmtΙ plasmid with a volume of 1000 copies / μL was used as a template, and the Kmt-RPA-F3 / Kmt-RPA-R3 in Table 1 was used as primers. The RPA reaction system was the same as in Example 1. The prepared RPA reaction tubes were placed in a 25°C water bath, and were taken out and terminated at 5, 10, 15, 20, 25, 30, 35, and 40 minutes, respectively. The amplification results of different reaction times were detected and judged by 1% AGE to determine the optimal reaction time. The results are shown in Figure 4 .

[0071] Depend on Figure 4 It can be seen that the amplification product has a gradual increase trend between 10min and 30min, and the change is not obvious after 30min. At 20min, the specific band is already obvious and clear. Therefore, 20min is selected as the optimal reaction time.

[0072] Example 3 Evaluation of the detection performance of the RPA method

[0073] 1. Sensitivity test

[0074] The concentration is 2.26×10 9 The pMD 18T-KmtΙ plasmid with 10 copies / μL was diluted 10 times in a gradient ratio as an RPA amplification template, and Kmt-RPA-F3 / Kmt-RPA-R3 in Table 1 were used as primers. The RPA reaction system was the same as in Example 1. The prepared RPA reaction tubes were reacted at 30°C for 20 minutes, and the negative control was ddH2O. After the reaction was terminated, it was detected with 1% AGE. The results are shown in FIG. Figure 5 .

[0075] Depend on Figure 5 It can be seen that the concentration is 2.26×10 1 -2.26×10 9 After amplification, the pMD 18T-KmtΙ plasmid with a concentration of 10 copies / μL showed specific bands, and the minimum detection limit of RPA was 2.26×10 1 copies / μL. Compared with the conventional PCR, fluorescence quantitative and isothermal amplification detection methods of P. multocida in the prior art described in the background technology, the rapid detection method established in this experiment still has good sensitivity.

[0076] 2. Specificity test

[0077] The extracted genomic DNA of Escherichia coli, Salmonella choleraesuis, Staphylococcus aureus, Pseudomonas aeruginosa, and Salmonella typhimurium were used as templates, and Kmt-RPA-F3 / Kmt-RPA-R3 in Table 1 were used as primers. The RPA reaction system was the same as in Example 1. The prepared RPA reaction tubes were reacted at 30° C. for 20 minutes, and the negative control was ddH2O. After the reaction was terminated, 1% AGE was used for detection. The results are shown in FIG. Figure 6 .

[0078] Depend on Figure 6 It can be seen that the amplification of the genomic DNA of Escherichia coli, Listeria, Staphylococcus aureus, Pseudomonas aeruginosa and Salmonella typhimurium and the negative control were all negative, indicating that the RPA primers of the present invention have good specificity.

[0079] 3. Repeatability test

[0080] With a concentration of 2.26×10 6 , 2.26×10 5 and 2.26×10 1 The pMD 18T-KmtΙ plasmid with 100 copies / μL was used as a template, Kmt-RPA-F3 / Kmt-RPA-R3 in Table 1 was used as primers, and the RPA reaction system was the same as in Example 1. The prepared RPA reaction tubes were reacted at 30°C for 20 min. The RPA test was repeated 3 times for each concentration of the positive plasmid, and ddH2O was used as a negative control. After the reaction was terminated, 1% AGE was used for detection. The results are shown in FIG. Figure 7 .

[0081] The results showed that the established method had no significant difference in the detection results of the same template and had good repeatability.

[0082] Example 4 Application Test

[0083] Fifteen fecal samples of abnormal seed geese with symptoms such as diarrhea, fever and dyspnea were collected from the breeding goose base in Fulaerji District, Qiqihar City, Heilongjiang Province. The DNA of each sample was extracted using a whole-genome DNA extraction kit as a template, and RPA amplification was performed using the sequences shown in SEQ ID No.5-6 as primers. The RPA reaction system (50 μL): Rehydration Buffer 29.5 μL, RPA lyophilized enzyme powder (50 μL system dosage), upstream and downstream primers (10 μmol / L) 2.4 μL each, DNA template 2 μL and ddH2O11.2 μL, magnesium acetate buffer (280 nm / L) 2.5 μL. The RPA reaction conditions are as follows: pre-mix Rehydration Buffer 2, upstream and downstream primers, DNA template and ddH2O, add to the reaction tube containing freeze-dried enzyme, wait for the dry powder to dissolve completely, add magnesium acetate buffer, mix upside down, centrifuge to the bottom of the tube to mix, and place in a 37°C water bath for 30 minutes. After the reaction is terminated, 1% AGE is used for detection, and ddH2O is used as the negative control. The results are shown in Figure 8 .

[0084] In order to compare the compliance rate of the detection method constructed based on RPA primers in the present invention, PCR detection was performed on the fecal samples of the above-mentioned seed goose according to "NYT 564-2016 Diagnostic Technology of Swine Pasteurellosis". The PCR primers, amplification system and amplification procedure were the same as those in the above-mentioned literature. The results are shown in Fig. 9 .

[0085] Depend on Figure 8 and Fig. 9 It can be seen that the RPA primers and the constructed RPA detection method of the present invention are consistent with the detection results of the national industry standard detection method for ordinary PCR detection of P. multocida disease, and both detected samples 4 and 11 as positive, and the rest as negative. The results of the positive coincidence rate and the negative coincidence rate obtained by the two methods are both 100%, indicating that the RPA detection method for Pasteurella multocida established in this study is equivalent to the conventional molecular detection method, but the RPA detection is simpler and faster, and has stronger field applicability.

[0086] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0087] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. An RPA primer pair for detecting Pasteurella multocida, characterized in that: Including forward primer and reverse primer, The nucleotide sequence of the forward primer is shown in SEQ ID No.5; The nucleotide sequence of the reverse primer is shown as SEQ ID No.

6.

2. Use of the RPA primer pair as claimed in claim 1 in detecting Pasteurella multocida.

3. Use of the RPA primer pair as claimed in claim 1 in preparing a Pasteurella multocida detection reagent or kit.

4. A kit for detecting Pasteurella multocida, characterized in that: Comprising the RPA primer pair as described in claim 1.

5. The kit according to claim 3, characterized in that It also includes RPA freeze-dried enzyme powder, Rehydration Buffer, magnesium acetate buffer, ddH2O and DNA template; the RPA freeze-dried enzyme powder is a mixture of recombinase, single-stranded binding protein and DNA polymerase required for the RPA amplification reaction, and exists in the RPA reaction tube in the state of RPA freeze-dried enzyme powder.

6. Use of the kit as claimed in claim 4 or 5 in detecting Pasteurella multocida.

7. A method for rapid detection of Pasteurella multocida, characterized in that: The following steps are involved: (1) Extracting DNA from fecal samples to be tested; (2) using the fecal sample DNA extracted in step (1) as a template, and performing RPA amplification using the RPA primer pair described in claim 1 or the kit described in claim 4 or 5; (3) performing 1% agarose gel electrophoresis on the RPA amplification product of step (2); (4) Determine the electrophoresis result of step (3): If there are bands, it means that the stool sample contains Pasteurella multocida; If there is no band, it means that the stool sample does not contain Pasteurella multocida.

8. A method for rapid detection of Pasteurella multocida according to claim 7, characterized in that: The reaction system of the RPA amplification in step (2) is 50 μL. Specifically, add 29.5 μL of Rehydration Buffer, 2.4 μL of upstream and downstream primers with a concentration of 10 μmol / L, 2 μL of DNA template and 11.2 μL of ddH2O, and 2.5 μL of magnesium acetate buffer with a concentration of 280 nm / L into the reaction tube containing RPA freeze-dried enzyme powder, and mix thoroughly.

9. A method for rapid detection of Pasteurella multocida according to claim 7 or 8, characterized in that: The reaction process of RPA amplification is as follows: the reaction tube is inverted to mix, centrifuged to the bottom of the tube to mix, and then placed in a 37° C. water bath for 30 minutes.

Images